Construction method and application of zebra fish model

Abstract

The invention discloses a construction method and application of a zebra fish model. The construction method comprises the following steps: taking zebra fish as a model animal, and obtaining a zebra fish model by knocking out a sod1 gene in the zebra fish and / or expressing a human source sod1 gene mutant in the zebra fish; wherein the serial number of the sod1 gene in the zebra fish in an Ensepbl database is ENSDARG00000043848, and the nucleotide sequence of the human source sod1 gene mutant is as shown in SEQ ID NO. 1. The zebrafish can be used for the function research of the sod1 gene in the zebrafish, the function research of the human-derived sod1 gene mutant, the pathological research of amyotrophic lateral sclerosis and the screening of amyotrophic lateral sclerosis resisting drugs.

Description

Technical Field

[0001] This invention relates to a method for constructing a zebrafish model and its application. Background Technology

[0002] Amyotrophic lateral sclerosis (ALS) is an adult-onset, progressive, and fatal neurodegenerative disease caused by the degeneration of motor neurons in the cerebral cortex, brainstem, and spinal cord. ALS is a devastating neurodegenerative disease characterized by progressive degeneration of upper and lower motor neurons in the spinal cord and motor cortex, sometimes extending to the frontal and temporal lobes, manifesting as frontotemporal degeneration (FTD). ALS patients are primarily characterized by progressive limb or bulbar muscle weakness, and die from respiratory failure due to respiratory muscle involvement within an average of 3–5 years after onset. Approximately 10% of ALS cases are familial.

[0003] To date, more than 20 genes have been reported to be associated with the pathogenesis of ALS, among which sod1, tartdp, fus, and ang are of particular interest. Mutations in these genes can cause typical ALS phenotypes. The sod1 gene encodes copper / zinc ion-binding superoxide dismutase, a key enzyme that prevents oxidative damage and reduces mitochondrial superoxide leakage. Mutations in this gene lead to structural instability, altering protein activity and causing enzyme misfolding, resulting in cytotoxicity. Early studies indicated that mutations in the sod1 gene lead to complete loss of protein function. Subsequent in vitro experiments demonstrated that mutated human SOD1 protein (such as the G37R mutation) is active and stable, promoting neuronal apoptosis in a dominant manner. These studies suggest that the pathogenesis of amyotrophic lateral sclerosis may not only involve reduced / lost SOD1 enzyme function but may also be due to increased dominant toxicity of this enzyme.

[0004] Zebrafish (Daniorerio) are tropical freshwater fish belonging to the Cyprinidae family of the order Cypriniformes. They are native to South Asian countries such as India, Pakistan, Bangladesh, and Nepal, located on the southern slopes of the Himalayas. Adults are 3-4 cm in length, slightly spindle-shaped, with a small, slightly pointed head, a short snout, and a delicate, slender body. They are named for the longitudinal dark blue and silver stripes along their sides, resembling those of a zebra. In experimental research, both adult zebrafish and fertilized eggs can be used. After mating, the female's eggs are fertilized externally, and the embryos develop in vitro. Under conditions of 28.5℃, zebrafish embryos can develop normally and relatively quickly. Analysis is based on the morphological changes and organ development during early embryonic development. Zebrafish have a diploid genome, with almost every gene having a functional counterpart that is directly homologous to a human gene. Furthermore, zebrafish exhibit significant similarities to humans in spinal development, growth, and function. It combines the advantages of in vitro methods, such as ease of handling, low cost, and high throughput, with the integrity of a complete living organism, allowing for observation of physiological states early in the development of the nervous system and even throughout its entire development. The zebrafish sod1 gene shows high amino acid sequence homology with the human sod1 gene, making it an excellent model organism for studying ALS-related gene expression. Summary of the Invention

[0005] The purpose of this invention is to provide a method for constructing a zebrafish model and its application.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: A method for constructing a zebrafish model includes the steps of knocking out the sod1 gene in zebrafish and / or expressing a human sod1 gene mutant in zebrafish; the sod1 gene in zebrafish is identified by the Ensembl database number ENSDARG00000043848; the nucleotide sequence of the human sod1 gene mutant is shown in SEQ ID NO.1.

[0007] The above-mentioned method for constructing a zebrafish model includes the following steps: S1: Target sites were selected for the sod1 gene in zebrafish, sgDNA was designed and synthesized, and then sgRNA was obtained by in vitro transcription using sgDNA as a template. S2: sgRNA and Cas9 protein were co-injected into wild-type zebrafish embryos. Genotyping of the microinjected embryos was performed, and successfully chimeric embryos were selected and cultured to adulthood to obtain F0 generation chimeric zebrafish. S3: F0 generation chimeric zebrafish are hybridized with wild-type zebrafish to obtain F1 generation embryos. Genotyping of F1 generation embryos is performed, and heterozygous embryos are selected from F1 generation embryos and cultured to adulthood to obtain F1 generation heterozygous zebrafish. S4: F1 heterozygous zebrafish with identical genotypes were mated to obtain F2 embryos. Genotyping of the F2 embryos was performed to screen for homozygous sod1. - / - sod1 - / - It can be used as a zebrafish model; The nucleotide sequence of the target site is 5'-GTGAAGTGACCGGCACCGTC-3'; the nucleotide sequence of the sgDNA is 5'-GAAATTAATACGACTCACTATAGGGTGAAGTGACCGGCACCGTCGTTTTAGAGC TAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAG TCGGTGCTTTTCACAA-3'.

[0008] Furthermore, the above-mentioned method for constructing a zebrafish model also includes the following steps: S1: The human sod1 gene mutant was ligated into a backbone plasmid containing the Tol2 transposon, the green fluorescent protein gene and the goldfish β-actin promoter to obtain the human sod1 gene mutant expression plasmid. S2: Co-inject human sod1 gene mutant expression plasmid and Tol2 transposase mRNA into sod1 - / - Embryos were screened using a fluorescence microscope after microinjection, and those with green fluorescent signals were cultured to adulthood to obtain positive F0 generation zebrafish. S3: Cross F0 generation zebrafish with wild-type zebrafish to obtain F1 generation embryos. Use a fluorescence microscope to screen F1 individuals to select those with green fluorescence signals. Individuals with green fluorescence signals can be used as zebrafish models. The nucleotide sequence of the human sod1 gene mutant expression plasmid is shown in SEQ ID NO.2.

[0009] The above-mentioned method for constructing a zebrafish model can also be: S1: The human sod1 gene mutant was ligated into a backbone plasmid containing the Tol2 transposon, the green fluorescent protein gene and the goldfish β-actin promoter to obtain the human sod1 gene mutant expression plasmid. S2: Human sod1 gene mutant expression plasmid and Tol2 transposase mRNA were co-injected into wild-type zebrafish embryos. The microinjected embryos were screened using a fluorescence microscope. Embryos with green fluorescent signals were selected and cultured to adulthood to obtain positive F0 generation zebrafish. S3: Cross F0 generation zebrafish with wild-type zebrafish to obtain F1 generation embryos. Use a fluorescence microscope to screen F1 individuals to select those with green fluorescence signals. Individuals with green fluorescence signals can be used as zebrafish models. The nucleotide sequence of the human sod1 gene mutant expression plasmid is shown in SEQ ID NO.2.

[0010] The above-mentioned construction methods have applications in preparing zebrafish growth and development defect models, preparing zebrafish movement disorder models, preparing zebrafish amyotrophic lateral sclerosis (ALS) models, studying the function of the sod1 gene in zebrafish, and studying the function of human sod1 gene mutants.

[0011] The zebrafish model obtained using the above construction method has been applied in zebrafish sod1 gene function research, human sod1 gene mutant function research, pathological research of amyotrophic lateral sclerosis (ALS), and screening of anti-ALS drugs. Attached Figure Description

[0012] Figure 1 WT, sod1 + / - ,sod1 - / - Target sequence mutation analysis.

[0013] Figure 2 WT and SOD1 for 3dpf and 5dpf + / - ,sod1 - / - Phenotypic and morphological characteristics analysis. A: White light microscope photograph, scale bar 500 μm; BC: Body length, head area, eye area, otolith area.

[0014] Figure 3 WT and SOD1 with a 5dpf resolution + / - ,sod1 - / - The results of the motion trajectory experiment. A: Motion trajectory; B: Motion trajectory heatmap; C: Total motion distance; D: Average motion speed; E: Change in average motion distance per minute; F: Relationship between relative motion time and total time.

[0015] Figure 4 WT and SOD1 with a 5dpf resolution + / - ,sod1 - / -The results of mRNA expression level detection of zebrafish sod1 gene and ALS-related genes. A: zebrafish sod1 gene; B: ALS classical related gene ZDB-GENE-040426-1010 (fus); C: ALS classical related gene ZDB-GENE-030131-3777 (tardbpb); D: Oxidative stress related gene ZFIN: ZDB-GENE-070620-4 (slc25a17); E: Oxidative stress related gene ZDB-GENE-010302-3 (agxtb); F: Autophagy related gene ZDB-GENE-051030-72 (atg10).

[0016] Figure 5 Schematic diagram of the structure of the hsod1 gene (mutant) expression plasmid.

[0017] Figure 6 3dpf's WT, hsod1 G38R Positive F0 generation, hsod1 H44R Positive F0 generation, hsod1 E101G Positive F0 generation, hsod1 L145F Phenotypic and morphological characteristics analysis of positive F0 generation. A: White light microscope image, scale bar 500 μm; B: Fluorescence microscope image, scale bar 500 μm.

[0018] Figure 7 3dpf's WT, hsod1 G38R Positive F1 generation, hsod1 H44R Positive F1 generation, hsod1 E101G Positive F1 generation, hsod1 L145F Phenotypic and morphological analysis of positive F1 generation. A: White light microscope and fluorescence microscope images, scale bar 500 μm; B: Body length; C: Eye area; D: Head area; E: Otolith area.

[0019] Figure 8 WT and hsod1 with a 5dpf resolution G38R Positive F1 generation, hsod1 H44R Positive F1 generation, hsod1 E101G Positive F1 generation, hsod1 L145F Results of the motion trajectory experiment for positive F1 generation. A: Motion trajectory; B: Motion trajectory heatmap; C: Total motion distance; D: Average motion speed; E: Change in average motion distance per minute; F: Relationship between relative motion time and total time.

[0020] Figure 9 WT and hsod1 with a 5dpf resolution H44R Positive F1 generation, hsod1 L145FThe results of mRNA expression levels of sod1, hsod1 (mutant), and ALS-related genes in positive F1 generation zebrafish. A: zebrafish sod1 gene; B: hsod1 gene (mutant); C: fus gene; D: tardbpb gene; E: slc25a17 gene; F: agxtb gene.

[0021] Figure 10 3dpf's WT, sod1 - / - ,sod1 - / - +hsod1 positive F1 generation, sod1 - / - +hsod1 H44R Positive F1 generation, sod1 - / - +hsod1 145F Phenotypic and morphological analysis of positive F1 generation. A: White light microscope and fluorescence microscope images, scale bar 500 μm; B: Body length; C: Eye area; D: Head area; E: Otolith area.

[0022] Figure 11 WT and SOD1 with a 5dpf resolution - / - ,sod1 - / - +hsod1 positive F1 generation, sod1 - / - +hsod1 H44R Positive F1 generation, sod1 - / - +hsod1 145F Results of the motion trajectory experiment for positive F1 generation. A: Motion trajectory; B: Motion trajectory heatmap; C: Total motion distance; D: Average motion speed; E: Change in average motion distance per minute; F: Relationship between relative motion time and total time.

[0023] Figure 12 WT and SOD1 with a 60dpf resolution - / - ,sod1 - / - +hsod1 145F Results of the movement trajectory experiment of positive F1 generation. A: Movement trajectory; B: Movement trajectory heatmap; C: Total movement distance; D: Change in average movement distance per minute.

[0024] Figure 13 WT and SOD1 with a 5dpf resolution - / - ,sod1 - / - +hsod1 positive F1 generation, sod1 - / - +hsod1 H44R Positive F1 generation, sod1 - / - +hsod1 145FThe results of mRNA expression levels of sod1, hsod1 (mutant), and ALS-related genes in positive F1 generation zebrafish. A: zebrafish sod1 gene; B: hsod1 gene (mutant); C: tardbpb gene; D: fus gene; E: agxtb gene.

[0025] Significance: ns = no significant difference; * = P < 0.05; ** = P < 0.01; *** = P < 0.001; **** = P < 0.0001. Detailed Implementation

[0026] To make the content of this invention easier to understand, the technical solution of this invention will be further described below in conjunction with specific embodiments, but this invention is not limited thereto.

[0027] It should be noted that the plasmids obtained by the inventors during the research and development process were obtained through various cross-combinations and adjustments of gene sequences and fragments. Some specific acquisition processes are trade secrets and will not be described in detail. Those skilled in the art can also synthesize them directly according to the disclosure of this invention, without affecting the realization of this invention, only increasing the cost.

[0028] The target sequence upstream and downstream detection primer sequences used in this embodiment of the invention are: forward primer: 5'-TCACGTGCCTCCTCTTATCAAACA-3', reverse primer: 5'-TGGGATGCGACATTGCACAAAATA-3'.

[0029] Example 1: 1. Knockout of the sod1 gene in zebrafish S1: In the sod1 gene protein coding region (ENSDARG00000043848) on the zebrafish chromosome, based on target prediction and confirmation of target specificity, 5'-GTGAAGTGACCGGCACCGTC-3' was selected as the target site, and sgDNA was synthesized as: 5'-GAAATTAATACGACTCACTATAGGGTGAAGTGACCGGCACCGTCGTTTTAGAGCTAGA AATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGG TGCTTTTCACAA-3'. The sgDNA was transcribed into sgRNA in vitro using a T7 transcription kit and then purified and recovered.

[0030] S2: Mix sgRNA at a final concentration of 100 ng / μL with Cas9 protein at a final concentration of 3.33 μM (derived from...). The SpyCas9 NLS kit was mixed and injected microinjected into wild-type zebrafish embryos at 0.25 hpf (hours post-fertilization). The injected embryos were placed in culture medium and incubated at 28°C. Embryo phenotypes were observed under a stereomicroscope. Genomic DNA was extracted from embryos with normal phenotypes at 2 dpi (day after injection). Using these embryos as templates, PCR amplification was performed using upstream and downstream primers for target sequence detection. After PCR electrophoresis, clear bands without impurities were observed, followed by sequencing. The sequencing results were compared with the wild-type zebrafish genome. Successfully chimeric embryos were selected and cultured to adulthood to obtain F0 generation chimeric zebrafish.

[0031] S3: F0 generation chimeric zebrafish were hybridized with wild-type zebrafish, and the resulting F1 generation embryos were collected. Genomic DNA was then extracted from each F1 generation embryo at 48 hpf. Using these embryos as templates, PCR amplification was performed using upstream and downstream primers for target sequence detection. After nucleic acid electrophoresis, the PCR products were sequenced after the bands were clear and free of impurities. The sequencing results were compared with the genome of wild-type zebrafish to screen out heterozygous embryos from the F1 generation and cultured them to adulthood to obtain F1 generation heterozygous zebrafish.

[0032] S4: Genotype-identical F1 heterozygous zebrafish were mated 1:1 (male to female), and the resulting F2 embryos were collected. After the F2 embryos reached adulthood, their tails were harvested to extract genomic DNA. Using this DNA as a template, PCR amplification was performed using upstream and downstream primers for target sequence detection. After nucleic acid electrophoresis, the PCR products were sequenced, and the sequences were compared with those of wild-type zebrafish. Wild-type (WT) and heterozygous (sod1) zebrafish were screened for their genomes. + / - ) and homozygotes (sod1) - / - ).like Figure 1 As shown, compared to WT, sod1 - / - There is a 5bp deletion mutation in the target sequence.

[0033] 2. Phenotypic and morphological trait analysis: WT and SOD1 at 3 dpf and 5 dpf. + / - ,sod1 - / - The results of the phenotypic and morphological trait analysis are as follows: Figure 2 As shown in the figure. WT, as a control, showed normal growth and development. As can be seen from the figure, sod1 + / - and sod1 - / - The body length, eye area, head area, and otolith area were all significantly lower than WT; compared to sod1 + / - sod1 - / - The growth and developmental defects they exhibit are more severe.

[0034] 3. Motion trajectory analysis WT and SOD1 with 5dpf respectively + / - ,sod1 - / - The samples were placed in 48-well plates, with 800 μL of 1×E3 medium added to each well. Images were captured using the Noldus animal motion tracking system (EthoVisionXT), and analyzed using the zebrafish motion tracking system (DanioVision). The results are as follows: Figure 3 As shown in the figure. It can be seen from the figure that, compared to WT, sod1 + / - and sod1 - / - The movement trajectory was significantly reduced and the movement pattern was significantly changed, sod1 - / - The movement trajectory is more concentrated; sod1 + / - and sod1 - / - The total movement distance and average movement speed were significantly lower than WT, and the average movement distance per minute and relative movement time were also significantly lower than WT; compared to sod1 + / - sod1 - / - The motor impairments were more severe.

[0035] 4. Detection of zebrafish sod1 gene and ALS-related genes Extract WT and SOD1 at 5dpf respectively + / - ,sod1 - / - Total RNA was used as a template for RT-qPCR to detect the mRNA expression levels of zebrafish sod1, fus, tardbpb, slc25a17, agxtb, and atg10 genes. The results are as follows: Figure 4 As shown in the figure. It can be seen from the figure that, compared to WT, the expression of the sod1 gene in zebrafish is significantly lower. + / - With sod1 - / - Significantly downregulated expression of fus, slc25a17, and atg10 genes in sod1 + / - With sod1 - / - Significantly upregulated expression of tardbpb and agxtb genes in sod1 - / - The value of the medium-sized enterprises (SMEs) has also been significantly increased.

[0036] Example 2: 1. Expression of human sod1 gene or its mutant S1 in zebrafish: Total RNA was extracted from HEK293 cells and reverse transcribed into cDNA. Using this cDNA as a template, PCR amplification was performed using primers 5'-atggcgacgaaggccgt gtg-3' and 5'-ttattgggcgatcccaattacaccac-3' to obtain the human sod1 gene, i.e., the hsod1 gene. (5'-atggcgacgaaggccgtgtgcgtgctgaagggcgacggcccagtgcagggcatcatcaatttcgagcagaaggaaagtaatggaccagtg) aaggtgtggggaagcattaaaggactgactgaaggcctgcatggattccatgttcatgagtttggagataatacagcaggctgtaccagtgcaggtcctcactttaatcctctatccagaaaacacggtgggccaaaggatgaagaggcatgttggagacttgggcaatgtgactgctgacaaagatggtgtggccgatgtgtctattgaagattctgtgatctcactctcaggagagaccattgcatcattggccgcacactggtggtccatgaaaaagcagatgacttgggcaaaggtggaaatgaagaaagtacaaagacaggaaacgctggaagtcgtttggcttgtggtgtaattgggatcgcccaataa-3'; Site-directed mutagenesis was performed on the hsod1 gene to create the hsod1 gene mutant hsod1. L145F hsod1 G38R hsod1 H44R and hsod1 E101G Among them, hsod1 L145F The nucleotide sequence is shown in SEQ ID NO.1.

[0037] S2: Using the pEASY-Basic Seamless Cloning and Assembly Kit, the hsod1 gene or its mutant hsod1 was cloned. L145F hsod1 G38R hsod1 H44R or hsod1 E101G The expression plasmid was obtained by linking it to a backbone plasmid containing the Tol2 transposon, the green fluorescent protein gene, and the goldfish β-actin promoter; among which, hsod1L145F See the schematic diagram of the expression plasmid structure. Figure 5 Its nucleotide sequence is shown in SEQ ID NO.2.

[0038] S3: Tol2 transposase mRNA was synthesized in vitro via transcription, and its nucleotide sequence is shown in SEQ ID NO.3.

[0039] S4: The expression plasmid at a final concentration of 50–75 ng / μL was mixed with Tol2 transposase mRNA at a final concentration of 100–150 ng / μL and injected into wild-type zebrafish embryos at 0.25 hpf using microinjection. The injected embryos were placed in culture medium and cultured at 28°C. Phenotypic characteristics were observed using a fluorescence microscope at 48 hpf. Embryos exhibiting green fluorescence signals were selected and cultured to adulthood to obtain positive F0 generation zebrafish.

[0040] S5: Positive F0 generation zebrafish were crossed with wild-type zebrafish to obtain F1 generation embryos. At 48 hpf, the phenotype was observed using a fluorescence microscope, and individuals with green fluorescent signals were screened to obtain positive F1 generation zebrafish.

[0041] 2. Phenotypic and morphological trait analysis 3dpf's WT, hsod1 G38R Positive F1 generation, hsod1 H44R Positive F1 generation, hsod1 E101G Positive F1 generation, hsod1 L145F The phenotypic and morphological characteristics of the positive F1 generation are as follows: Figure 7 As shown in the figure. WT, as a control, showed normal growth and development. As can be seen from the figure, hsod1 G38R Positive F1 generation, hsod1 L145F The body length, eye area, and head area of ​​the positive F1 generation were significantly lower than those of the WT, hsod1 L145F The otolith area of ​​positive F1 offspring was also significantly lower than that of WT; hsod1 H44R Positive F1 generation, hsod1 E101 There were no significant differences in body length, eye area, head area, and otolith area between the G-positive F1 generation and the WT generation.

[0042] 3. Motion trajectory analysis Referring to the method in Example 1, the WT and hsod1 of 5dpf were analyzed. G38R Positive F1 generation, hsod1 H44R Positive F1 generation, hsod1 E101G Positive F1 generation, hsod1 L145F The positive F1 generation was subjected to motion trajectory analysis, and the results are as follows: Figure 8 As shown in the figure. It can be seen from the figure that, compared to WT, hsod1G38R Positive F1 generation, hsod1 H44R Positive F1 generation, hsod1 E101G Positive F1 generation, hsod1 L145F The movement trajectories of positive F1 offspring were significantly reduced and showed more concentrated hotspot areas; hsod1 G38R Positive F1 generation, hsod1 H44R Positive F1 generation, hsod1 E101G The total distance and average speed of the positive F1 generation were not significantly different from those of the WT generation. L145F The total distance and average speed of the positive F1 generation were significantly lower than those of the WT generation; compared with the WT generation, hsod1 H44R Positive F1 generation, hsod1 E101 G positive F1 generation, hsod1 L145F The average distance per minute and relative movement time of the positive F1 generation were significantly reduced, and hsod1 E101G The average distance per minute and relative movement time of positive F1 generation are less affected.

[0043] 4. Detection of zebrafish sod1 gene, hsod1 gene (mutant), and ALS-related genes: Following the method in Example 1, the WT and hsod1 genes of 5 dpf zebrafish were analyzed. H44R Positive F1 generation, hsod1 L145F The expression levels of sod1 and ALS-related genes mRNA in the positive F1 generation of zebrafish were detected, and the expression level of hsod1 gene (mutant) mRNA was also detected. The results are as follows: Figure 9 As shown in the figure. It can be seen from the figure that the expression of the endogenous zebrafish sod1 gene is higher in WT and hsod1. H44R Positive F1 generation, hsod1 L145F There were no significant differences among positive F1 generations; compared with WT, the expression of the hsod1 gene (mutant) was significantly lower in hsod1. H44R Positive F1 generation, hsod1 145F Significantly upregulated in the positive F1 generation; compared with WT, the expression of fus and agxtb genes was significantly higher in hsod1. H44R Positive F1 generation, hsod1 145F Significant downregulation of tardbpb gene expression in the positive F1 generation was observed in hsod1. H44R Significantly downregulated in positive F1 generations but in hsod1 145F Significantly upregulated slc25a17 gene expression in the positive F1 generation was observed in hsod1. H44R Positive F1 generation, hsod1 145F Significant upregulation was observed in the positive F1 generation.

[0044] Example 3: 1. Expressing the hsod1 gene or its mutant S1 based on the knockout of the zebrafish sod1 gene: Construct a zebrafish sod1 gene knockout homozygous mutant, i.e., sod1, according to the method in Example 1. - / - .

[0045] S2: Construct expression plasmids according to the method in Example 2, and synthesize Tol2 transposase mRNA in vitro by transcription.

[0046] S3: Mix the expression plasmid at a final concentration of 50–75 ng / μL with Tol2 transposase mRNA at a final concentration of 100–150 ng / μL, and inject the mixture into sod1 using microinjection. - / - Zebrafish embryos at 0.25 hpf were injected. The injected embryos were placed in culture medium and cultured at 28°C. The phenotype was observed using a fluorescence microscope at 48 hpf. Embryos with green fluorescent signals were selected and cultured to adulthood to obtain positive F0 generation zebrafish.

[0047] S4: Mix positive F0 generation zebrafish with sod1 - / - Zebrafish were hybridized to obtain F1 generation embryos. At 48 hpf, the phenotype was observed using a fluorescence microscope, and individuals with green fluorescent signals were screened to obtain positive F1 generation zebrafish.

[0048] sod1 - / - +hsod1 indicates a positive F1 generation obtained by expressing the hsod1 gene after knocking out the sod1 gene in zebrafish; sod1 - / - +hsod1 H44R This indicates the expression of hsod1 based on the knockout of the sod1 gene in zebrafish. H44R The resulting positive F1 generation; sod1 - / - +hsod1 L145F This indicates the expression of hsod1 based on the knockout of the sod1 gene in zebrafish. L145F The resulting positive F1 generation.

[0049] 2. Phenotypic and morphological trait analysis 3dpf WT, sod1 - / - ,sod1 - / - +hsod1 positive F1 generation, sod1 - / - +hsod1 H44R Positive F1 generation, sod1 - / - +hsod1 L145F The phenotypic and morphological characteristics of the positive F1 generation are as follows: Figure 10 As shown in the figure. WT, as a control, showed normal growth and development. As can be seen from the figure, sod1 - / -+hsod1 positive F1 generation only had a significantly shorter body length than WT, but no significant difference in eye area, head area, and otolith area compared to WT; sod1 - / - +hsod1 H44R Positive F1 generation, sod1 - / - +hsod1 145F Positive F1 offspring had significantly smaller body length, eye area, head area, and otolith area than WT; compared to sod1 - / - +hsod1 H44R Positive F1 generation, sod1 - / - +hsod1 145F A positive F1 indicates a more severe growth and developmental defect.

[0050] 3. Motion trajectory analysis Referring to the method in Example 1, the WT and SOD1 of 5dpf were tested. - / - ,sod1 - / - +hsod1 positive F1 generation, sod1 - / - +hsod1 H44R Positive F1 generation, sod1 - / - +hsod1 L145F The positive F1 generation was subjected to motion trajectory analysis, and the results are as follows: Figure 11 As shown in the figure. It can be seen from the figure that, compared to WT, sod1 - / - The movement trajectories and movement areas of the +hsod1 positive F1 offspring showed no significant differences. - / - +hsod1 H44R Positive F1 generation, sod1 - / - +hsod1 L145F The movement trajectories of positive F1 offspring were significantly reduced and exhibited more concentrated hotspot areas; sod1 - / - The total range and average speed of the F1 generation of positive hsod1 were not significantly different from those of the WT generation. - / - +hsod1 H44R Positive F1 generation, sod1 - / - +hsod1 L145F The total distance and average speed of the positive F1 generation were significantly lower than those of the WT generation; compared with the WT generation, sod1 - / - The average distance per minute and relative movement time of the F1 generation positive for hsod1 showed little variation. - / - +hsod1 H44R Positive F1 generation, sod1 - / - +hsod1 L145F The average distance and relative movement time per minute of positive F1 offspring were significantly reduced; compared to sod1 - / - +hsod1 H44RPositive F1 generation, od1 - / - +hsod1 L145F A positive F1 indicates a more severe motor impairment.

[0051] WT and SOD1 with 60 dpf respectively - / - ,sod1 - / - +hsod1 L145F Positive F1 generation was placed in a container with a base area of ​​approximately 30 cm². 2 The aquarium was filled with water to allow the fish to swim freely. The water temperature was 28.5±3℃. After a 5-minute acclimatization period, the movement was recorded for 5 minutes. Motion tracking software (DanioVision, Noldus) was used to analyze the movement trajectory. The results are as follows: Figure 12 As shown in the figure. It can be seen from the figure that, compared to WT, sod1 - / - ,sod1 - / - +hsod1 L145F Positive F1 generation individuals exhibited more concentrated movement trajectories, significantly reduced total movement distance, and markedly reduced average movement distance per minute.

[0052] 4. Detection of zebrafish sod1 gene, hsod1 gene (mutant), and ALS-related genes: Following the method in Example 1, the WT and sod1 genes of 5 dpf zebrafish were analyzed. - / - ,sod1 - / - +hsod1 positive F1 generation, sod1 - / - +hsod1 H44R Positive F1 generation, sod1 - / - +hsod1 L145F The expression levels of sod1 and ALS-related genes mRNA in the positive F1 generation of zebrafish were detected, and the expression level of hsod1 gene (mutant) mRNA was also detected. The results are as follows: Figure 13 As shown in the figure, compared with WT, the expression of the endogenous zebrafish sod1 gene is significantly lower in sod1. - / - +hsod1 positive F1 generation, sod1 - / - +hsod1 H44R Positive F1 generation, sod1 - / - +hsod1 L145F Significantly downregulated in the positive F1 generation, hsod1 gene (mutant) expression is present in sod1. - / - +hsod1 positive F1 generation, sod1 - / - +hsod1 H44R Positive F1 generation, sod1 - / - +hsod1 L145F Significantly upregulated in positive F1 generations; compared with WT, tardbpb gene expression was significantly upregulated in sod1. - / -+hsod1 positive F1 generation, sod1 - / - +hsod1 H44R Significantly downregulated in positive F1 generations but in SOD1 - / - +hsod1 L145F Significantly upregulated in positive F1 generation; expression of fus and agxtb genes was significantly upregulated in WT and sod1. - / - +hsod1 positive F1 generation, sod1 - / - +hsod1 H44R Positive F1 generation, sod1 - / - +hsod1 L145F There were no significant differences among the positive F1 generations.

[0053] In summary, this invention knocks out the sod1 gene in wild-type zebrafish, thereby obtaining a zebrafish sod1 gene knockout homozygous mutant. - / - ; hsod1 L145F An expression plasmid was obtained by ligating it into a backbone plasmid containing the Tol2 transposon, the green fluorescent protein gene, and the goldfish β-actin promoter. This plasmid, along with the Tol2 transposon mRNA, was then introduced into wild-type zebrafish embryos to cultivate hsod1. L145F Positive F1 generation; hsod1 L145F An expression plasmid was obtained by ligating it into a backbone plasmid containing the Tol2 transposon, the green fluorescent protein gene, and the goldfish β-actin promoter. This plasmid, along with the Tol2 transposon mRNA, was then introduced into sod1. - / - SOD1 was obtained from embryos. - / - +hsod1 L145F Positive F1 generation. sod1 - / - hsod1 L145F Positive F1 generation, sod1 - / - +hsod1 L145F The positive F1 generation successfully mimicked the core phenotype of amyotrophic lateral sclerosis (ALS)—motor impairment—and its ALS-related gene expression levels differed somewhat from wild-type zebrafish. Furthermore, compared to wild-type zebrafish, sod1... - / - hso d1 L145F Positive F1 generation, sod1 - / - +hsod1 L145F The positive F1 generation showed obvious growth and development defects.

Claims

1. A method for constructing a zebrafish model, characterized in that: Including knockout of zebrafish sod1 Genes and / or human-derived genes expressed in zebrafish sod1 The steps of gene mutants; in the zebrafish sod1 The gene's ID in the Ensembl database is ENSDARG00000043848; the human source... sod1 The nucleotide sequence of the gene mutant is shown in SEQ ID NO.

1.

2. The construction method according to claim 1, characterized in that: Includes the following steps: S1: For zebrafish sod1 Genes are selected to target sites, sgDNA is designed and synthesized, and then sgDNA is used as a template for in vitro transcription to obtain sgRNA; S2: sgRNA and Cas9 protein were co-injected into wild-type zebrafish embryos. Genotyping of the microinjected embryos was performed, and successfully chimeric embryos were selected and cultured to adulthood to obtain F0 generation chimeric zebrafish. S3: F0 generation chimeric zebrafish are hybridized with wild-type zebrafish to obtain F1 generation embryos. Genotyping of F1 generation embryos is performed, and heterozygous embryos are selected from F1 generation embryos and cultured to adulthood to obtain F1 generation heterozygous zebrafish. S4: Mating male and female F1 heterozygous zebrafish with the same genotype yields F2 embryos. Genotyping of the F2 embryos is then performed to screen for homozygotes. sod1 - / - , sod1 - / - It can be used as a zebrafish model.

3. The construction method according to claim 2, characterized in that: The nucleotide sequence of the target site is 5'-GTGAAGTGACCGGCACCGTC-3'; the nucleotide sequence of the sgDNA is 5'-GAAATTAATACGACTCACTATAGGGTGAAGTGACCGGCACCGTCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTCACAA-3'.

4. The construction method according to claim 2, characterized in that: The construction method further includes the following steps: S1: Human Resources sod1 The gene mutant was ligated into a backbone plasmid containing the Tol2 transposon, the green fluorescent protein gene, and the goldfish β-actin promoter to obtain human-derived [genes / products]. sod1 Gene mutant expression plasmids; S2: Human Resources sod1 Gene mutant expression plasmid and Tol2 transposase mRNA were co-injected into sod1 - / - Embryos were screened using a fluorescence microscope after microinjection, and those with green fluorescent signals were cultured to adulthood to obtain positive F0 generation zebrafish. S3: Cross F0 generation zebrafish with wild-type zebrafish to obtain F1 generation embryos. Use a fluorescence microscope to screen F1 individuals to select those with green fluorescence signals. Individuals with green fluorescence signals can be used as zebrafish models.

5. The construction method according to claim 4, characterized in that: The source of people sod1 The nucleotide sequence of the gene mutant expression plasmid is shown in SEQ ID NO.

2.

6. The construction method according to claim 1, characterized in that: Includes the following steps: S1: Human Resources sod1 The gene mutant was ligated into a backbone plasmid containing the Tol2 transposon, the green fluorescent protein gene, and the goldfish β-actin promoter to obtain human-derived [genes / products]. sod1 Gene mutant expression plasmids; S2: Human Resources sod1 The gene mutant expression plasmid and Tol2 transposase mRNA were co-injected into wild-type zebrafish embryos. The microinjected embryos were screened using a fluorescence microscope, and embryos with green fluorescent signals were cultured to adulthood to obtain positive F0 generation zebrafish. S3: Cross F0 generation zebrafish with wild-type zebrafish to obtain F1 generation embryos. Use a fluorescence microscope to screen F1 individuals to select those with green fluorescence signals. Individuals with green fluorescence signals can be used as zebrafish models.

7. The construction method according to claim 6, characterized in that: The source of people sod1 The nucleotide sequence of the gene mutant expression plasmid is shown in SEQ ID NO.

2.

8. The construction method described in claim 1 is applicable to the preparation of zebrafish growth and development defect models, zebrafish movement disorder models, zebrafish amyotrophic lateral sclerosis (ALS) models, and the study of zebrafish... sod1 Gene function, research on human origins sod1 Applications of gene mutants in functional aspects.

9. The zebrafish model obtained using the construction method described in claim 1 in zebrafish sod1 Gene function research, human origin sod1 Applications in gene mutant function research, pathological research of amyotrophic lateral sclerosis (ALS), and screening of anti-ALS drugs.

Images