GlycoRNA detection platform of nonlinear hybrid chain reaction circuit based on proximity coding and application of GlycoRNA detection platform

Abstract

The invention discloses a GlycoRNA detection platform of a nonlinear hybrid chain reaction circuit based on proximity coding and application of the GlycoRNA detection platform, the GlycoRNA detection platform is composed of a recognition module and an assembly module, the recognition module comprises a glycan probe for triggering a nonlinear HCR reaction and an RNA specific probe, the glycan probe comprises an aptamer for selectively binding N-acetylneuraminic acid, a spacer region, a binding region and a trigger region, the RNA specific probe contains a DNA (Deoxyribose Nucleic Acid) sequence complementary with an RNA sequence of GlycoRNA, a spacer region, a hybridization region and a trigger region; the assembly module comprises two double-stranded substrates and two single-stranded assistants; each double-stranded substrate is composed of a DNA chain marked by a quenching agent and a DNA chain marked by a fluorophore. The method does not need enzyme, solves the actual limitation related to enzymatic reaction, saves time, simplifies the process, and has high sensitivity and high specificity.

Description

Technical Field

[0001] This invention belongs to the field of biomaterials technology, specifically relating to a GlycoRNA detection platform and its application based on a nonlinear hybridization chain reaction circuit with proximity coding. Background Technology

[0002] Recent advances in RNA glycobiology have revealed the presence of cell-surface glycoRNAs and elucidated the chemical linkages between N-glycans and RNA, defining the structural characterization of glycoconjugates. These studies demonstrate that glycosylation, a form of post-transcriptional modification, confers function and influences cell growth, development, differentiation, cell-cell interactions, and tumor immune regulation. In exploring the functions of glycoRNAs, Ma et al. investigated their intracellular transport mechanisms and found downregulation of glycoRNAs during breast cancer progression and malignant transformation, as well as their biological significance in monocyte-endothelial cell interactions. Zhang et al. investigated the biological role of glycoRNAs in neutrophil recruitment, linking it to P-selectin-mediated neutrophil-endothelial cell interactions essential for innate immunity. These findings highlight the profound functional significance of glycoRNAs in cell-cell signaling and their regulatory role in key biological processes, such as maintaining immune homeostasis. Considering that intercellular communication occurs not only through direct contact-dependent signaling but also through paracrine, autocrine, and synaptic signaling, we hypothesize that other agents involving surface glycoRNAs may help expand the palette of extracellular signaling mediating these functions.

[0003] Exosomes have been identified as key extracellular mediators in many physiological or pathophysiological processes, acting as messengers over both short and long distances. The surface molecules carried by these extracellular vesicles reflect the surface molecular composition of their originating cells, suggesting that their surfaces may also contain glycoRNAs. Studying the presence and function of glycoRNAs on the exosome surface can provide valuable insights into their biological roles and their involvement in cancer and immunity. To date, various chemical tools for labeling glycoRNAs have been developed, facilitating their discovery and characterization on cell surfaces. Notably, sialic acid-specific metabolic chemical reporter gene (MCR) N-azidoacetylmannosamine (Ac4ManNAz) and optimized periodate oxidation and aldehyde linkage strategies have been used to label glycoRNAs. However, their limitations are evident. First, MCRs can only be absorbed by metabolically active cells and then biosynthesized and integrated into nascent biopolymers such as glycans. This means that this method cannot be directly applied to biological or clinical samples, nor can it be visualized. Furthermore, Ma et al. introduced a labeling technique for in situ visualization of glycoRNAs, called ARPLA. This method involves a complex coupling workflow, including multi-step enzymatic reactions catalyzed by T4 ligase and phi29 DNA polymerase. However, high preparation costs, instability, and inadequate storage conditions limit the practical application of these methods. To address these challenges, the detection of glycoRNAs at the single-cell level is essential to improve the visualization of glycoRNAs at the organelle and extracellular vesicle levels. Furthermore, simpler procedures need to be developed to examine their spatial distribution and functional characteristics across multiple scales. Summary of the Invention

[0004] To address the aforementioned technical problems, the first objective of this invention is to provide a GlycoRNA detection platform based on a proximity-encoded nonlinear hybridization chain reaction circuit, and the second objective is to provide its applications. It eliminates the need for enzymes, overcoming practical limitations associated with enzymatic reactions, saving time and simplifying the process, and exhibits high sensitivity and high specificity.

[0005] To achieve the aforementioned first objective, the present invention provides a GlycoRNA detection platform based on a proximity-encoded nonlinear hybridization chain reaction circuit, characterized in that it comprises a recognition module and an assembly module, wherein the recognition module includes a glycan probe that triggers a nonlinear HCR reaction and an RNA-specific probe, the glycan probe comprising an aptamer, a spacer region, a binding region, and a trigger region for selectively binding N-acetylneuraminic acid; the RNA-specific probe contains a DNA sequence, a spacer region, a hybridization region, and a trigger region complementary to the RNA sequence of the GlycoRNA;

[0006] The assembly module comprises two double-stranded substrates and two single-stranded auxiliary materials; each double-stranded substrate consists of a quencher-labeled DNA strand and a fluorophore-labeled DNA strand.

[0007] In the above scheme:

[0008] The sequence of the glycan probe is as follows:

[0009] TGACGAACTAGTTGATATGACATTTTTTTTTTTTTTTTTTTTTTTTTTAGGGAATTCGTCGACGGATCCCGTGGCGTCTGCAACGGAAAAGAATTTATCTTGTCCTGCAGGTCGACGCATGCGCCG;

[0010] The RNA-specific probe is one of RNA probe-U1, RNA probe-SNORD2, or RNA probe-U8.

[0011] The sequence of RNA probe-U1 is:

[0012] CTGGGAAAACCACCTTCGTGATCATGGTATCTCCCCTGCCAGGTAAGTATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGTCATATGAAGCTG;

[0013] The sequence of RNA probe-SNORD2 is as follows:

[0014] CAGGTCAGTCCCGAAAGATGATTGCCATCATTTCTTTTTTTTTTTTTTTTTTTTTTTTTTTGTCATATGAAGCTG;

[0015] The sequence of RNA probe-U8 is:

[0016] TAATCTGCCCTCCGGAGGAGGAACAGGTAAGGATTATTTTTTTTTTTTTTTTTTTTTTTTTTTTTGTCATATGAAGCTG.

[0017] In the above scheme: the two double-stranded substrates are S1 and S2, the two auxiliary strands are A1 and A2, and the fluorophore-labeled DNA strand sequence of S1 is:

[0018] FAM_GTGTGCCTATTATGTCTCCTCCTGTGTGCCTATTATGTCTCCTCCTCAGCTTCATCAACTAGTTCGTCA;

[0019] The sequence of the S1 quencher-labeled DNA strand is as follows:

[0020] AACTAGTTTGATGAAGCTGGACATAATAGGCACACGACATAATAGGCACAC_BHQ1;

[0021] The fluorophore-labeled DNA strand sequence of S2 is as follows:

[0022] AGGAGGAGACATAATAGGCATGACGAACTAGTTGATGAAGCTG_FAM;

[0023] The sequence of the S2 quencher-labeled DNA strand is as follows:

[0024] BHQ1_CAGCTTCATCAACTAGTGCCTATTATGTCTC;

[0025] The sequence of A1 is: GTGCCTATTATGTCGTGTGCCTATTATGTCCAGCTT;

[0026] The sequence for A2 is: GCACACCTAGTTGATGAAGC.

[0027] In the above scheme, the two double-stranded substrates S1 and S2 are prepared by mixing the fluorophore-labeled DNA strands and the quencher-labeled DNA strands of the double-stranded substrates at a molar ratio of 1:1.5, denaturing them at 95°C for 5 minutes, and then cooling them at room temperature.

[0028] In the above scheme, S1, S2, A1, A2, glycan probe and RNA-specific probe are self-assembled in a molar ratio of 2:2:2:4:1:1.

[0029] The second objective of this invention is achieved as follows: a GlycoRNA detection platform based on a proximity-encoded nonlinear hybridization chain reaction circuit is used for in situ visualization detection of glycoRNAs on exosomes.

[0030] The specific operation is as follows: the exosomes are fixed on a confocal dish, and the GlycoRNA detection platform based on the proximity coding nonlinear hybridization chain reaction circuit is prepared in a dual recognition buffer to obtain the predictor. The dual recognition buffer consists of 50 mM Tris-HCl, 5 mM KCl, 100 mM NaCl and 1 mM MgCl2, pH 7.4, and is allowed to stand at 25°C for 1 hour. It is then washed with pre-cooled PBS and imaged using a laser confocal microscope.

[0031] To develop a sensitive, rapid, and specific visualization method without the use of enzymes, this invention introduces nonlinear hybridization chain reaction (HCR), a widely used technique for detecting low-expression RNA in cells. It operates at room temperature, is user-friendly, and cost-effective. The nonlinear HCR system responds to a trigger amplification signal, enhancing detection sensitivity. We propose a proximity-encoded nonlinear hybridization chain reaction circuit (called the predictor), which shows significant potential in addressing challenges associated with conventional nucleic acid amplification techniques used in proximity ligation assays, such as enzyme dependence, non-isothermality, and complex workflows. The present invention's PREDICTOR consists of two modules: a recognition module and an assembly module. To specifically detect glycoRNA, a glycan aptamer probe and an RNA-specific probe, acting as paired proximity probes, trigger the nonlinear HCR reaction. Two double-stranded DNA substrates modified with fluorescent groups are introduced into the reaction system along with two single-stranded DNA auxiliaries. Over time, the high-molecular-weight DNA product self-assembles on the exosome surface, resulting in an exponential increase in fluorescence intensity. The predictor not only provides high sensitivity and selectivity but also offers a more convenient method for visualizing glycoRNA.

[0032] Compared with the prior art, the present invention has the following beneficial effects:

[0033] (1) The present invention PREDICTOR enables bioimaging of glycoRNA at room temperature without the need for enzymes, thus overcoming practical limitations associated with enzyme-catalyzed reactions, such as high preparation costs, instability and inappropriate storage conditions.

[0034] (2) The present invention can achieve one-pot fluorescence imaging of glycoRNA by premixing the required components, which significantly saves time and simplifies the process.

[0035] (3) The PREDICTOR of the present invention generates a strong fluorescence signal and can perform high-sensitivity imaging of the spatial distribution of glycoRNAs on exosome membranes.

[0036] (4) The PREDICTOR of the present invention is highly specific and images glycoRNAs on exosome membranes rather than single glycans, RNAs or glycans and RNAs that are far apart.

[0037] (5) The glycan and RNA-specific probes in the PREDICTOR of the present invention can be customized to dually recognize other types of glycoRNAs, thus having multifunctionality. Attached Figure Description

[0038] Figure 1 This describes the assembly and characterization of the PREDICTOR of this invention.

[0039] Figure 2 PREDICTOR specifically recognizes glycoRNAs on the surface of Exo-Hela.

[0040] Figure 3 To reveal the spatial distribution of glycoRNAs on Exo-HeLa using PREDICTOR.

[0041] Figure 4 To detect the abundance of glycoRNAs on the surface of exosomes during malignant transformation using PREDICTOR. Detailed Implementation

[0042] The present invention will be further described below with reference to the embodiments and accompanying drawings:

[0043] Experimental Example 1

[0044] GlycoRNA Detection Platform Based on Proximity Encoding Nonlinear Hybridization Chain Reaction Circuit

[0045] It consists of two modules: identification and assembly, such as... Figure 1 .

[0046] (1) Recognition: This module is characterized by a glycan probe containing an aptamer, spacer, binding region, and trigger region for selective binding of N-acetylneuraminic acid (Neu 5Ac); in addition, it includes an RNA-specific probe containing a DNA sequence complementary to the RNA sequence of the glycoRNA. The probe also includes a spacer, hybridization region, and trigger region. The glycoRNA on the exosome is recognized by the glycan probe and the RNA-specific probe, causing the complementary DNA strands to hybridize in the hybridization region and form a single trigger.

[0047] The RNA-specific probe is one of RNA probe-U1, RNA probe-SNORD2, or RNA probe-U8. Detailed sequences are shown in the table below.

[0048] (2) Assembly: The assembly module includes two double-stranded substrates (S1 and S2) and two single-stranded auxiliary materials (A1 and A2). Each double-stranded substrate consists of a quencher-labeled DNA strand (Q strand) and a fluorophore-labeled DNA strand (F strand). The two double-stranded substrates S1 and S2 are prepared as follows: the fluorophore-labeled DNA strand (F strand) and the quencher-labeled DNA strand (Q strand) of the double-stranded substrate are mixed at a molar ratio of 1:1.5, denatured at 95°C for 5 minutes, and then cooled at room temperature for 15 minutes.

[0049] The complementary regions of the Q and F chains hybridize, forming an exposed "foothold" at one end and a raised loop in the middle. Proximity to the fluorophore and quencher leads to a quenching state. After hybridization with the exposed foothold of S1, the trigger induces branching migration, displacing part of the Q chain from the F chain and opening the first loop. This irreversible branching migration exposes the displaced portion of the Q chain as a new foothold. The exposed Q chain of S1 is replaced by A1, opening a second loop and releasing byproduct B1. As a result, the quencher-labeled Q chain of S1 separates from the fluorophore-labeled F chain of S1, emitting fluorescence. The F chain of S1 now exposes two tandemly identical sequences that can hybridize simultaneously with the footholds of both S2 chains. A2 facilitates the dissociation of byproduct B2, releasing additional fluorescent reporter molecules and exposing a new single-stranded region similar to the trigger DNA, preparing for subsequent reactions.

[0050] S1, S2, A1, A2, glycan probes, and RNA-specific probes were self-assembled in a molar ratio of 2:2:2:4:1:1. The resulting panel-HCR strategy was scanned on a pretreated dry mica substrate using fluid-mode AFM (NanoWizard BioAFM, USA).

[0051] This strand displacement process, triggered by glycans and RNA probes, is repeated multiple times, resulting in the formation of highly branched, high-molecular-weight DNA structures called predators. Simultaneously, the fluorescence intensity of predators increases exponentially over time.

[0052]

[0053] All the required nucleic acid sequences were synthesized by Sangon Biotech.

[0054] To simulate the enzyme-free self-assembly of exosome surface predator (in vitro experiments), we synthesized trigger sequences to verify the feasibility of this strategy. S1, S2, A1, A2, and triggers were self-assembled according to a molar ratio of 2:2:2:4:1. Panel-predator formation was verified using 12% PAGE.

[0055] PAGE results showed that high molecular weight DNA self-assembly products were formed only when the reaction system contained triggers (T), two substrate strands (S1, S2), and two auxiliary strands (A1, A2). Figure 1 (b). These findings were confirmed by fluorescence spectroscopy. Figure 1 c and Figure 1 (d). This was further confirmed by direct imaging of the self-assembled products using atomic force microscopy (AFM). By controlling the self-assembly reaction time, DNA branching structures of different sizes were observed, with larger structures forming as the reaction time increased. The self-assembled product at 30 min was smaller than that at 60 min. Figure 1 (e). After 60 minutes, the average fluorescence intensity of the self-assembled product reached its maximum and stabilized. Figure 1 The result of f) demonstrates the speed and controllability of this strategy. Therefore, the enzyme-free self-assembly of PREDICTOR in the extracellular environment was successfully achieved.

[0056] Example 2

[0057] In situ imaging of exosome glycoRNAs using PREDICTOR:

[0058] To observe glycoRNAs on exosomes using laser confocal microscopy, exosomes were immobilized on confocal plates. Specifically: Poly-L-lysine (0.1 mg / mL, Biosharp) was added to six culture dishes, which were then incubated at 37°C for 30 min. Excess poly-L-lysine was then aspirated, and the coated confocal plates were placed in an incubator at 37°C and dried overnight. The poly-L-lysine-coated confocal plates were then washed three times with pre-chilled PBS. (The text abruptly ends here, so the translation stops as well.) 6 Exosomes of 1 particle / mL were added to six confocal culture dishes treated as described above, incubated at 37°C for 2 hours, and then washed three times with pre-chilled PBS to remove unfixed exosomes. Next, predictors were prepared by placing S1+ glycan probe, S1+ RNA probe, S1+ glycan probe+RNA probe, S1+ glycan probe+RNA probe+A1, S1+ glycan probe+RNA probe+A1+S2, and S1+ glycan probe+RNA probe+A1+S2+A2 in dual recognition buffer (50mM Tris-HCl, 5mM KCl, 100mM NaCl, and 1mM MgCl2, pH 7.4), and added to the six confocal culture dishes respectively, and incubated at 25°C for 1 hour. Finally, the dishes were washed three times with pre-chilled PBS and then imaged using a laser confocal microscope (Zeiss LSM 900, Germany).

[0059] Using confocal laser scanning microscopy (CLSM), a distinct green fluorescent signal was observed on exosomes only when the glycan probe, RNA probe, and two substrate strands (S1, S2) and two auxiliary strands (A1, A2) were present simultaneously. Figure 1 (g). Combination tests using various component sets (S1 and glycan probes, S1 and RNA probes, etc.) showed a significant decrease in fluorescence intensity, decreasing by 19-fold, 20-fold, 25-fold, 16-fold, and 11-fold, respectively. Figure 1 (h). These results highlight the necessity of all components in the system.

[0060] Example 3

[0061] The specific steps for using PREDICTOR to specifically recognize glycoRNAs on the Exo-Hela surface are as follows:

[0062] To determine whether PREDICTOR specifically detects glycoRNAs on exosomes, the RNA and glycan fractions of the glycoRNAs were processed separately. The RNA fraction was treated with RNase A and incubated at 37°C for 10 minutes. The RNase A-treated Exo-Hela was then fixed in a laser confocal microscopy dish, PREDICTOR was added, and the dish was incubated at 25°C for 1 hour. Finally, the dish was washed three times with pre-cooled PBS and imaged using a laser confocal microscope.

[0063] To verify whether PREDICTOR specifically responds to the glycan portion of glycoRNA, HeLa cells were treated with the glycosylation inhibitors NGI-1 (8 μM, NEB) and Kifunensine (2 μM, NEB) for 48 hours to disrupt glycoRNA biosynthesis on Exo-HeLa cells in order to target the glycan portion.

[0064] In the enzymatic method, Exo-Hela were treated with PNGase-F (500 U suspension μL⁻¹, NEB) and O-glycoprotein (40,000 U suspension μL⁻¹, NEB), respectively, to remove glycan fractions from the exosome surface. Finally, the glycan-treated Exo-Hela were immobilized in laser confocal culture dishes for PREDICTOR experiments and imaged using a laser confocal microscope (Zeiss LSM 900, Germany). Furthermore, the mean fluorescence intensity of Exo-Hela treated in the same manner was detected and analyzed by flow cytometry (CytoFLEX LX, Beckman).

[0065] Laser confocal microscopy revealed a 91% reduction in the fluorescence signal of glycoRNA after RNase A digestion compared to untreated Exo-HeLa, supporting the view that RNA on the Exo-HeLa surface is crucial for PREDICTOR fluorescence signal generation. Treatment with NGI-1, Kifunensine, and PNGase-F resulted in reductions of 87%, 90%, and 92% in fluorescence signal, respectively, compared to untreated Exo-HeLa. In contrast, O-glycosidase treatment did not significantly affect the fluorescence signal, consistent with expectations, indicating that the glycan portion of glycoRNA is also essential for PREDICTOR fluorescence signal generation. Figure 2 a and Figure 2 (b). To further confirm this conclusion, the treated samples were analyzed by flow cytometry. Figure 2 c and Figure 2 (d). The results showed that, compared with untreated Exo-HeLa, treatment with RNase A, NGI-1, Kifunensine, and PNGase-F reduced the fluorescence signal of glycoRNA by 91%, 90%, 87%, and 86%, respectively. These findings confirm that PREDICTOR generates a fluorescence signal upon co-recognition with glycoRNA. These results indicate that PREDICTOR can be used for highly sensitive and selective in situ imaging of glycoRNA.

[0066] Example 4

[0067] Detection of colocalization of lipid rafts and GlycoRNA using PREDITOR

[0068] To investigate the spatial relationship between glycoRNAs and lipid rafts on exosomes, we used PREDICTOR for fluorescence imaging. Exo-Hela was used as a representative exosome. Lipid rafts were stained with Alexa Fluor 555-labeled cholera toxin subunit B (CT-B, orange-red), and glycoRNAs (green) were visualized on the exosome surface using PREDICTOR.

[0069] Lipid raft staining and imaging: To label lipid rafts on exogenous organisms, the Vybrant Alexa Fluor 555 Lipid Raft Labeling Kit (Invitrogen) was used to specifically stain lipid rafts. Following the instructions in the reagent manual, simply put, 2 μL of LCT-B stock solution (mL⁻¹) was added to 1 mL of Exo-Hela solution (lx I⁻¹). 6The sample was incubated with CT-B antibody (particles / mL) on ice for 15 minutes, then washed three times with pre-chilled PBS, and the labeled exosomes were fixed on culture dishes. PREDICTOR was added, and the mixture was incubated at 25°C for 1 hour. Imaging was performed using laser confocal microscopy, and co-localization was analyzed using Fiji (ImageJ). Furthermore, the fluorescence intensity of CT-B and PREDICTOR was detected and analyzed by flow cytometry to further verify the co-localization of lipid rafts and glycoRNAs on the exosome membrane.

[0070] Figure 3 As shown in Figure a, lipid rafts and glycoRNAs significantly co-localized on the exosome surface. To assess the fluorescence intensity of lipid rafts and glycoRNAs, [further details needed]. Figure 3 Quantitative fluorescence analysis of b. The Pearson correlation coefficient between the predicted value and CT-B was 0.653 ± 0.145. Figure 3 (c). Additionally, the Exo-HeLa treated as described was analyzed by flow cytometry. Figure 3 The scatter plot in d shows that double-stained Exo-Hela mainly accumulated in the Q2 quadrant, accounting for 37.2%, further supporting the co-localization of glycoRNAs and lipid rafts on exosomes. These findings demonstrate the versatility of PREDICTOR in examining the spatial distribution of glycoRNAs on nanoscale exosome surfaces.

[0071] Example 5

[0072] Detection of exosome surface glycoRNA abundance during malignant transformation using PREDICTOR:

[0073] The level of exosome surface glycoRNAs is negatively correlated with tumor malignancy and metastasis. Exosomes, as key extracellular mediators in various physiological and pathophysiological processes, act as messengers over both short and long distances. Investigating the abundance of exosome surface glycoRNAs associated with malignant transformation provides valuable insights into their biological roles and involvement in cancer and immunity. Previous studies have shown a negative correlation between cell surface glycoRNA abundance and breast cancer malignancy and metastasis; however, the relationship between exosome surface glycoRNA abundance and corresponding cell states has not been reported. To address this gap, exosomes derived from non-tumorigenic human breast epithelial cells (Exo-MCF-10A), malignant breast cancer cells (Exo-MCF-7), and metastatic breast cancer cells (Exo-MDA-MB-231) were used as representative models of different tumor states. This allowed for the investigation of the relationship between exosome surface glycoRNA abundance and breast cancer progression. Furthermore, to assess the robustness of the probe, three glycoRNA sequences—U1, SNORD 2, and U8—were designed as RNA probes. These probes, in combination with glycan probes, were used to simultaneously target the glycan and RNA components of glycoRNA to trigger the PROTECTOR reaction: the F and Q strands of the double-stranded substrate S1 were mixed at a molar ratio of 1:1.5, denatured at 95°C for 5 minutes, and then cooled at room temperature for 15 minutes; the F and Q strands of the double-stranded substrate S2 were treated in the same manner. For in vitro experiments, S1, S1, A1, A2, glycan recognition probes, and RNA complementarity probes were self-assembled according to a molar ratio of 2:2:2:4:1:1. The formation of the PROTECTOR was verified using 12% PAGE.

[0074] like Figure 4 a and Figure 4 As shown in Figure b, glycoRNA on Exo-MCF-10A exhibited the strongest fluorescence signal, followed by Exo-MCF-7, with the weakest signal observed for Exo-MDA-MB-231. These results indicate a negative correlation between exosome surface glycoRNAs and the malignancy of breast tumors. Furthermore, glycoRNA sequences U1, SNORD 2, and U8 were successfully used to visualize glycoRNAs on the exosome membrane. To further verify the relationship between exosome surface glycoRNAs and tumor malignancy, the fluorescence signal of glycoRNAs amplified by BMPTOR was analyzed by flow cytometry. Figure 4 c and Figure 4(d). The results showed that the fluorescence signal of glycoRNA on Exo-MCF-10A was significantly higher than that on Exo-MCF-7, and the signal of Exo-MCF-7 was higher than that of Exo-MDA-MB-231. In conclusion, PREDICTOR can detect different RNA sequences on exosomes, and the abundance of glycoRNA is negatively correlated with the degree of cell malignancy.

[0075] This invention is not limited to the above embodiments. Those skilled in the art will understand that various changes, modifications, substitutions and variations can be made to these embodiments without departing from the principles and spirit of this invention. The scope of this invention is defined by the claims and their equivalents.

Claims

1. A GlycoRNA detection platform based on a neighbor-encoded nonlinear hybridization chain reaction circuit, characterized in that: It consists of a recognition module and an assembly module, wherein the recognition module includes a glycan probe that triggers a nonlinear HCR reaction and an RNA-specific probe, the glycan probe including an aptamer, a spacer region, a binding region and a trigger region for selectively binding N-acetylneuraminic acid; the RNA-specific probe includes a DNA sequence complementary to the RNA sequence of GlycoRNA, a spacer region, a hybridization region and a trigger region; The assembly module comprises two double-stranded substrates and two single-stranded auxiliary materials; each double-stranded substrate consists of a quencher-labeled DNA strand and a fluorophore-labeled DNA strand.

2. The GlycoRNA detection platform based on a nonlinear hybridization chain reaction circuit using proximity coding as described in claim 1, characterized in that: The sequence of the glycan probe is as follows: TGACGAACTAGTTGATATGACATTTTTTTTTTTTTTTTTTTTTTTTTTAGGGAATTCGTCGACGGATCCCGTGGCGTCTGCAACGGAAAAGAATTTATCTTGTCCTGCAGGTCGACGCATGCGCCG; The RNA-specific probe is one of RNA probe-U1, RNA probe-SNORD2, or RNA probe-U8. The sequence of RNA probe-U1 is: CTGGGAAAACCACCTTCGTGATCATGGTATCTCCCCTGCCAGGTAAGTATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGTCATATGAAGCTG; The sequence of RNA probe-SNORD2 is as follows: CAGGTCAGTCCCGAAAGATGATTGCCATCATTTCTTTTTTTTTTTTTTTTTTTTTTTTTTTGTCATATGAAGCTG; The sequence of RNA probe-U8 is: TAATCTGCCCTCCGGAGGAGGAACAGGTAAGGATTATTTTTTTTTTTTTTTTTTTTTTTTTTTTTGTCATATGAAGCTG.

3. The GlycoRNA detection platform based on a nonlinear hybridization chain reaction circuit using proximity coding as described in claim 2, characterized in that: The two double-chain substrates are S1 and S2, and the two auxiliary chains are A1 and A2. The fluorophore-labeled DNA strand sequence of S1 is as follows: FAM_GTGTGCCTATTATGTCTCCTCCTGTGTGCCTATTATGTCTCCTCCTCAGCTTCATCAACTAGTTCGTCA; The sequence of the S1 quencher-labeled DNA strand is as follows: AACTAGTTTGATGAAGCTGGACATAATAGGCACACGACATAATAGGCACAC_BHQ1; The fluorophore-labeled DNA strand sequence of S2 is as follows: AGGAGGAGACATAATAGGCATGACGAACTAGTTGATGAAGCTG_FAM; The sequence of the S2 quencher-labeled DNA strand is as follows: BHQ1_CAGCTTCATCAACTAGTGCCTATTATGTCTC; The sequence of A1 is: GTGCCTATTATGTCGTGTGCCTATTATGTCCAGCTT; The sequence for A2 is: GCACACCTAGTTGATGAAGC.

4. The GlycoRNA detection platform based on a nonlinear hybridization chain reaction circuit using proximity coding as described in claim 3, characterized in that, The two double-stranded substrates S1 and S2 were prepared as follows: the fluorophore-labeled DNA strands and the quencher-labeled DNA strands of the double-stranded substrates were mixed at a molar ratio of 1:1.5, denatured at 95°C for 5 minutes, and then cooled at room temperature.

5. The GlycoRNA detection platform based on a nonlinear hybridization chain reaction circuit using proximity coding as described in claim 4, characterized in that: S1, S2, A1, A2, glycan probes, and RNA-specific probes self-assemble in a molar ratio of 2:2:2:4:1:

1.

6. A GlycoRNA detection platform based on a proximity-encoded nonlinear hybridization chain reaction circuit as described in any one of claims 1-5, for the in-situ visual detection of glycoRNAs on exosomes.

7. The application according to claim 6, characterized in that: Exosomes were immobilized on a confocal dish, and the GlycoRNA detection platform based on the proximity coding nonlinear hybridization chain reaction circuit as described in any one of claims 1-5 was used to prepare a predictor in a dual recognition buffer. The dual recognition buffer consisted of 50 mM Tris-HCl, 5 mM KCl, 100 mM NaCl and 1 mM MgCl2, pH 7.4, and was allowed to stand at 25°C for 1 hour. The sample was then washed with pre-cooled PBS and imaged using a laser confocal microscope.

Images