Chimeric antigen receptor for knocking down DMGDH gene expression and application of chimeric antigen receptor

Abstract

The invention relates to a chimeric antigen receptor for knocking down DMGDH gene expression and application of the chimeric antigen receptor, the chimeric antigen receptor comprises a plasmid structure capable of simultaneously expressing CD19CAR and knocking down T cell DMGDH expression, and the chimeric antigen receptor comprises a U6 promoter, an anti-DMGDH shRNA sequence started by the U6 promoter, an EF1 alpha promoter and a three-generation CD19CAR sequence started by the EF1 alpha promoter which are sequentially connected in series; the sequence of the shRNA for targeted inhibition of the DMGDH is as shown in SEQ ID NO.15: GCTCGGAGTATAAACAGGTTACTGAGTAACCTGTTTATACTCCGAGCTTTTT, and the sequence of the shRNA for targeted inhibition of the DMGDH is as shown in SEQ ID NO.15: The third-generation CD19CAR sequence is formed by connecting a CD19 single-chain variable region, a human CD8alpha hinge region, a human CD28 transmembrane region and intracellular region, an intracellular costimulatory region 4-1BB and a human CD3zeta intracellular region in series. After being subjected to antigen stimulation in vitro, the CART cells with the DMGDH expression knocked down show enhanced tumor cytotoxicity, lower cell depletion level and higher cytokine secretion capacity.

Description

Technical Field

[0001] This invention relates to the field of pharmaceutical biology, specifically to a chimeric antigen receptor (CAR) with knockdown of DMGDH expression and its application in tumor treatment. Background Technology

[0003] Introduction to CAR-T CAR T cells (Chimeric Antigen Receptor T cells) are a novel immunotherapy strategy that uses genetically engineered T cells from a patient's own body. The core mechanism involves expressing chimeric antigen receptors (CARs) on the surface of human T cells, enabling specific recognition and efficient killing of tumor cells. When CAR T cells recognize and bind to target antigens on the surface of tumor cells, signal transduction is activated, inducing T cell proliferation, cytokine secretion, and cytotoxic responses, thereby mediating the direct killing of tumor cells.

[0004] CAR T cells possess advantages such as strong targeting, high cytotoxicity, strong self-proliferation capacity, and personalized therapy, and have achieved significant efficacy in various hematologic malignancies. However, T cell exhaustion remains a challenge in clinical applications. Long-term or continuous antigen stimulation leads to decreased proliferation capacity, weakened cytotoxicity, reduced cytokine secretion, and is accompanied by high expression and metabolic abnormalities of immune checkpoint molecules such as PD-1 and CTLA-4. These changes severely limit the sustained anti-tumor effect of CAR T cells and may lead to relapse or drug resistance. Therefore, improving the tolerability and durable function of CAR T cells has become a key technical challenge that urgently needs to be addressed.

[0005] DMGDH is a mitochondrial enzyme involved in the choline metabolic pathway, specifically catalyzing the conversion of dimethylglycine to sarcosine, which is part of one-carbon metabolism and methyl transfer reactions. Aberrant expression of DMGDH can affect mitochondrial function and ROS homeostasis in T cells, potentially promoting or exacerbating exhaustion phenotypes. Furthermore, one-carbon metabolism regulates T cell activation and proliferation, which may also influence T cell fate. Multiple omics or single-cell sequencing studies have found that DMGDH is co-expressed with exhaustion-related genes (such as PD-1, TIM-3, and LAG-3) in tumor-infiltrating T cells (TILs), suggesting a potential correlation between DMGDH and T cell exhaustion. Summary of the Invention

[0006] To address the shortcomings of existing technologies, this invention provides a plasmid structure PTK-U6-shDMGDH-EF1α-CD19 capable of simultaneously expressing CD19 CAR and knocking down DMGDH expression in T cells. The structure is characterized by comprising, in tandem, a U6 promoter, an anti-DMGDH shRNA sequence, an EF1α promoter, and a third-generation CD19 CAR sequence; the third-generation CD19 CAR sequence is composed of a CD19 single-stranded variable region, a CD8α hinge region, a CD28 transmembrane region and intracellular region, a 4-1BB intracellular region, and a CD3ζ intracellular region.

[0007] Preferably, the amino acid sequence of the single-chain antibody ScFv targeting the CD19 antigen protein is shown in SEQ ID NO.1, and the nucleotide sequence of the ScFv is shown in SEQ ID NO.2. The single-chain antibody ScFv specifically recognizes the CD19 antigen protein on the surface of tumor cells.

[0008] Preferably, the amino acid sequence of the signal peptide is as shown in SEQ ID NO.3, and the nucleotide sequence is as shown in SEQ ID NO.4; the amino acid sequence of the CD8 hinge is as shown in SEQ ID NO.5, and the nucleotide sequence is as shown in SEQ ID NO.6; the amino acid sequences of the CD28 transmembrane region and the CD28 intracellular domain are as shown in SEQ ID NO.7 and SEQ ID NO.9, respectively, and the nucleotide sequences are as shown in SEQ ID NO.8 and SEQ ID NO.10, respectively; the amino acid sequence of the intracellular co-stimulatory domain 4-1BB is as shown in SEQ ID NO.11, and the nucleotide sequence is as shown in SEQ ID NO.12; the amino acid sequence of CD3ζ is as shown in SEQ ID NO.13, and the nucleotide sequence is as shown in SEQ ID NO.14; preferably, the shRNA sequence targeting and inhibiting DMGDH is as shown in SEQ ID NO.15.

[0009] Another aspect of the present invention relates to a gene vector for a recombinant chimeric antigen receptor, characterized in that a lentivirus, retrovirus, or transposon vector encoding the chimeric antigen receptor nucleotide sequence is inserted into a PTK881-EF1α vector as a backbone; preferably, a lentiviral vector encoding the chimeric antigen receptor nucleotide sequence as described in claims 1 and 2 is inserted into a PTK881-EF1α vector as a backbone.

[0010] Another aspect of the present invention relates to an immune cell expressing a chimeric antigen receptor, characterized in that it is obtained by transfecting immune cells with the encoding nucleotide sequence of the chimeric antigen receptor as described in claims 1 and 2 or the recombinant chimeric antigen receptor gene vector as described in claim 3, wherein the immune cells are selected from umbilical cord blood, peripheral blood, tumor tissue or iPSC-derived T cells, NK cells, NKT cells, αβT cells, γδT cells, CD4+T cells, CD8+T cells, preferably peripheral blood-derived T cells; the single-chain antibody ScFv of the chimeric antigen receptor binds to the CD19 receptor.

[0011] Another aspect of the present invention relates to the use of the aforementioned immune cells in the preparation of a medicament for treating tumors that express CD19 antigen extracellularly.

[0012] In a preferred embodiment of the present invention, the tumor includes, but is not limited to, acute lymphoblastic leukemia (r / r ALL) and diffuse large B-cell lymphoma (r / r DLBCL). Another aspect of the present invention relates to the use of the aforementioned immune cells for reducing CAR T cell depletion.

[0013] In some embodiments, when performing in vitro functional tests on immune cells expressing chimeric antigen receptors, the selected cell line is one that expresses CD19 antigen extracellularly.

[0014] The beneficial effects of this invention are as follows: 1. The chimeric antigen receptor targeting CD19 provided by the present invention includes a specific single-chain antibody ScFv, which is used to modify immune cells. The modified immune cells can be used to treat tumors that are positive for CD19 on their surface.

[0015] 2. The chimeric antigen receptor with low expression of DMGDH provided by this invention reduces CAR T cell exhaustion, increases cytokine secretion, and enhances specific killing activity. Attached Figure Description

[0016] Figure 1 The image shows the PTK-EF1α-CD19 plasmid pattern in the example. Figure 2 The image shows the plasmid pattern of PTK-U6-shDMGDH-EF1α-CD19 in the example. Figure 3 The CAR expression efficiency of Anti-CD19 CAR-T and Anti-shDMGDH-CD19 CAR-T cells; Figure 4 To improve the efficiency of DMGDH gene knockdown in CAR-T cells Figure 5Schematic diagram of DMGDH knockdown Wb in CAR-T cells Figure 6 The statistical results show the in vitro killing effect of CAR-T cells on the Burkitt's lymphoma cell line Raji. Figure 7 Statistical results of the release of IFN-γ, TNF-α and Granzyme B from CAR-T cells co-incubated with the Burkitt's lymphoma cell line Raji in vitro. Figure 8 Statistical results of the release of cytokines IFN-γ, TNF-α and Granzyme B after CAR-T cells were co-incubated with the Burkitt's lymphoma cell line Raji in vitro; Figure 9 Statistical results of differentiation of Anti-CD19 CAR T and Anti-shDMGDH2-CD19 CAR-T cells; Figure 10 Statistical results of differentiation of Anti-CD19 CAR T cells and Anti-shDMGDH-CD19 CAR-T cells after co-incubation with Raji cells; Figure 11 Statistical results of exhaustion of Anti-CD19 CAR T and Anti-shDMGDH-CD19 CAR-T cells; Figure 12 Statistical results of exhaustion of Anti-CD19 CAR T cells and Anti-shDMGDH-CD19 CAR-T cells after co-incubation with Raji cells; Detailed Implementation The present invention will be explained below with reference to embodiments. Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be considered as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.

[0017] Example 1: Construction of PTK-EF1α-CD19, PTK-U6-shDMGDH-EF1α-CD19 plasmids 1. Artificially synthesize fragments CD19SCFV, SP, and strepII-CD8 hinge-CD28TM+ICD-4-1BB-CD3ζ. Using Thermo Fisher's BLOCK-iT™ RNAi Designer, search for sequences interfering with DMGDH and select a 21bp interfering sense strand sequence. Link the interfering sense strand and interfering antisense strand sequences to both sides of CTCGAG (loop), and add five thymine residues as terminators at the end of the sequence. Design Oligo based on the vector's restriction enzyme sites.

[0018] 2. shRNA was obtained by annealing with Oligo primers and then inserted into the PTK-U6-EF1α-CD19 vector via T4 ligation, ultimately obtaining the PTK-U6-shRNA1-EF1α-CD19 plasmid carrying shRNA. The synthesized CD19 sequence was inserted into the lentiviral expression plasmid PTK-EF1α-IRES-BSD-WPRE to construct the PTK-EF1α-CD19 plasmid. The amino acid sequences of the signal peptide (SP) are shown in SEQ ID NO.3, CD8 hinge in SEQ ID NO.5, CD28TM in SEQ ID NO.7, CD28ICD in SEQ ID NO.9, 4-1BB in SEQ ID NO.11, and CD3ζ in SEQ ID NO.13. The nucleotide sequence of the shRNA targeting and inhibiting DMGDH is shown in SEQ ID NO.15. More preferably, the nucleotide sequence of the signal peptide (SP) is shown in SEQ ID NO.4, the nucleotide sequence of CD8 hinge is shown in SEQ ID NO.6, the nucleotide sequence of CD28TM is shown in SEQ ID NO.8, the nucleotide sequence of CD28ICD is shown in SEQ ID NO.10, the nucleotide sequence of 4-1BB is shown in SEQ ID NO.12, and the nucleotide sequence of CD3ζ is shown in SEQ ID NO.14. 3. The plasmid PTK-EF1α-Kan was double-digested with Xba I and BamH I restriction endonucleases. The products were subjected to 0.8% agarose gel electrophoresis, and the gel was excised and collected in Eppendorf tubes. The corresponding fragments were recovered using an Axygen agarose gel extraction kit, and the purity and concentration of the products were determined.

[0019] 4. Add the fragment to an Eppendorf tube at a 1:2 molar ratio, along with Exnase II ligase (Vazyme) and homologous recombinase 5×CE II buffer, and incubate at 37°C for 0.5 hours. Take 10 μL of the ligation solution and add it to 100 μL of DH5α competent cells. Incubate on ice for 30 min, then heat shock at 42°C for 90 s. After this, add 500 μL of SOC medium and incubate at 37°C and 220 rpm for 2 hours. After 2 hours, centrifuge the Eppendorf tube at 400g for 1 min to remove 400 μL of excess liquid. Spread the remaining liquid onto LB agar plates and incubate at 37°C for 12 hours. Pick a single colony from the plate and inoculate it into 5 mL of LB liquid medium, incubating at 37°C and 220 rpm for 12 hours.

[0020] 5. Plasmids were extracted using the Axygen miniprep kit to obtain plasmids PTK-EF1α-CD19 and PTK-U6-shDMGDH-EF1α-CD19. After verification by first-generation sequencing at Sangon Biotech (Shanghai) Co., Ltd., complete chromatograms of plasmids PTK-EF1α-CD19 and PTK-U6-shDMGDH-EF1α-CD19 were obtained, as shown in the schematic diagrams below. Figure 1 , Figure 2 As shown.

[0021] Example 2: Plasmid preparation and sequencing 1. Plasmid preparation Escherichia coli DH5α strains containing plasmids PTK-EF1α-CD19 and PTK-U6-shDMGDH-EF1α-CD19 were inoculated into 250 mL of LB broth containing 100 μg / mL ampicillin and cultured overnight at 37°C and 220 rpm. The culture was then centrifuged at 6000 g for 20 min at 4°C, and the supernatant was discarded.

[0022] Take out Buffers P1 from the EndoFree plasmid mega kit (Qiagen), add 120 mL of pre-cooled Buffers P1 to the E. coli precipitate obtained by centrifugation, cap the centrifuge bottle, and shake the centrifuge bottle vigorously to completely disperse the E. coli precipitate in Buffers P1.

[0023] Add 120 mL of Buffers P2 to the centrifuge bottle, cap it, place it on a roller mixer, slowly increase the speed to 50 rpm, mix thoroughly, and let it stand at room temperature for 5 min.

[0024] Add 120 mL of Buffers P3 to the centrifuge bottle, cap it, and place it on a roller mixer. Slowly increase the speed to the maximum speed of the roller mixer (70 rpm) and mix thoroughly until a white, non-viscous, and fluffy mixture is formed. Centrifuge at 9000 g for 15 min at 4°C.

[0025] Pour 50 mL of buffer FW into the QIAfilter Cartridge, then pour the supernatant obtained from centrifugation into the QIAfilter Cartridge and gently stir to mix. Filter the mixture into the corresponding labeled glass bottles.

[0026] Add 20 mL of Buffer ER to each glass bottle, mix by inverting the bottle 6 times, and incubate at -20°C for 30 min.

[0027] Place the marked mega columns on the corresponding racks, add 35 mL of QBT buffers to each mega column for equilibration, and allow gravity to drain the buffers completely.

[0028] Pour the liquid from the glass bottle into the corresponding labeled mega columns in batches. After the liquid has drained from the columns, add 200 mL of buffer QC to each mega column in batches for cleaning. After the liquid has drained from the columns, pour the waste liquid from the waste collection tray into a clean 50 mL centrifuge tube.

[0029] Add 40 mL of Buffer QN to each mega column, collect the effluent using a 50 mL clean centrifuge tube, invert the tube 6 times to mix, and aliquot 20 mL into another clean, labeled 50 mL centrifuge tube.

[0030] Add 14 mL of isopropanol (at room temperature) to each 50 mL centrifuge tube and mix by inverting the tube 6 times. Centrifuge at 15000 g for 50 min at 4°C.

[0031] In a clean bench, aspirate the supernatant completely. Add 3.5 mL of Endotoxin-free water to each tube and rinse, being careful not to disturb the sediment at the bottom. Centrifuge at 15000 g for 30 min at 4°C. Preheat the Buffer TE from the EndoFree plasmid mega kit in an oven.

[0032] After centrifugation, remove the supernatant in a clean bench and dry it in the clean bench (evaporate the residual anhydrous ethanol, which takes about 10 minutes).

[0033] Remove the Buffer TE from the oven. In a clean bench, add 1 mL of Buffer TE to each tube, blow it 10 times with a pipette, and then place it in a 65°C oven. During this time, continuously tap the tube wall to ensure complete dissolution of the precipitate. Centrifuge at 4°C and 4000g for 1 min, then shake the liquid on the tube wall to the bottom of the tube and mix thoroughly by blowing.

[0034] Inside a clean bench, all liquid was transferred to EP tubes that were free of endotoxins, pyrogens, and nucleases. 2 μL was aspirated, and the plasmid concentration was measured using a micro spectrophotometer and labeled onto the corresponding EP tubes to obtain plasmids PTK-EF1α-CD19 and PTK-U6-shDMGDH-EF1α-CD19.

[0035] 2. Target gene sequencing Take 20 μL (500 ng) of plasmid DNA and send it for sequencing. Based on the original seed sequence, check whether the target gene of the product produced by plasmid production has been changed. Under stable process, the target gene will not be changed during the fermentation culture and amplification process of the working seed, and can be used for the next stage of production and correct protein expression.

[0036] Example 3: Preparation and live droplet detection of PTK-EF1α-CD19 and PTK-U6-shDMGDH-EF1α-CD19 lentiviral vectors. 1. Preparation of lentiviral vectors Inoculate with 130.0~140.0×10⁶ cells / mL in a multilayer cell culture flask (Hyperflask). 6 293T cells (Takara) were cultured in 560 mL of DMEM complete medium (50 mL fetal bovine serum, 5 mL Antibiotic-Antimycotic (100×)) at 37°C for 24 hours in a 5% CO2 incubator. DMEM complete medium containing 320 µg of plasmids (PTK-EF1α-CD19, PTK-U6-shDMGDH-EF1α-CD19:BZ1 plasmid:BZ2 plasmid:BZ3 plasmid = 12:10:6:5) was added to 960 µg PEI tubes, vortexed, and equilibrated at room temperature for 10 min. The above mixture of 35 mL PEI and plasmids was then mixed with 525 mL of DMEM complete medium and transferred to the aforementioned multilayer cell culture flasks. The multilayer cell culture flasks were incubated at 37°C in a 5% CO2 incubator for 3 days, and the cell culture supernatant was collected.

[0037] Centrifuge the supernatant at 4000 rpm (or 3000 g) for 30 min, then add cryonase (Takara) to the supernatant and incubate at 4°C. After 6 hours, filter the lentiviral supernatant through a 0.22 μm filter membrane and centrifuge at 30000 g for 2.5 h at 4°C. Remove the supernatant and resuspend the pellet in 1 mL of T cell culture medium. After resuspending, reserve 20 µL for viral activity titer testing. Aliquot the remaining lentiviral concentrate, label it Lenti3-CD19-CAR and Lenti3-shRNA-CD19-CAR, and store at -80°C for later use.

[0038] 2. Detection of lentiviral vector activity titer Principle: A commercially available antibody targeting FMC63 was used to validate CAR expression on the cell surface. The fluorescence signal detected by flow cytometry indirectly reflected the expression of CAR in 293T cells.

[0039] Method: Introduce 5.0 × 10⁻⁶ mm wire into a 6-well plate. 5 293T cells per well were added, with 0.1 μL, 0.5 μL, and 1 μL of lentiviral concentrate added to each well, and one negative control was included. Cells were incubated at 37°C in a 5% CO2 incubator. After three days, 293T cells were collected using Versene solution (Gibco) and analyzed by flow cytometry to determine the proportion of CAR-positive 293T cells. The activity titers of PTK-EF1α-CD19 and PTK-U6-shDMGDH-EF1α-CD19 lentiviral concentrates were then calculated.

[0040] The current lentivirus concentrate has an activity titer of 1×10⁻⁶. 8 ~10×10 8 The detection and analysis results within the range of (TU / mL) are shown in Table 1. This indicates that each lentiviral vector can achieve high activity titers and can be used for the subsequent preparation of chimeric antigen receptor immune cells.

[0041] Table 1. Results of Lentiviral Activity Titer Detection and Analysis Example 4: Preparation of Anti-CD19 CAR-T and Anti-shDMGDH-CD19 CAR-T cells 1. Preparation of CAR-T cell preparations: 100 mL of peripheral blood was collected from healthy donors, and mononuclear cells were isolated using Ficoll lymphocyte separation medium. After counting, CD3-positive cells were sorted using an appropriate amount of CD3 MicroBeads, human (Medini), and counted at 1.0–2.0 × 10⁻⁶ cells / mL. 6T cells were cultured at a density of cells / mL in complete T cell culture medium (OpTmizer™ CTS™ T-Cell Expansion Basal Medium, OpTmizer™ CTS T-Cell Expansion Supplement (Invitrogen), 500 IU / mL IL-2 (Shuanglu Pharmaceutical)), and simultaneously injected at 10... 6 Add 25 μL of Dynabeads Human T-Activator CD3 / CD28 (Invitrogen) to each cell to activate T cells.

[0042] 48 hours later (Day 2), Lenti3-CD19-CAR and Lenti3-shRNA-CD19-CAR lentiviral vectors were added at an MOI of 3 for transduction. After mixing, the mixture was placed in a CO2 incubator for incubation. After 4 hours, an appropriate amount of T cell complete culture medium was added for further culture.

[0043] 24 hours after lentivirus transduction, the transduced cells were replaced with fresh complete T cell culture medium, and the viable cell density was adjusted to 1.0-2.0 × 10⁶ cells / year. 6 Continue culturing and expanding the cell culture for 10-20 days at a density of 1.0-2.0 × 10⁶ cells / mL, observing and counting the cells daily, and replenishing the culture medium as needed based on the counted cell number, always maintaining a cell culture density of 1.0-2.0 × 10⁶ cells / mL. 6 / mL.

[0044] 2. Detection of transduction efficiency of Anti-CD19 CAR-T and Anti-shDMGDH-CD19 CAR-T cells Take 1.0 × 10 6 After transduction, T cells were incubated with 1 μg / mL FITC-Protein-L at room temperature for 30 minutes, washed twice with physiological saline, and then FITC fluorescence signal was detected by flow cytometry. The percentage of FITC-positive cells was measured, reflecting the percentage of CAR-T cells in the total cell count. The transduction efficiency of Anti-CD19 CAR-T and Anti-shDMGDH-CD19 CAR-T cells is as follows: Figure 3 As shown. Figure 3 This indicates that CAR-T cells were successfully prepared, and the CAR expression efficiency of Anti-CD19 CAR-T and Anti-shDMGDH-CD19 CAR-T was around 30%.

[0045] Example 5: In vitro functional detection of Anti-CD19 CAR-T and Anti-shDMGDH-CD19 CAR-T cells. 1. CAR-T cell typing detection before and after in vitro co-incubation: Flow cytometry was used to perform cell typing of Anti-CD19 CAR-T and Anti-shDMGDH-CD19 CAR-T cells, with the target cell being the CD19-positive B acute lymphoblastic lymphoma cell line Raji.

[0046] Take 2 x 10 respectively 6 Anti-CD19 CAR-T and Anti-shDMGDH-CD19 CAR-T cells were divided into two groups. One group was cultured in complete T cell culture medium (OpTmizer™ CTS™ T-Cell Expansion Basal Medium, OpTmizer™ CTS T-Cell Expansion Supplement (Invitrogen), 500 IU / mL IL-2 (Shuanglu Pharmaceutical)) and the cell density was adjusted to 1.0~2.0 × 10⁶ cells / mL. 6 The other group had target cells added at a 5:1 effector-to-target ratio, along with complete T-cell culture medium (OpTmizer™ CTS™ T-Cell Expansion Basal Medium, OpTmizer™ CTS T-Cell Expansion Supplement (Invitrogen), 500 IU / mL IL-2 (Shuanglu Pharmaceutical)) and cultured at a cell density of 1.0–2.0 × 10⁶ cells / mL. 6 Cells / mL. Incubate in a CO2 incubator for 48 hours.

[0047] After incubation, BV421-CD45RA / PE-CCR7 was used to label cells to evaluate cell differentiation levels, and PE-PD-1 / BV421-TIM-3 / BV650-LAG-3 was used to evaluate cell exhaustion levels. Results are as follows: Figures 5-12 As shown, the proportions of TN and TSCM in Anti-shDMGDH-CD19 CAR-T cells were significantly higher than those in Anti-CD19 CAR-T cells before and after incubation. The activation markers (CD25 / CD71) were lower in Anti-CD19 CAR-T cells, and the exhaustion markers (PD-1 / TIM-3 / LAG-3) were also significantly lower in Anti-CD19 CAR-T cells.

[0048] 2. In vitro tumor-killing detection: The in vitro tumor-killing function of Anti-CD19 CAR-T and Anti-shDMGDH-CD19 CAR-T cells was detected by the calcein assay. The target cells were the CD19-positive B acute lymphoblastic tumor cell line Raji.

[0049] Take an appropriate amount of target cells and mix them at a concentration of 1×10⁻⁶. 6 Add Calcein-AM to a final concentration of 25 μM in a 1 mL / mL cell suspension (PBS, 5% fetal bovine serum) and incubate for 30 min. After washing twice at room temperature, resuspend the cells at a concentration of 0.5 × 10⁹ / mL. 5 / mL, add 0.5×10 to each well of a 96-well plate. 5 Anti-CD19 CAR-T and Anti-shDMGDH-CD19 CAR-T were added at effector-to-target ratios of 25:1, 5:1, and 1:1, respectively, and incubated at 37°C for 2–3 hours. After incubation, the supernatant was collected, and the fluorescence intensity of calcein was measured. The percentage of target cell lysis was calculated based on the spontaneous release control and the maximum release control.

[0050] The in vitro killing and lysis results of Anti-CD19 CAR-T and Anti-shDMGDH-CD19 CAR-T cells against the CD19-overexpressing tumor cell line Raji are as follows: Figure 4 As shown, The above in vitro tumor-killing results show that Anti-shDMGDH-CD19 CAR-T has significantly higher killing power than ordinary Anti-CD19 CAR-T.

[0051] 3. In vitro cytokine detection: Take an appropriate amount of target cells and mix them at a concentration of 1×10⁻⁶. 6 Resuspend the cells in a 0.5 × 10⁶ mL cell suspension (PBS, 5% fetal bovine serum) at room temperature, wash twice, and then resuspend the cells to a concentration of 0.5 × 10⁶. 5 / mL, add 0.05×10 to each well of a 96-well plate. 5 Anti-CD19 CAR-T and Anti-shDMGDH-CD19 CAR-T cells were added at an effector-to-target ratio of 25:1 per mL of target cells. The cells were centrifuged at 200g for 30 seconds and incubated at 37℃ for 18 hours. After incubation, the supernatant was collected, and the concentrations of IFN-γ, TNF-α, and Granzyme B in the supernatant were measured.

[0052] The results of IFN-γ, TNF-α, and Granzyme B secretion after in vitro incubation of Anti-CD19 CAR-T cells, Anti-shDMGDH-CD19 CAR-T cells, and the CD19-overexpressing cell line Raji are as follows: Figure 7 As shown, the release levels of IFN-γ and Granzyme B in Anti-shDMGDH-CD19 CAR-T cells were significantly higher than those in Anti-CD19 CAR-T cells.

[0053] In summary, compared with Anti-CD19 CAR-T, Anti-shDMGDH-CD19 CAR-T has better cell memory typing and lower exhaustion level, which makes CAR T cells survive longer in vivo and have stronger anti-tumor ability; higher cytokine secretion enhances the killing effect of CAR T cells on tumor cells in vivo.

[0054] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. A chimeric antigen receptor with knockdown of the DMGDH gene, characterized in that, The plasmid structure PTK-U6-shDMGDH-EF1α-CD19, which can simultaneously express CD19 CAR and knock down DMGDH expression on T cells, comprises: a U6 promoter, an anti-DMGDH shRNA sequence, an EF1α promoter, and a third-generation CD19 CAR sequence in tandem; the third-generation CD19 CAR sequence is composed of a variable region of a single-chain antibody targeting CD19, a CD8α hinge region, a CD28 transmembrane region and intracellular region, a 4-1BB intracellular region, and a CD3ζ intracellular region in tandem.

2. The chimeric antigen receptor with knockdown of DMGDH gene expression according to claim 1, characterized in that, The CAR-T cells include a sequence that targets and inhibits DMGDH, the shRNA targeting and inhibiting DMGDH, SEQ ID NO. 15: GCTCGGAGTATAAACAGGTTACTCGAGTAACCTGTTTATACTCCGAGCTTTTT. The amino acid sequence of the single-chain antibody ScFv is shown in SEQ ID NO.

1.

3. The chimeric antigen receptor with knockdown of DMGDH gene expression according to claim 1, characterized in that, The amino acid sequence of the signal peptide is shown in SEQ ID NO.3; the amino acid sequence of the CD8 hinge is shown in SEQ ID NO.5; the amino acid sequences of the CD28 transmembrane region and the CD28 intracellular domain are shown in SEQ ID NO.7 and SEQ ID NO.9, respectively; the amino acid sequence of the intracellular co-stimulatory domain 4-1BB is shown in SEQ ID NO.11; and the amino acid sequence of CD3ζ is shown in SEQ ID NO.

13.

4. A gene vector for a recombinant chimeric antigen receptor, characterized in that, Using the PTK881-EF1α vector as a backbone, insert a lentivirus, retrovirus, or transposon vector containing the chimeric antigen receptor encoding nucleotide sequence as described in any one of claims 1-4.

5. An immune cell expressing a chimeric antigen receptor, characterized in that, The immune cells are obtained by transfecting immune cells with the encoding nucleotide sequence of the chimeric antigen receptor as described in any one of claims 1-3 or the recombinant chimeric antigen receptor gene vector as described in claim 4. The immune cells are selected from umbilical cord blood, peripheral blood, tumor tissue or iPSC-derived T cells, NK cells, NKT cells, αβT cells, γδT cells, CD4+T cells, and CD8+T cells.

6. Use of the immune cells according to claim 5, wherein the immune cells are used for the treatment of tumors expressing tumor antigens, more preferably, the immune cells are used for the treatment of tumors expressing CD19 antigens.

7. The application according to claim 6, wherein the tumor is selected from acute lymphoblastic leukemia (r / r ALL) and diffuse large B-cell lymphoma (r / r DLBCL).

8. Use of the immune cells according to claim 6, wherein the immune cells are used to resist and reduce the depletion of CAR T cells.

Images