Method, system and application for analyzing next-generation sequencing data

Abstract

The invention discloses a method and system for analyzing next-generation sequencing data and application. The specific detection of the transcriptional activity of the cccDNA is realized by utilizing the two characteristic sequences, a new analysis method is provided for evaluating the antiviral treatment effect and judging functional cure, and individualized treatment and new drug research and development can be guided. In addition, the method is also suitable for designing specific quantitative PCR probes and primers, the cccDNA transcriptional level is evaluated by detecting characteristic fragments, and a more convenient detection means is provided for clinical laboratories.

Description

Technical Field

[0001] This invention relates to the fields of bioinformatics and molecular diagnostics, specifically to methods, systems, and applications for analyzing next-generation sequencing data, particularly in the detection of hepatitis B virus cccDNA transcriptional activity. Background Technology

[0002] Hepatitis B virus (HBV) infection is a major global public health problem. Chronic hepatitis B (CHB) can lead to cirrhosis and hepatocellular carcinoma (HCC), and is a leading cause of liver disease-related deaths. Current antiviral drugs, such as nucleoside (nucleotide) analogs (NAs), can effectively inhibit the reverse transcription process of HBV, but they are difficult to completely eliminate the viral replication template—covalently closed circular DNA (cccDNA)—located in the hepatocyte nucleus. The persistence and transcriptional activity of cccDNA are the root cause of viral rebound and disease relapse after treatment cessation. Therefore, accurately assessing the transcriptional activity of intrahepatic cccDNA is crucial for guiding clinical medication, determining treatment endpoints, and predicting patient prognosis.

[0003] On the one hand, while current conventional RNA sequencing (RNA-seq) technology can sequence all HBV transcripts in a sample and analyze the overall transcriptional level of HBV, conventional RNA-seq analysis methods cannot distinguish between RNA derived from cccDNA and RNA derived from HBV DNA integrated into the human chromosome, as these two sources are largely identical in sequence. On the other hand, for viral integration analysis, while existing technologies can confirm the presence and transcriptional activity of integrated HBV DNA by analyzing chimeric transcripts (i.e., RNA that is half viral and half human sequences), this only indicates that the integrated sequence is being transcribed and cannot provide any information about the transcriptional activity of cccDNA.

[0004] In summary, there is currently a lack of a method that can effectively distinguish between HBV RNA from two sources using sequencing data, thereby specifically assessing cccDNA transcriptional activity.

[0005] The information in the background section is merely intended to illustrate the general background of the invention and should not be construed as an admission or implication in any way that such information constitutes prior art known to those skilled in the art. Summary of the Invention

[0006] To address the problem that existing technologies cannot accurately distinguish between RNA derived from cccDNA and RNA derived from integrated HBV DNA using conventional RNA-seq data, thus hindering the effective assessment of cccDNA transcriptional activity, this invention provides a method and system for specifically detecting and assessing the transcriptional activity of hepatitis B virus (HBV) covalently closed circular DNA (cccDNA) by analyzing RNA sequencing (RNA-seq) data or applying quantitative PCR technology. Specifically, this invention includes the following:

[0007] In a first aspect, the present invention provides a method for analyzing next-generation sequencing data, comprising:

[0008] (1) Obtain next-generation sequencing data of biological samples, including paired-end sequencing data of ribonucleic acid;

[0009] (2) Align the sequencing data with the HBV reference genome;

[0010] (3) Filter the first feature sequence and the second feature sequence, where:

[0011] The first characteristic sequence is defined as: in a paired-end sequencing read, the alignment start position of one end is located before 1816nt of the HBV reference genome, while the alignment end position of the other end is located between 1834nt and 1935nt.

[0012] The second characteristic sequence is defined as: in a paired-end sequencing read, the alignment start position of one end is located before 1816nt of the HBV reference genome, while the alignment end position of the other end paired with it is located after 1940nt.

[0013] (4) Count the number of the first feature sequence and the second feature sequence, and thereby determine the state of the biological sample.

[0014] In some implementations, the method for analyzing next-generation sequencing data according to the first aspect, wherein the first characteristic sequence includes a cross-integration breakpoint sequence.

[0015] In some implementations, the method for analyzing next-generation sequencing data according to the first aspect, wherein the second characteristic sequence includes a sequence across polyA signal sites.

[0016] In some implementations, according to the method for analyzing next-generation sequencing data as described in the first aspect, the state of the biological sample includes an active and inactive state of cccDNA transcription.

[0017] A second aspect of the present invention provides a system for analyzing next-generation sequencing data (a system or apparatus for detecting the transcriptional activity of hepatitis B virus cccDNA based on next-generation sequencing data), comprising:

[0018] The data acquisition unit is configured to acquire paired-end sequencing data of ribonucleic acid from biological samples.

[0019] A data processing unit is configured to compare the sequencing data with an HBV reference genome, screen and determine a first characteristic sequence and a second characteristic sequence, count the number of the first characteristic sequence and the second characteristic sequence, and thereby determine the state of the biological sample; wherein:

[0020] The first characteristic sequence is defined as: in a paired-end sequencing read, the alignment start position of one end is located before 1816nt of the HBV reference genome, while the alignment end position of the other end is located between 1834nt and 1935nt.

[0021] The second characteristic sequence is defined as: in a paired-end sequencing read, the alignment start position of one end is located before 1816nt of the HBV reference genome, while the alignment end position of the other end is located after 1940nt.

[0022] In some embodiments, the system for analyzing next-generation sequencing data according to the second aspect is wherein the next-generation sequencing data is deep sequencing data, or the next-generation sequencing data is RNA sequencing or targeted RNA sequencing data.

[0023] A third aspect of the present invention provides an apparatus comprising: a memory, a processor, and a program stored in the memory and capable of running on the processor, the program being configured to implement the method of the first aspect.

[0024] A fourth aspect of the present invention provides a computer-readable storage medium having a program stored thereon, the program being executed by a processor to implement the method described in the first aspect.

[0025] A fifth aspect of the present invention provides a reagent for detecting the transcriptional activity of hepatitis B virus cccDNA, wherein the reagent comprises primers and / or probes, and the primers comprise a forward primer and a reverse primer; wherein:

[0026] The 5' end of the forward primer corresponds to the upstream position of 1816nt in the HBV reference genome;

[0027] The 5' end of the reverse primer corresponds to the position between 1834-1935 nt in the HBV reference genome, and

[0028] / or the reverse primer crosses the polyA site at 1935nt in the HBV reference genome;

[0029] A sixth aspect of the present invention provides the use of a reagent in the preparation of a hepatitis B virus cccDNA transcriptional activity detection product, wherein the reagent comprises substances for detecting a first characteristic fragment and a second characteristic fragment, wherein the first characteristic fragment comprises a first characteristic sequence, and the second characteristic fragment comprises a second characteristic sequence.

[0030] The first characteristic sequence is defined as: in a paired-end sequencing read, the alignment start position of one end is located before 1816nt of the HBV reference genome, while the alignment end position of the other end is located between 1834nt and 1935nt.

[0031] The second characteristic sequence is defined as: in a paired-end sequencing read, the alignment start position of one end is located before 1816nt of the HBV reference genome, while the alignment end position of the other end is located after 1940nt.

[0032] In some embodiments, the reagents of the present invention are provided in the form of compositions, kits, or chips.

[0033] This invention proposes a scheme for analyzing next-generation sequencing data, which effectively analyzes or detects the state of hepatitis B virus cccDNA in biological samples, including its transcriptionally active or inactive state, with high specificity. It distinguishes the structural differences between cccDNA and integrated HBV DNA transcripts through two specific sequences. The defined characteristic sequences originate exclusively from cccDNA, eliminating interference from integrated sequences and achieving specific detection of cccDNA transcriptional activity.

[0034] Furthermore, the method of this invention has high sensitivity and can extract effective information from conventional whole transcriptome RNA-seq data. By combining it with HBV-targeted RNA-seq sequencing, HBV transcripts can be further enriched, greatly improving the sensitivity of detection.

[0035] The solution of this invention also has significant clinical application value, providing a new analytical method for evaluating the efficacy of antiviral treatment and determining functional cure (achieving cccDNA transcriptional silencing), which helps guide personalized treatment and new drug development. Finally, this invention has technical scalability, applicable to the design of specific quantitative PCR (qPCR) probes and primers, enabling the assessment of cccDNA transcription levels by detecting the aforementioned characteristic fragments, providing clinical laboratories with a more convenient detection method. Attached Figure Description

[0036] Figure 1The structure of (AC)dslDNA, and the characteristics of RNA transcribed from HBV under two dslDNA integration scenarios, as well as the features of RNA-seq sequencing fragments. The characteristics of RNA transcribed from (D)cccDNA and the features of RNA-seq sequencing fragments.

[0037] Figure 2 Distribution of HBV transcriptome in Huh-7 cells transfected with prcccDNA plasmid.

[0038] Figure 3 (A) Sequencing coverage of the HBV transcriptome in Huh-7 cells transfected with prccDNA plasmid. (B) Classification of HBV transcriptome sequencing fragments in Huh-7 cells transfected with prccDNA plasmid analyzed by the analytical process of this invention, wherein the red fragment is cccDNA transcriptional characteristic fragment 1 and the green fragment is transcriptional characteristic fragment 2.

[0039] Figure 4 The sequencing coverage of HBV transcriptome sequencing fragments in the livers of HBeAg-negative chronic hepatitis B patients, and the classification of sequencing fragments using the analysis workflow of this invention, wherein brown fragments are cccDNA transcriptional characteristic fragment 1, and green fragments are transcriptional characteristic fragment 2. Detailed Implementation

[0040] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0041] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that the upper and lower limits of the range and each intermediate value between them are specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, are also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0042] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0043] The methods involved in this invention include non-disease diagnosis methods, that is, only obtaining intermediate data for disease diagnosis. Those skilled in the art can further diagnose the disease state based on the obtained hepatitis B virus cccDNA transcriptional activity combined with other indicators or gold standards.

[0044] HBV belongs to the Hepatoviridae family. Its genome is a relaxed circular DNA (rcDNA) approximately 3.2 kb in length. The genome contains four partially overlapping open reading frames (ORFs) encoding the core protein (Core, C), polymerase (P), surface antigen (Surface, S), and X protein (X), respectively. Transcriptional regulation of the HBV genome is carried out collaboratively by multiple promoters and enhancers. The main promoters include the core promoter (CP), the pre-core / basic core promoter (preC / BCP), the S1 promoter (SP1), the S2 promoter (SP2), and the X promoter (XP).

[0045] When HBV enters hepatocytes, its rcDNA genome enters the nucleus and is repaired into a complete double-stranded, covalently closed circular DNA (cccDNA) under the action of host enzymes. cccDNA, as a miniature chromosome of the virus, is the sole template for transcription of all viral RNA. Under the action of host RNA polymerase II, cccDNA can be transcribed into at least five major RNA transcripts sharing a common 3' end (see...). Figure 1 These transcripts include:

[0046] (1) PreC mRNA / pregenomic RNA (pgRNA): approximately 3.5kb in length, it is the template for pgRNA required for viral replication and translation core protein (HBcAg), precore protein (HBeAg), and polymerase;

[0047] (2) Pre-S1 mRNA: approximately 2.4 kb in length, used for translating the large surface antigen (L-HBsAg);

[0048] (3) Pre-S2 / S mRNA: approximately 2.1 kb in length, used for translating medium surface antigen (M-HBsAg) and small surface antigen (S-HBsAg);

[0049] (4) X mRNA: approximately 0.7 kb in length, used to translate the X protein (HBxAg) with multiple regulatory functions;

[0050] (5) Spliced ​​X-spanning transcripts: Some transcripts with a length of up to 3.9kb have been discovered in recent years, and their functions are still under investigation.

[0051] After in-depth analysis, the inventors discovered that all RNAs transcribed normally from cccDNA have their 3' ends cleaved and tailed downstream of a common polyadenylation signal, located near 1935 nt in the HBV genome.

[0052] During chronic infection, HBV DNA fragments can integrate into the host cell's genome. This process is considered an accidental event during viral replication and is not essential to the virus's life cycle, but it is closely related to the development of hepatocellular carcinoma. The main substrate for HBV integration is double-stranded linear DNA (dslDNA), an intermediate in viral replication. The integration process is mainly accomplished through host DNA repair mechanisms such as non-homologous end joining (NHEJ) or microhomologous end joining (MMEJ), resulting in HBV DNA fragments randomly inserting into different locations on the human chromosome.

[0053] dslDNA is a byproduct of the reverse transcription process from pgRNA to rcDNA within the viral core particle. When the reverse transcription process malfunctions, and the positive strand of rcDNA is synthesized beyond the length of the entire genome, a linear, double-stranded DNA molecule, dslDNA, is formed. Taking HBV genotype C as an example, the structural characteristics of dslDNA are: 5' end: originating at the start of the negative strand of the HBV genome, approximately 1816 nt later. 3' end: due to redundancy in the positive strand synthesis, it contains a redundant sequence of approximately 16 bp or more; therefore, the 3' end terminates near the 1834 bp site of the HBV genome.

[0054] When dslDNA integrates into the human genome, its 5' and 3' ends typically experience varying degrees of sequence loss. Therefore, the final integrated HBV DNA sequence usually has a 5' end after 1816 nt and a 3' end before 1834 nt. This structure results in the integrated HBV DNA losing its upstream core promoter (CP / BCP) but retaining the SP1, SP2, and XP promoters. Thus, the integrated HBV DNA can be transcribed using its retained promoters (SP1, SP2, XP), all of which have initiation sites after 2808 nt. Furthermore, if the HBV DNA happens to integrate downstream of an active human gene promoter, its transcription can also be driven by that human promoter, in which case the 5' end of the transcribed HBV RNA sequence can begin near 1816 nt. However, regardless of how transcription begins, all RNA transcribed from the integrated HBV DNA must terminate at its 3' end before the viral polyadenylation signal (approximately 1935 nt), forming a chimeric transcript with the downstream human genome sequence (see...). Figure 1 ).

[0055] Based on this, the RNA transcribed from cccDNA differs fundamentally from the RNA transcribed from integrated HBV DNA at its 3' end, providing a theoretical basis for the specific detection of cccDNA transcriptional activity. Furthermore, preC RNA and ultra-long X transcripts also possess characteristic sequences at their 5' ends that are not present in RNA transcribed from integrated HBV DNA. Although existing RNA-seq technology can analyze total HBV transcription levels and chimeric transcripts, there is currently no effective method to directly determine whether cccDNA transcription is active. In addition, circular genomes present alignment difficulties, as most existing sequence alignment software is designed for linear genomes. For HBV circular cccDNA, common strategies include doubling or elongating the genome sequence for linearization, but this leads to an increase in reads aligned to repetitive regions (multiple alignment problem), affecting the accuracy of alignment and subsequent analyses (such as mutation detection and viral integration analysis precision). Currently, there is no publicly available analytical workflow specifically optimized for the characteristics of the HBV circular genome and capable of effectively solving the multiple alignment problem.

[0056] Example 1

[0057] This embodiment provides a novel method for analyzing cccDNA transcriptional activity using deep sequencing data (especially RNA-seq). This method is based on the fundamental sequence structural differences between cccDNA and integrated HBV DNA transcripts, and also defines characteristic sequence fragments that exist only in the cccDNA-derived RNA. Specifically:

[0058] (1) First characteristic fragment (also referred to as characteristic sequence 1 in this paper, i.e., the fragment that spans the integration endpoint and the cccDNA polyA site): Since the fragment length of paired-end RNA-seq sequencing libraries is usually around 300 bp, and the sequencing read length (e.g., 2 x 150 bp) is sufficient to cover the entire fragment, paired-end sequencing reads (sometimes referred to as reads in this paper) that meet the following criteria can be screened: the alignment start position of one end (Read 1) is before 1816 nt of the HBV genome, while the alignment end position of its paired other end (Read 2) is after 1834 nt and before 1935 nt. Such read pairs span the typical 3' end breakpoint of integrated HBV DNA (<1834 nt) and extend to the 3' end region unique to cccDNA transcripts (>1834 nt), which can be considered as clear evidence of origin from cccDNA.

[0059] (2) Second characteristic fragment (also referred to herein as characteristic sequence 2, i.e., the 5' end characteristic sequence of preC RNA and ultra-long X RNA): To further confirm that the transcript originates from cccDNA and has undergone normal polyadenylation, this invention screens paired-end sequencing read pairs that meet the following criteria: the alignment start position of one end (Read 1) is before 1816 nt of the HBV genome, while the alignment termination position of its paired end (Read 2) is after 1940 nt (i.e., crossing the 1935 nt polyA signal site). These fragments clearly demonstrate that the transcript has completely passed through the virus's own polyA signal site, which is something that integrated transcripts cannot do. These fragments mainly originate from preC RNA and ultra-long X RNA transcribed from cccDNA.

[0060] This embodiment further provides a bioinformatics analysis method including the following steps. Specifically, the method of the present invention includes:

[0061] a. Obtain RNA-seq data from the sample to be tested.

[0062] b. Compare the sequencing data with the HBV reference genome (e.g., C genotype, NC_003977.2).

[0063] c. Screen and count sequencing reads that meet the above conditions of “characteristic sequence 1” and “characteristic sequence 2”.

[0064] d. Determine whether the transcription of cccDNA in the sample is active based on the presence or number of characteristic sequence reads.

[0065] Example 2

[0066] This embodiment is the in vitro validation of the methodology in Embodiment 1.

[0067] To verify the effectiveness of the analytical procedure in Example 1, this example constructs a cell model expressing only cccDNA-derived RNA. A plasmid (HBV prccc) containing the full-length HBV genome and capable of spontaneously circularizing to form cccDNA was transfected into the Huh-7 hepatocellular carcinoma cell line. In this model, no HBV integration event occurred; all HBV RNA was transcribed from cccDNA.

[0068] The total RNA from this cell was subjected to Nanopore long-read sequencing and Illumina paired-end RNA-seq sequencing, respectively.

[0069] Nanopore sequencing results (as the gold standard) showed that all five major HBV RNA transcripts and the ultra-long HBV X RNA were successfully expressed intracellularly, with their 3' ends all located around 1935 nt, confirming normal transcription of cccDNA. Figure 2 ).

[0070] RNA-seq data analysis results showed that, using the analysis method proposed in this invention, a large number of "characteristic sequence 1" and "characteristic sequence 2" fragments were successfully detected from the data. Figure 3 ).

[0071] The experimental results demonstrate that the analytical procedure of this invention can accurately and specifically identify RNA transcribed from cccDNA, verifying the effectiveness and reliability of the method.

[0072] Example 3

[0073] This example is a clinical sample data analysis.

[0074] To verify the application value of the method in Example 1 in real clinical samples, RNA-seq data of liver biopsy tissues from HBeAg-negative chronic hepatitis B patients were downloaded from the public database GEO (GeneExpression Omnibus). Since the cccDNA transcriptional activity in the livers of HBeAg-negative patients is low, this method can verify whether the present invention has good detection sensitivity. Figure 4 ).

[0075] Traditionally, the level of HBV transcription originating from integration is mainly determined by the coverage of the HBV genome in RNA-seq data. The absence of 1834-1935 nt coverage indicates the absence of cccDNA transcription. Therefore, this study first analyzes the coverage of sequencing reads on the HBV genome to classify patients into the following categories:

[0076] (1) Case 1 (Integrated RNA Only): In a small number of patients, the sequencing reads only covered the region before 1834 nt of the HBV genome. Traditional methods clearly showed that almost all the HBV RNA in these samples originated from integrated HBV DNA;

[0077] (2) Cases 2 and 3 (mixed source RNA): RNA-seq data from most other patients showed coverage in all regions of the HBV genome, making it impossible to determine the presence of cccDNA-derived RNA through simple coverage analysis.

[0078] Subsequently, the patient data for “cases 2 and 3” were analyzed using the analysis workflow of Example 1:

[0079] (1) Case 2 (Inactive cccDNA): In some patients, although the HBV genome coverage appears complete, no "characteristic sequence 1" or "characteristic sequence 2" can be detected. This suggests that the cccDNA in the liver of these patients may be in a transcriptionally quiescent state, and the HBV RNA detected therein is mainly or entirely derived from the integrated fragment;

[0080] (2) Case 3 (with active cccDNA): In another group of patients, clear signals of “characteristic sequence 1” and / or “characteristic sequence 2” were successfully detected. This strongly suggests the presence of transcriptionally active cccDNA in the liver of these patients.

[0081] This clinical data analysis demonstrates that the analytical process of this invention is effective, capable of accurately stratifying complex clinical samples and distinguishing patients with transcriptionally active cccDNA, which is impossible with traditional analytical methods.

[0082] Example 4

[0083] This embodiment illustrates a detection method based on quantitative PCR. The principles of this invention are also applicable to the development of quantitative PCR (qPCR) detection, where primers and probes can be designed to specifically amplify and detect the characteristic sequences defined in this invention. Specifically:

[0084] (1) Detection of characteristic sequence 1: The forward primer is designed to be located in the upstream region of 1816 nt, and the reverse primer is located in the region of 1834-1935 nt. Products can only be amplified when the template is cDNA derived from cccDNA. Exemplary sequences include: the forward primer sequence located in the region of 1725-1744 nt is: AAAGACTGGGAGGAGTTGGG; the reverse primer sequence located in the region of 1880-1860 nt is: ACAGCTTGGAGGCTTGAACAG.

[0085] (2) Detection of characteristic sequence 2: The forward primer is designed to be located in the upstream region of 1816 nt, and the reverse primer spans the polyA site at 1935 nt. Exemplary sequences include: the forward primer sequence located in the 1786-1810 nt region is GGCATAAATTGGTCTGTTCACCAGC; the reverse primer sequence located in the 2014-1995 nt region is ATACAGAGCAGAGGCGGTGT.

[0086] By performing qPCR detection on the cDNA after reverse transcription of the sample, a rapid and quantitative assessment of cccDNA transcriptional activity can be achieved.

[0087] Example 5

[0088] This embodiment further illustrates an optimization scheme based on targeted RNA-seq.

[0089] To further improve detection sensitivity, especially in samples with extremely low viral transcript content such as peripheral blood, HBV-targeted RNA-seq technology can be used. By designing probes covering the HBV genome, HBV RNA in the sample is specifically captured and enriched, followed by high-throughput sequencing. Applying the enriched sequencing data to the analysis workflow of this invention can greatly increase the chance of detecting "characteristic sequence 1" and "characteristic sequence 2," thereby significantly improving the sensitivity and reliability of the analysis.

[0090] The probe sequences involved are not particularly limited; any commercially available or known HBV-targeting enrichment products may be used, or sequences may be designed and synthesized based on those mentioned in existing gene databases.

[0091] The results show that the targeted RNA-seq based invention can still accurately and specifically identify RNA transcribed from cccDNA, enabling rapid, effective and reliable assessment of cccDNA transcriptional activity.

[0092] Those skilled in the art will understand that the reagents mentioned in Examples 4 and 5, namely the primers and probes, can be used to prepare detection products for the transcriptional activity of hepatitis B virus cccDNA, such as kits, the components of which may be contained in containers. Containers typically include at least one vial, test tube, flask, bottle, syringe, and / or other container means, wherein solvents may optionally be contained in equal portions. The kit may also include buffers and / or other solvents for containing sterile, pharmaceutically acceptable buffers.

[0093] In this embodiment, the components of the kit can be provided in solution form, such as an aqueous solution. When present in an aqueous solution state, the concentration or content of these components can be easily determined by those skilled in the art according to different needs.

[0094] In this embodiment, the kit may further contain other reagents or components. For example, reagents or components used for polymerase chain reaction, high-throughput sequencing. These other reagents or components are known to those skilled in the art and are readily available from publicly available publications such as Cold Spring Harbor's *Molecular Cloning: A Laboratory Manual*, Fourth Edition.

[0095] When a kit contains more than one component, it typically includes a second, third, or other additional container for holding other components separately. Additionally, combinations of multiple components can be contained within the container.

[0096] Example 6

[0097] This embodiment provides a system for detecting the transcriptional activity of hepatitis B virus cccDNA, comprising:

[0098] The data acquisition unit is configured to acquire paired-end sequencing data of ribonucleic acid from biological samples.

[0099] A data processing unit is configured to compare the sequencing data with an HBV reference genome, screen and determine a first characteristic sequence and a second characteristic sequence, count the number of the first characteristic sequence and the second characteristic sequence, and thereby determine the state of the biological sample; wherein:

[0100] The first characteristic sequence is defined as: in a paired-end sequencing read, the alignment start position of one end is located before 1816nt of the HBV reference genome, while the alignment end position of the other end is located between 1834nt and 1935nt.

[0101] The second characteristic sequence is defined as: in a paired-end sequencing read, the alignment start position of one end is located before 1816nt of the HBV reference genome, while the alignment end position of the other end is located after 1940nt.

[0102] This embodiment further provides a device, the device comprising: a memory, a processor, and a program stored in the memory and capable of running on the processor, the program being configured to perform:

[0103] (1) Obtain next-generation sequencing data of biological samples, including paired-end sequencing data of ribonucleic acid;

[0104] (2) Align the sequencing data with the HBV reference genome;

[0105] (3) Filter the first feature sequence and the second feature sequence, where:

[0106] The first characteristic sequence is defined as: in a paired-end sequencing read, the alignment start position of one end is located before 1816nt of the HBV reference genome, while the alignment end position of the other end is located between 1834nt and 1935nt.

[0107] The second characteristic sequence is defined as: in a paired-end sequencing read, the alignment start position of one end is located before 1816nt of the HBV reference genome, while the alignment end position of the other end paired with it is located after 1940nt.

[0108] (4) Count the number of the first feature sequence and the second feature sequence, and thereby determine the state of the biological sample.

[0109] This embodiment further provides a computer-readable storage medium, wherein a program is stored on the computer-readable storage medium, and the program is implemented when executed by a processor:

[0110] (1) Obtain next-generation sequencing data of biological samples, including paired-end sequencing data of ribonucleic acid;

[0111] (2) Align the sequencing data with the HBV reference genome;

[0112] (3) Filter the first feature sequence and the second feature sequence, where:

[0113] The first characteristic sequence is defined as: in a paired-end sequencing read, the alignment start position of one end is located before 1816nt of the HBV reference genome, while the alignment end position of the other end is located between 1834nt and 1935nt.

[0114] The second characteristic sequence is defined as: in a paired-end sequencing read, the alignment start position of one end is located before 1816nt of the HBV reference genome, while the alignment end position of the other end paired with it is located after 1940nt.

[0115] (4) Count the number of the first feature sequence and the second feature sequence, and thereby determine the state of the biological sample.

[0116] The computer storage medium (readable storage medium) or cloud provided in this embodiment is for use by, or in conjunction with, an instruction execution system, apparatus, or device (such as a computer-based system, a processor-based system, or other system that can fetch and execute instructions from, an instruction execution system, apparatus, or device). For the purposes of this embodiment, "computer-readable medium" can be any device that can contain, store, communicate, propagate, or transmit programs for use by, or in conjunction with, an instruction execution system, apparatus, or device. More specific examples of computer-readable media include: an electrical connection (electronic device) having one or more wires, a portable computer disk drive (magnetic device), random access memory (RAM), read-only memory (ROM), erasable and editable read-only memory (EPROM or flash memory), fiber optic devices, and portable optical disc read-only memory (CDROM). Alternatively, the computer-readable medium may be paper or other suitable media on which the program can be printed, since the program can be obtained electronically, for example, by optically scanning the paper or other medium, followed by editing, interpreting, or otherwise processing as necessary, and then stored in a computer memory.

[0117] It should be understood that the various parts of this embodiment can be implemented using hardware, software, firmware, or a combination thereof. In the above embodiments, multiple steps or methods can be implemented using software or firmware stored in memory and executed by a suitable instruction execution system. For example, if implemented in hardware, as in another embodiment, it can be implemented using any one or a combination of the following techniques known in the art: discrete logic circuits having logic gates for implementing logical functions on data signals, application-specific integrated circuits (ASICs) having suitable combinational logic gates, programmable gate arrays (PGAs), field-programmable gate arrays (FPGAs), etc.

[0118] Those skilled in the art will understand that all or part of the steps of the method implementing the above embodiments can be completed by instructing related hardware through a program. The program can be stored in a computer-readable storage medium, and when executed, the program includes one or a combination of the steps of the method.

[0119] Furthermore, the functional units can be integrated into a single processing module, or each unit can exist as a separate physical entity, or two or more units can be integrated into a single module. The integrated module can be implemented in hardware or as a software functional module. If the integrated module is implemented as a software functional module and sold or used as an independent product, it can also be stored in a computer-readable storage medium. The aforementioned storage medium can be a read-only memory, a hard disk, or an optical disk, etc.

[0120] Although the invention has been described with reference to exemplary embodiments, it should be understood that the invention is not limited to the disclosed exemplary embodiments. Various adjustments or changes may be made to the exemplary embodiments described in this specification without departing from the scope or spirit of the invention. The scope of the claims should be interpreted in the broadest possible sense to cover all modifications and equivalent structures and functions.

Claims

1. A method for analyzing next-generation sequencing data, characterized in that, It includes: (1) Obtain next-generation sequencing data of biological samples, including paired-end sequencing data of ribonucleic acid; (2) Align the sequencing data with the HBV reference genome; (3) Filter the first feature sequence and the second feature sequence, where: The first characteristic sequence is defined as: in a paired-end sequencing read, the alignment start position of one end is located before 1816nt of the HBV reference genome, while the alignment end position of the other end is located between 1834nt and 1935nt. The second characteristic sequence is defined as: in a paired-end sequencing read, the alignment start position of one end is located before 1816nt of the HBV reference genome, while the alignment end position of the other end paired with it is located after 1940nt. (4) Count the number of the first feature sequence and the second feature sequence, and thereby determine the state of the biological sample.

2. The method for analyzing next-generation sequencing data according to claim 1, characterized in that, The first feature sequence includes a sequence across integration breakpoints.

3. The method for analyzing second-generation sequencing data according to claim 1, characterized in that, The second feature sequence includes a sequence across polyA signal sites.

4. The method for analyzing next-generation sequencing data according to claim 1, characterized in that, The state of the biological sample includes both active and inactive cccDNA transcription states.

5. A system for analyzing next-generation sequencing data, characterized in that, include: The data acquisition unit is configured to acquire paired-end sequencing data of ribonucleic acid from biological samples. A data processing unit is configured to compare the sequencing data with an HBV reference genome, screen and determine a first characteristic sequence and a second characteristic sequence, count the number of the first characteristic sequence and the second characteristic sequence, and thereby determine the state of the biological sample; wherein: The first characteristic sequence is defined as: in a paired-end sequencing read, the alignment start position of one end is located before 1816nt of the HBV reference genome, while the alignment end position of the other end is located between 1834nt and 1935nt. The second characteristic sequence is defined as: in a paired-end sequencing read, the alignment start position of one end is located before 1816nt of the HBV reference genome, while the alignment end position of the other end is located after 1940nt.

6. The system for analyzing next-generation sequencing data according to claim 1, characterized in that, The second-generation sequencing data is either deep sequencing data or RNA sequencing or targeted RNA sequencing data.

7. A device, characterized in that, The device includes: a memory, a processor, and a program stored in the memory and capable of running on the processor, the program being configured to implement the method of any one of claims 1-4.

8. A computer-readable storage medium, characterized in that, The computer-readable storage medium stores a program that, when executed by a processor, implements the method described in any one of claims 1-4.

9. A reagent for detecting the transcriptional activity of hepatitis B virus cccDNA, characterized in that, The reagent includes primers and / or probes, and the primers include forward primers and reverse primers; wherein: The 5' end of the forward primer corresponds to the position upstream of 1816nt in the HBV reference genome; The 5' end of the reverse primer corresponds to the position between 1834-1935 nt of the HBV reference genome, and / or the reverse primer spans the polyA site at 1935 nt of the HBV reference genome.

10. The application of the reagent in the preparation of hepatitis B virus cccDNA transcriptional activity detection products, characterized in that, The reagent includes substances for detecting a first feature fragment and a second feature fragment, wherein the first feature fragment contains a first feature sequence and the second feature fragment contains a second feature sequence. The first characteristic sequence is defined as: in a paired-end sequencing read, the alignment start position of one end is located before 1816nt of the HBV reference genome, while the alignment end position of the other end is located between 1834nt and 1935nt. The second characteristic sequence is defined as: in a paired-end sequencing read, the alignment start position of one end is located before 1816nt of the HBV reference genome, while the alignment end position of the other end is located after 1940nt.

Images