Diagnostic application of NDUFS5 in premature ovarian insufficiency disease

Abstract

The invention provides a diagnostic application of NDUFS5 in premature ovarian insufficiency disease, the NDUFS5 peripheral blood expression level (mRNA) is detected to have a significant difference between POI and a control group, the difference is verified by qPCR in an independent queue, and the result shows that the expression of the NDUFS5 gene in the premature ovarian insufficiency group is significantly reduced compared with the control group, and the NDUFS5 gene has a significant effect on the premature ovarian insufficiency disease. The trend is consistent with that of transcriptome sequencing, and meanwhile, training and verification data are combined to prove that the NDUFS5 can be applied to distinguishing normal ovarian functions and ovarian insufficiency. The kit can be used for diagnosis of premature ovarian insufficiency (premature ovarian failure and ovarian aging), solves the clinical dilemma that diagnosis is delayed by means of existing means for POI diseases in the prior art, enables high-risk groups to be capable of early prediction or early warning, and avoids the risk that irreversible fertility is lost in advance due to the fact that the optimal period of early intervention is missed.

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology, and in particular to the diagnostic application of NDUFS5 in early-onset ovarian insufficiency. Background Technology

[0002] Currently, the diagnosis of premature ovarian insufficiency (POI) in clinical practice mainly relies on two key elements: medical history collection and reproductive hormone testing. However, this diagnostic model has significant limitations, as it is often discovered at the terminal stage of the disease, which cannot be reversed by existing medical means.

[0003] 1. Diagnosis of premature ovarian insufficiency (POI) depends on medical history and reproductive hormone levels.

[0004] Medical history taking: The doctor will ask the patient a series of questions related to their health and reproduction, including changes in their menstrual cycle. For example, a sudden change in a previously regular menstrual cycle, such as prolonged cycles, gradually decreasing menstrual flow, or even amenorrhea; a history of ovarian surgery, as ovarian surgery can directly damage ovarian tissue and affect normal ovarian function; whether the patient has received chemotherapy or radiotherapy, as these treatments, while killing diseased cells, can also damage the ovaries; and whether there is a family history of similar POI (Potentially Ovarian Inflammation), as genetic factors also play a role in the development of POI. Through a comprehensive analysis of this medical history information, the doctor can make a preliminary assessment of whether the patient has a potential risk of POI.

[0005] Reproductive hormone testing: This mainly measures the levels of hormones closely related to reproductive function in the blood, with follicle-stimulating hormone (FSH), luteinizing hormone (LH), estrogen (E2), and anti-Müllerian hormone (AMH) being key indicators. When ovarian function is abnormal, hormone levels in the body will change accordingly. Generally, elevated FSH levels are an important marker of POI (Positive Ovary Syndrome). Typically, FSH levels are consistently above a certain threshold (e.g., 25 U / L), while estrogen levels are decreased. Combined with the patient's clinical manifestations, this can serve as an important basis for diagnosing POI.

[0006] 2. Limitations of existing diagnostic methods for premature ovarian insufficiency (POI)

[0007] This diagnostic approach, which relies primarily on medical history and reproductive hormones, often leads to POI being discovered when the patient is already in the terminal stage of the disease. In the early stages, POI may only present with mild, atypical symptoms, such as subtle changes in the menstrual cycle. These symptoms are easily overlooked by patients, preventing them from seeking timely medical attention and examination. Moreover, early decline in ovarian function may not be apparent in reproductive hormone levels, making it difficult for routine hormone testing to accurately detect these early changes. By the time a patient presents with significant menstrual irregularities, amenorrhea, and other symptoms, and is diagnosed with POI through medical history and hormone testing, ovarian function has already been severely impaired, entering the terminal stage.

[0008] Once POI progresses to its end stage, current medical approaches face the dilemma of being unable to reverse the disease. Ovarian tissue damage and functional decline is a gradual and complex process. In the end stage, the number of follicles in the ovary decreases significantly or even depletes, and the ovarian endocrine function is severely impaired. Current medical technology, whether through drug treatment or other interventions, struggles to restore damaged ovarian tissue to a normal state, reactivate depleted follicles, or fully restore normal ovarian endocrine and reproductive function. This not only poses a significant challenge to the patient's reproductive health but also has a serious negative impact on their physical and mental health and quality of life. Summary of the Invention

[0009] To address the technical problems existing in the prior art, the present invention provides the following technical solution:

[0010] On the one hand, it provides a diagnostic application of NDUFS5 as a biomarker in the diagnosis of early-onset ovarian insufficiency.

[0011] On the other hand, the diagnostic application method of NDUFS5 in early-onset ovarian insufficiency is provided as follows:

[0012] Diagnostic warnings can be made by detecting the relationship between the gene expression level of NDUFS5 in peripheral blood and a threshold.

[0013] Furthermore, the diagnostic warning method based on detecting the relationship between the gene expression level of NDUFS5 in peripheral blood and a threshold includes the following steps:

[0014] The first step involved collecting and pre-processing peripheral blood from women, extracting PBMCs (peripheral blood mononuclear cells), and extracting RNA using the Trizol method, which was then reverse transcribed into cDNA.

[0015] The second step is to detect the relative expression level of NDUFS5;

[0016] The third step is result interpretation:

[0017] If the relative expression level of NDUFS5 is greater than the threshold, it indicates premature ovarian insufficiency.

[0018] Conversely, there is no risk of premature ovarian insufficiency.

[0019] On the other hand, a diagnostic kit is provided, which includes the NDUFS5 described above, and performs risk diagnosis and early warning through the diagnostic and early warning application methods described above.

[0020] The beneficial effects of the technical solutions provided in the embodiments of the present invention include at least the following:

[0021] This invention develops a diagnostic molecular marker for early-onset ovarian insufficiency (POI) based on the expression level of the NDUFS5 gene in peripheral blood. The study detected a significant difference in NDUFS5 peripheral blood expression levels (mRNA) between the POI and control groups, and validated this difference using qPCR in an independent cohort. The results showed that NDUFS5 gene expression was significantly downregulated in the POI group compared to the control group, a trend consistent with transcriptome sequencing. Furthermore, training and validation data were combined to conduct diagnostic tests to evaluate the sensitivity and specificity of the new molecular marker for diagnosis, demonstrating that NDUFS5 can be used to differentiate between normal ovarian function and ovarian insufficiency.

[0022] This invention can be used for the diagnosis and early warning of premature ovarian insufficiency (premature ovarian failure, ovarian aging), solving the clinical dilemma of delayed diagnosis of POI diseases by existing technologies, enabling high-risk groups to predict or be warned early, avoiding the risk of irreversible premature loss of fertility due to missing the best time for early intervention. Attached Figure Description

[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0024] Figure 1 This is a comparison of the expression levels of the NDUFS5 gene in a group with premature ovarian insufficiency and a healthy control group, as provided in an embodiment of the present invention.

[0025] Figure 2 This is a comparative graph showing the expression of NDUFS5 gene in the early-onset ovarian insufficiency group compared with the control group, provided by an embodiment of the present invention.

[0026] Figure 3This is a bar chart illustrating the decline in NDUFS5 protein expression in ovarian tissue during ovarian aging, as provided in an embodiment of the present invention.

[0027] Figure 4 This is a bar chart showing the decrease in ovarian tissue protein expression of NDUFS5 during ovarian aging, as provided in another embodiment of the present invention.

[0028] Figure 5 These are electron micrographs showing the difference in expression of NDUFS5 protein in ovarian tissue sections (immunohistochemistry showing ovarian tissue) of naturally aging mouse models in the advanced age group and the young age group, as provided in this embodiment of the invention.

[0029] Figure 6 This is the diagnostic efficacy curve of NDUFS5 in the peripheral blood expression level of the training set provided in the embodiments of the present invention;

[0030] Figure 7 This is the diagnostic efficacy curve of NDUFS5 in the peripheral blood expression level of the validation set provided in the embodiments of the present invention. Detailed Implementation

[0031] The technical solution of the present invention will now be described with reference to the accompanying drawings.

[0032] In embodiments of the present invention, words such as "exemplarily," "for example," etc., are used to indicate that something is an example, illustration, or description. Any embodiment or design described as "exemplary" in the present invention should not be construed as being more preferred or advantageous than other embodiments or designs. Specifically, the use of the word "exemplary" is intended to present the concept in a concrete manner. Furthermore, in embodiments of the present invention, the meaning expressed by "and / or" can be both, or either one.

[0033] In the embodiments of this invention, the terms "image" and "picture" may sometimes be used interchangeably. It should be noted that, without emphasizing the distinction between them, they convey the same meaning. Similarly, the terms "of," "corresponding (relevant)," and "corresponding" may sometimes be used interchangeably. It should be noted that, without emphasizing the distinction between them, they convey the same meaning.

[0034] In this embodiment of the invention, sometimes a subscript such as W1 may be mistakenly written as a non-subscript form such as W1. When the difference is not emphasized, the meaning they express is the same.

[0035] To make the technical problems, technical solutions and advantages of the present invention clearer, a detailed description will be given below in conjunction with the accompanying drawings and specific embodiments.

[0036] The diagnostic reagents and equipment used in this embodiment can all be purchased in laboratories or on the market.

[0037] This invention provides a diagnostic application of NDUFS5 in early-onset ovarian insufficiency. Based on peripheral blood transcriptome sequencing of POI and control (healthy women), a significant difference in NDUFS5 (NADH: ubiquinone oxidoreductase subunit S5) was found between the two groups. This difference was verified by qPCR in an independent cohort. Diagnostic tests were conducted to evaluate the sensitivity and specificity of the new molecular marker for diagnosis.

[0038] NDUFS5 gene IDs (IDs from different databases):

[0039] HGNC:7712;

[0040] NCBI Gene: 4725;

[0041] Ensembl:ENSG00000168653;

[0042] OMIM:603847;

[0043] UniProtKB / Swiss-Prot:043920.

[0044] The NDUFS5 gene sequence can be found at the following link:

[0045] https: / / www.ncbi.nlm.nih.gov / nuccore / NC_000001.11?report=fasta&from=39026350&to=39034615.

[0046] The application of POI diagnosis based on this gene diagnostic marker is as follows: detection of gene expression levels in peripheral blood (q-PCR, ELISA, immunohistochemistry, etc.).

[0047] The specific testing steps are as follows:

[0048] Step 1, Sampling: Collect 5 ml of peripheral blood from women using EDTA anticoagulant tubes. Separate and purify PBMCs (peripheral blood mononuclear cells) using Ficoll density gradient centrifugation. Extract RNA using the Trizol method and reverse transcribe it into cDNA.

[0049] The second step is detection: the relative expression level of NDUFS5 is detected by RT-qPCR, and the primers are: TGCACATGGAATCGGTTATACTC (positive 5′→3′) and CCGAAGCAAACACTCTACGAAAT (antisense 5′→3′).

[0050] The third step is result interpretation: if the relative expression level of NDUFS5 is less than the threshold (0 < TPM < 2.1), it may indicate premature ovarian insufficiency.

[0051] The diagnostic application of the above methods will be described in detail below.

[0052] Example 1: Peripheral blood expression of NDUFS5 was decreased in women with early-onset ovarian insufficiency compared to healthy controls.

[0053] 1. Study subjects: Patients with early-onset ovarian insufficiency who visited the outpatient clinic and women with normal ovarian function (control group) were collected and matched 1:1, for a total of 45 pairs. Among them, 30 pairs were in the discovery set and 15 pairs were in the validation set.

[0054] Inclusion criteria: ① Women aged 18-45 years who visited the outpatient clinic of this institution during the study period; ② Meeting the diagnostic criteria for premature ovarian insufficiency; ③ Willing to participate in this study and cooperate with the survey and follow-up. Diagnostic criteria for premature ovarian insufficiency: Infrequent menstruation or amenorrhea for more than 4 months before the age of 40, with at least two basal serum FSH levels >25 U / L (interval of more than 4 weeks).

[0055] Exclusion criteria: ① Comorbid reproductive endocrine disorders, such as functional hypothalamic amenorrhea, ovarian resistance syndrome, etc.; ② Currently receiving or within the past six months receiving treatment for cycle regulation, hormone replacement, or other steroid-containing medications (such as birth control pills); ③ Chromosomal abnormalities, such as Turner syndrome; ④ Those with a clear iatrogenic cause, such as chemotherapy, pelvic radiotherapy, or a history of bilateral oophorectomy; ⑤ Pregnant or lactating women; ⑥ Uncontrolled endocrine, cardiovascular, or autoimmune diseases; ⑦ Abnormal liver or kidney function, coagulation function, or severe anemia; ⑧ History of malignant tumors; ⑨ Mental illness or cognitive impairment; ⑩ Those who do not consent.

[0056] 2. Sample Collection, Processing, and Experimental Detection: 5ml of peripheral venous blood was drawn from a vacuum blood collection tube (EDTA anticoagulated, purple) under fasting conditions. PBMCs (peripheral blood mononuclear cells) were isolated and purified using Ficoll density gradient centrifugation, and RNA was extracted using the Trizol method. Transcriptome sequencing was performed on 30 pairs of samples from the discovery set, and RT-qPCR was performed on 15 pairs of samples from the validation set. Primers used were:

[0057] TGCACATGGAATCGGTTATACTC(Justice 5′→3′)

[0058] CCGAAGCAAACACTCTACGAAAT (Antonyms 5′→3′).

[0059] 3. Results: Differential gene expression analysis of the discovery set (n=30) transcriptome revealed 4,796 differentially expressed genes, of which 1,826 were upregulated in the early-onset ovarian insufficiency (POI) group and 2,970 were downregulated. NDUFS5 gene expression was significantly downregulated in the POI group compared to the control group. Figure 1 Log2(FC) is -1.294, and P-VALUE is 1.98 E-08.

[0060] This invention utilizes RT-qPCR to validate differentially expressed NDUFS5 gene in peripheral blood PBMCs of a validation set (n=15). The results showed that NDUFS5 gene expression was significantly downregulated in the early-onset ovarian insufficiency group compared to the control group, and the trend was consistent with transcriptome sequencing. Figure 2 ).

[0061] Example 2: NDUFS5 ovarian tissue protein expression decreases during ovarian aging.

[0062] In vitro, after inducing damage and senescence in the human ovarian granulosa cell line (KGN) with cyclophosphamide (CTX) and hydrogen peroxide (H2O2), qRT-PCR results showed that NDUFS5 mRNA expression was significantly downregulated. Figure 3 , 4)

[0063] In a mouse model of natural aging, immunohistochemistry of ovarian tissue sections showed that the expression of NDUFS5 protein in ovarian tissue was significantly lower in the older group (18 months old) than in the younger group (3 months old). Figure 5 The results suggest that downregulation of NDUFS5 expression is involved in the development and progression of ovarian aging.

[0064] Example 3: Diagnostic test of NDUFS5 peripheral blood expression level as a biomarker of ovarian aging

[0065] The diagnostic efficacy of NDUFS5 on the training set (based on clinical samples and gene expression data from the discovery set) and the validation set (based on clinical samples and gene expression data from the validation set) is as follows: Figure 6 , 7As shown, the diagnostic efficacy AUCs for the training and validation sets were 0.908 and 0.858, respectively. The Youden index was highest (sensitivity 88%, specificity 80%) when TPM (Transcripts Per Million) < 2.1. The model cutoff for NDUFS5 mRNA expression level in diagnosing early-onset ovarian insufficiency was TPM < 2.1, indicating that NDUFS5 can be used to differentiate between normal ovarian function and ovarian insufficiency.

[0066] Therefore, this application can be used to diagnose premature ovarian failure (including a series of clinical diseases (or states) with highly homologous mechanisms such as premature ovarian insufficiency, premature ovarian failure, ovarian insufficiency, ovarian aging, and early menopause) based on the detection of gene expression levels in peripheral blood, i.e., the detection of gene mRNA levels in peripheral blood PBMCs (mononuclear cells) by q-PCR.

[0067] In addition to the q-PCR detection mentioned above, other methods for detecting the expression level of this gene in peripheral blood, such as ELISA, immunohistochemistry, and proteomic profiling, can all be performed based on the method of this invention.

[0068] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. The diagnostic application of NDUFS5 as a biomarker in the diagnosis of early-onset ovarian insufficiency.

2. The gene number of NDUFS5 according to claim 1 is: HGNC:7712; or NCBI Gene: 4725; or Ensembl:ENSG00000168653; or OMIM:603847; or UniProtKB / Swiss-Prot:043920.

3. The diagnostic application method of NDUFS5 as described in claim 1 in early-onset ovarian insufficiency is as follows: Diagnosis is made by detecting the relationship between the gene expression level of NDUFS5 in peripheral blood and a threshold.

4. The diagnostic application method of NDUFS5 in early-onset ovarian insufficiency as described in claim 3, wherein the diagnosis is made by detecting the relationship between the gene expression level of NDUFS5 in peripheral blood and a threshold, includes the following steps: The first step involved collecting and pre-processing peripheral blood from women, extracting PBMCs (peripheral blood mononuclear cells), and extracting RNA using the Trizol method, which was then reverse transcribed into cDNA. The second step is to detect the relative expression level of NDUFS5; The third step is result interpretation: If the relative expression level of NDUFS5 is greater than the threshold, it indicates premature ovarian insufficiency. Conversely, there is no risk of premature ovarian insufficiency.

5. A diagnostic kit comprising the NDUFS5 of claim 1, and providing risk diagnostic alerts via the diagnostic application method of claim 3 or 4.

Images