New application of eriodictyol and derivative thereof

Abstract

The invention provides an application of eriodictyol or a derivative thereof in preparation of a medicine for preventing and / or treating interferon gene stimulating factor (STING) related diseases. The eriodictyol or the derivative thereof can effectively inhibit or reduce STING activation, STING-mediated IFN-I production and / or I-type interferon-induced gene (ISG) production, so as to prevent and / or treat STING-related diseases. The oral bioavailability of eriodictyol or derivatives thereof in an organism is increased by at least 50% compared to known STING antagonists.

Description

TECHNICAL FIELD

[0001] The present invention belongs to the field of medicinal chemistry and pharmacology. In particular, the present invention relates to new uses of eriodictyol and derivatives thereof. More particularly, the present invention relates to new uses of eriodictyol and derivatives thereof as STING antagonists. BACKGROUND

[0002] Type I interferons (IFN-I) are a family of cytokines that are mainly secreted upon activation of the innate immune system, and can further enhance host immunity and bridge adaptive immune responses. Stimulator of interferon genes (STING) is a key protein in pattern recognition receptors that drives the production of IFN-I and various proinflammatory factors, which form a positive feedback loop to amplify immune responses. Therefore, STING is an important target for drug development against cancer, infectious diseases, and autoimmune diseases. In particular, overactive STING is associated with autoimmune pathogenesis.

[0003] Currently known STING antagonists have poor bioavailability. For example, H-151 rapidly decreases after oral administration (Pan et al., British Journal of Pharmacology, Vol. 178, No. 24, 2021, pp. 4907-4922).

[0004] Therefore, the development of STING antagonists is still in very early stages. Currently, there is no STING antagonist approved for clinical trials, the main reasons being: 1) structural differences between human and murine STING proteins; and 2) low oral bioavailability; and toxicity shown in in vitro tests.

[0005] Therefore, there is still a need for STING antagonists that can address the above-mentioned problems and limitations. SUMMARY

[0006] In view of the above-mentioned problems in the prior art, the present invention provides STING antagonists that overcome the problems and limitations of known antagonists, and their use in the prevention and / or treatment of stimulator of interferon genes (STING)-related diseases.

[0007] In one aspect, the present invention provides the use of eriodictyol or a derivative thereof for the preparation of a medicament for the prevention and / or treatment of a stimulator of interferon genes (STING)-related disease.

[0008] According to some embodiments of the present invention, the derivative of eriodictyol is selected from one or more of eriodictyol-7-O-glucoside, hesperetin, eriodictyol-7-O-glucoside, 3,4-dihydroxyhydrocinnamic acid, and homoeriodictyol.

[0009] According to some embodiments of the application, the STING-related disease is a STING-related inflammatory disease or an autoimmune disease associated with type I interferon (IFN-I) production;

[0010] Preferably, the autoimmune disease associated with IFN-I production is selected from one or more of Sjogren's syndrome (SS), systemic lupus erythematosus (SLE), Systemic Sclerosis (SS) (PMID: 30685202), Parkinson's disease, Alzheimer's disease and amyotrophic lateral sclerosis (ALS) (PMID: 36435817).

[0011] According to some embodiments of the application, the prevention and / or treatment of the STING-related disease is inhibition or reduction of STING activation, STING-mediated IFN-I production and / or type I interferon inducible gene (ISG) production.

[0012] According to some embodiments of the application, the medicament comprises:

[0013] Rutin or a derivative thereof;

[0014] one or more pharmaceutically acceptable carriers; and

[0015] optionally one or more pharmaceutically acceptable excipients;

[0016] wherein the Rutin or a derivative thereof is present in the medicament in an amount effective to inhibit or reduce STING activation, STING-mediated IFN-I production and / or ISG production.

[0017] According to some embodiments of the application, the concentration of the Rutin or a derivative thereof in the medicament is 1 mM to 10 mM, 1 mM to 5 mM, 10 mM to 1 mM or 10 mM to 500 mM.

[0018] According to some other embodiments of the application, the concentration of the Rutin or a derivative thereof is 0.1 to 100 mg / mL, 0.1 to 75 mg / mL, 0.1 to 50 mg / mL, 0.1 to 25 mg / mL, 0.1 to 20 mg / mL, 0.1 to 15 mg / mL, 0.1 to 10 mg / mL or 0.1 to 5 mg / mL, based on the total volume of the medicament.

[0019] According to some embodiments of the application, the effective amount of said eriodictyol or derivative thereof in said medicament is from 0.01 to 1000 mg per kilogram of body weight of the subject per day, preferably from 0.1 to 500 mg per kilogram of body weight of the subject per day, more preferably from 1 to 250 mg per kilogram of body weight of the subject per day.

[0020] According to some embodiments of the application, said medicament further comprises one or more therapeutic, prophylactic and / or diagnostic agents;

[0021] Preferably, said therapeutic, prophylactic and / or diagnostic agents are selected from the group consisting of bronchodilators, corticosteroids, methylxanthines, phosphodiesterase-4 inhibitors, anti-angiogenic agents, antibiotics, antioxidants, antiviral agents, antifungal agents, anti-inflammatory agents, immunosuppressive agents, anti-allergic agents, and combinations thereof.

[0022] According to some embodiments of the application, said medicament is in an oral dosage form or in a dosage form for parenteral, enteral or transmucosal administration.

[0023] According to some embodiments of the application, said oral dosage form is an oral solid dosage form or an oral liquid dosage form;

[0024] Preferably, said oral solid dosage form is selected from the group consisting of tablets, capsules, powders, lozenges, chewable tablets, multiparticulates and nanoparticles, gels, solid solutions, liposomes and films; more preferably, said oral solid dosage form is formulated for immediate release or for sustained release; further preferably, said sustained release is selected from the group consisting of delayed release, sustained release, pulsatile release, controlled release, targeted release and programmed release;

[0025] Preferably, said oral liquid dosage form is selected from the group consisting of sprays, suspensions, solutions, syrups and elixirs;

[0026] In another aspect, the present application provides the use of eriodictyol or a derivative thereof for the preparation of a STING antagonist.

[0027] In another aspect, the present application provides a method for preventing and / or treating a STING-related disease in a subject in need thereof, comprising:

[0028] administering to said subject a therapeutically effective amount of eriodictyol or a derivative thereof or a medicament comprising eriodictyol or a derivative thereof.

[0029] Compared to the prior art, the technical solution of the present application has the following beneficial effects: it has been experimentally verified that EDC or a derivative thereof can be distributed to lymphoid organs, inhibits STING activation in vivo, and has a higher bioavailability, in particular oral bioavailability. Compared with known STING antagonists, such as H-151, the oral bioavailability of EDC or a derivative thereof is increased by at least 50% to 100%.

[0030] The inventors have found that EDC has a strong inhibitory effect on both human and murine STING-mediated IFN-I signaling through experiments. Oral administration of EDC significantly improves the development of experimental Sjogren's syndrome (ESS) in mice, indicating that EDC is a STING antagonist that can be used to treat STING-related inflammatory diseases, particularly Sjogren's syndrome. It should be particularly noted that although both systemic lupus erythematosus and Sjogren's syndrome are autoimmune diseases, there are obvious differences in treatment between the two. The typical symptoms of Sjogren's syndrome are dry mouth and dry eyes, while systemic lupus erythematosus does not have these symptoms. Conversely, the typical symptoms of systemic lupus erythematosus are butterfly rash and leg swelling, while Sjogren's syndrome does not have these symptoms. As can be seen, there is no obvious correlation between the two diseases, and accordingly, there is no obvious relationship between the treatment methods of the two. The inventors of the present application have, through research, for the first time creatively used EDC and its derivatives to prevent and treat Sjogren's syndrome (SS).

[0031] In addition, the inventors have also found that EDC and its derivatives effectively inhibit STING-mediated IFN-I production and IFN-I-induced genes (ISGs) in human macrophages (THP-1 cell line), monocytes (primary culture), and murine macrophages (primary culture); after oral treatment, EDC and its derivatives can be rapidly detected in serum and spleen and effectively inhibit STING-mediated IFN-I and ISGs in mice; based on the advantages of the established ESS (experimental SS) mouse model, the inventors have determined the key role of STING in the pathogenesis of SS. EDC treatment significantly improves the disease pathology and IFN-I signaling in the ESS mouse model, thus improving the candidate drugs for first-line drug screening and combination therapy. BRIEF DESCRIPTION OF DRAWINGS

[0032] The embodiments of the present application will be described in detail below with reference to the accompanying drawings, in which:

[0033] Figure 1 The chemical structures of EDC and its derivatives are shown, wherein the derivatives of EDC include ECT, hesperetin (Hesp), E7G, 3,4-dihydroxycinnamic acid (3,4D), and Homo.

[0034] Figure 2A The histogram showing that EDC inhibits the activation of STING is shown, which is a function of concentration, reflecting the reduction of IFN-I and ISG expression in murine immune cells.

[0035] Figure 2BThe bar chart shows the inhibition of interferon gene-stimulating factor (STING) activation by sennarol (EDC) as a function of concentration, reflecting the reduction in IFN-I and ISG expression in human immune cells.

[0036] Figure 2C The study demonstrated that sennaol (EDC) inhibited the phosphorylation of TBK1 / IRF3.

[0037] Figure 2D The study showed that EDC treatment can prevent the translocation of STING from the endoplasmic reticulum (ER) to the Golgi apparatus.

[0038] Figure 2E Computer docking shows the interaction between EDC and human STING (PDB ID:4EF5) in the C-terminal structural domain.

[0039] Figure 3 shows the LC-MS / MS analysis of immune cells collected after oral administration of EDC to mice (left panel), and the presence of EDC in mouse blood, salivary glands (SG), and spleen (SP) (right panel).

[0040] Figure 4A The study showed the inhibitory effect of EDC treatment on the expression levels of IFN-I (left panel) and BAFF (right panel) in cultured ESS spleen cells.

[0041] Figure 4B The bar charts show ESS mice treated with high and low doses of EDC and with H-151, showing lower serum antibody levels (top) and preserved salivary function (bottom); the bars from left to right correspond to PBS, EDC (low), EDC (high), and H-151, respectively.

[0042] Figure 4C The results showed that ISG56 expression was reduced in ESS mice when treated with high and low doses of EDC and with H-151; the bars from left to right correspond to PBS, EDC (low), EDC (high) and H-151, respectively.

[0043] Figure 4D Phenotypic analysis showed that germinal center (GC) B cells and plasma cells were reduced in ESS mice after high and low doses of EDC and treatment with H-151.

[0044] Figure 5 The following bar charts show the inhibition of IFN-I production in human and mouse macrophages by the following EDC derivatives: ectoside (ECT), hesperidin (Hesp), ectoside-7-O-glucoside (E7G), 3,4-dihydroxyhydrocinnamic acid (3,4D), and homo. Detailed Implementation

[0045] Described herein are methods of delivering a STING antagonist to a subject in need thereof to inhibit or reduce type I interferon (IFN-I) production, and pharmaceutical formulations comprising a STING antagonist.

[0046] I. DEFINITIONS

[0047] It is to be understood that the disclosed compounds, compositions, and methods are not limited to specific synthetic methods, specific analytical techniques, or particular reagents, unless otherwise specified, as such can vary. It is also to be understood that the terminology used herein is for the purpose of describing particular forms and embodiments only and is not intended to limit the scope of the disclosure.

[0048] As used herein, the term "subject" refers to a mammal, such as a human.

[0049] The term "effective amount" or "therapeutically effective amount" refers to the amount of a compound or agent that is capable of inhibiting or reducing pathway activation, treating one or more symptoms of a disease or disorder, reversing the progression of one or more symptoms of a disease or disorder, arresting the progression of one or more symptoms of a disease or disorder, or preventing the occurrence of one or more symptoms of a disease or disorder in a subject to whom the agent is administered, e.g., as compared to a matched subject that does not receive the compound. The actual effective amount of a compound can vary depending on the particular compound or combination thereof used, the particular composition formulated, the mode of administration, as well as the age, body weight, disease condition, and severity of the symptoms or conditions being treated of the individual.

[0050] The term "pharmaceutical" or "pharmaceutically acceptable" refers to a formulation or other material and / or dosage form that is, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and animals without excessive toxicity, irritation, allergic response, or other problem or complication commensurate with a reasonable benefit / risk ratio. The phrase "pharmaceutically acceptable carrier" refers to a pharmaceutically acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, solvent or encapsulating material, involved in carrying or transporting any subject composition from one organ or portion of the body to another organ or portion of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the subject composition and not injurious to the subject to which it is administered.

[0051] In the context of inhibition, the term "inhibit" or "reduction" means a decrease or reduction in activity and amount. This can be a complete inhibition or reduction, or a partial inhibition or reduction. Inhibition or reduction can be compared to a control or standard level. Inhibition can be measured as a value, for example, from 1% to 100%, such as 5%, 10%, 25%, 50%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%. For example, a pharmaceutical formulation comprising one or more types of active agents can inhibit or reduce activation of a pathway in a subject, such as STING activation and / or IFN-I production, by about 10%, 20%, 30%, 40%, 50%, 75%, 85%, 90%, 95%, or 99%, compared to the activity and / or amount of the same marker in a subject who has not received or been treated with the formulation(s).

[0052] In the context of a disease or condition, the term "treatment" means to ameliorate, reduce, or otherwise arrest the development or progression of a disease, condition, or pathology in an animal that can be predisposed to the disease, condition, and / or pathology, but has not yet been diagnosed as having the disease; to inhibit the disease, condition, or pathology, e.g., to impede its progress; and to relieve the disease, condition, or pathology, e.g., to cause regression of the disease, condition, and / or pathology. Treating a disease or condition includes ameliorating at least one symptom of the particular disease or condition, even if the underlying pathophysiology is not affected, e.g., treating pain in a subject by administering an analgesic, even if such agent cannot treat the cause of the pain. Desirable effects of treatment include reducing the rate of disease progression, ameliorating or palliating disease state, and remission or improved prognosis. A subject is "treated," for example, if one or more symptoms associated with an autoimmune disease, such as Sjogren's syndrome or systemic lupus erythematosus, are alleviated or eliminated, including but not limited to improving the quality of life of a cancer patient, reducing the dosage of other pharmaceutical agents required to treat the cancer, delaying the progression of the cancer, and / or prolonging the life of the subject(s).

[0053] A numerical range recites each possible number that such range can reasonably contain, as well as any sub-ranges contained therein, and combinations of sub-ranges. For example, in a given concentration range of 10 μΜ to 500 μΜ, the range also discloses 20, 33, 350, and 499 μΜ, as well as any sub-range between these numbers (e.g., 50 μΜ to 250 μΜ), and any possible combination of ranges between these values.

[0054] The use of the term "about" is intended to describe values that are near to or around a specified value, the term "about" being modified to be within about + / - 10% of the specified value. When the term "about" precedes a number range (i.e., about 1-5) or a series of numbers (i.e., about 1, 2, 3, 4, etc.), unless otherwise indicated, it is intended to modify each number in the range and / or series to be within about + / - 10% of that number.

[0055] II. STING antagonist pharmaceutical formulations and methods of use thereof

[0056] Type I interferons (IFN-I) are widely recognized in autoimmune pathogenesis, including in Sjogren’s syndrome (SS). Due to the likely primary cGAS STING over-activation for IFN-I production, pharmaceutical development of STING antagonists has received increasing attention in the pharmaceutical industry. However, as previously mentioned, there are currently no available STING antagonists that have entered clinical trials, particularly for oral delivery. As described in detail in the Examples section, eriodicytol (EDC) and its derivatives were investigated herein as STING antagonists in human and animal models. Using a mouse model of experimental SS (ESS), it was found that EDC can effectively inhibit IFN-I signaling (including IFN-a and IFN-b) in vivo, improve disease pathology, showing the therapeutic potential of such compounds for the treatment of STING-related diseases. Emerging evidence has revealed the role of IFN-I in infection and autoimmune pathogenesis, including systemic lupus erythematosus (SLE) and SS, [Kiefer, K., Oropallo, M. A., Cancro, M. P., Marshak-Rothstein, A. (2012) Role of type I interferons in the activation of autoreactive B cells. Immunol Cell Biol 90, 498-504]. It was found that IFN-I signaling is closely related to the level of autoantibodies and disease activity in SS patients. Similar results were also obtained from SLE patients [Paredes, J. L. and Niewold, T. B. (2020) Type I interferon antagonists in clinical development for lupus. Expert Opin Investig Drugs 29, 1025-1041].

[0057] The STING protein is found in all IFN-I producing immune cells, particularly myeloid cells. When a nuclear antigen (NA) is exposed, a NA-sensing receptor (e.g., cyclic guanosine monophosphate-adenosine monophosphate synthase, cGAS) is engaged to produce 2’3’ cyclic GMP-AMP (cGAMP), which binds and activates STING. STING further induces phosphorylation of the TBK1 / IRF3 pathway and directly drives IFN-I transcription [Kumar, V. (2019) A STING to inflammation and autoimmunity. J Leukoc Biol 106, 171-185]. Autoantibodies against NA, such as anti-SSA IgG, serve as a serological marker in the diagnostic criteria for SS and SLE, while ISG expression by PBMCs has been found to be STING-dependent [Kato, Y., Park, J., Takamatsu, H., Konaka, H., Aoki, W., Aburaya, S., Ueda, M., Nishide, M., Koyama, S., Hayama, Y., Kinehara, Y., Hirano, T., Shima, Y., Narazaki, M., Kumanogoh, A. (2018) Apoptosis-derived membrane vesicles drive the cGAS-STING pathway and enhance type I IFN production in systemic lupus erythematosus. Ann Rheum Dis 77, 1507-1515].Accordingly, the STING / IFN-I axis plays a role in several autoimmune disorders [Kong, X., Zuo, H., Huang, H. D., Zhang, Q., Chen, J., He, C., Hu, Y. (2023) STING as an emerging therapeutic target for drug discovery: Perspectives from the global patent landscape. J Adv Res 44, 119-133; Ulrich-Lewis, J. T., Draves, K. E., Roe, K., O'Connor, M. A., Clark, E. A., Fuller, D. H. (2022) STING Is Required in Conventional Dendritic Cells for DNA Vaccine Induction of Type I T Helper Cell-Dependent Antibody Responses. Front Immunol 13, 861710].

[0058] Described herein are pharmaceutical formulations comprising one or more stimulator of interferon genes (STING) antagonists. In one non-limiting example, the pharmaceutical formulation comprises:

[0059] Chavicol or a derivative thereof;

[0060] one or more pharmaceutically acceptable carriers; and

[0061] optionally one or more pharmaceutically acceptable excipients;

[0062] wherein the chavicol or derivative thereof is a STING antagonist and is present in the pharmaceutical formulation in an amount effective to inhibit or reduce STING activation and STING-mediated type I interferon (IFN-I) production.

[0063] Eriodictyol (EDC) is a flavonoid compound found in medicinal plants of Santa Clause (Eriodictyon californicum, North America) and Aspalathus linearis. Derivatives of EDC, including Eriodictyol-7-O-glucoside (ECT), Eriodictyol-7-O-glucoside (E7G), Hesperetin (Hesp), Homoeriodictyol (Homo), and 3,4-Dihydroxyhydrocinnamic acid (3,4D), are also known. The chemical structures of EDC and its derivatives are shown in Figure 1 EDC and its derivatives can be obtained and purified from natural sources. Alternatively, such STING antagonist compounds can be synthesized using known synthetic methods and techniques.

[0064] As noted above, currently known STING antagonists, such as H-151, rapidly decrease upon oral administration (Pan et al., British Journal of Pharmacology, Vol. 178, No. 24, 2021, pp. 4907-4922). Thus, STING antagonists, such as H-151, can present problems in clinical use. In contrast, EDC or derivative compounds for use in the pharmaceutical formulations have bioavailability, particularly oral bioavailability, in which they can be distributed to lymphoid organs and inhibit STING activation in vivo. In some examples, the oral bioavailability of EDC or derivative compounds in the formulations is at least 50% to 100% or more, and individual values or subranges encompassed within the foregoing ranges, higher than the oral bioavailability of known STING antagonists, such as H-151, when compared to other equivalent formulations for treating STING-related diseases.

[0065] A. STING Antagonist Pharmaceutical Formulations

[0066] The STING antagonist(s) form part of the pharmaceutical formulation. The pharmaceutical formulation comprises an effective amount of the STING antagonist(s) and one or more pharmaceutically acceptable carriers and, optionally, one or more excipients. Combinations of STING antagonists are possible, as understood.

[0067] In one non-limiting example, the pharmaceutical formulation comprises:

[0068] Eriodictyol, or a derivative thereof;

[0069] one or more pharmaceutically acceptable carriers; and

[0070] optionally one or more pharmaceutically acceptable excipients;

[0071] wherein the eriodictyol or derivative thereof is a STING antagonist and is present in the pharmaceutical formulation in an amount effective to inhibit or reduce STING activation and STING-mediated type I interferon (IFN-I) production. Derivatives thereof are selected from the group consisting of Eriodictyol-7-O-glucoside (ECT), Eriodictyol-7-O-glucoside (E7G), Hesperetin (Hesp), Homoeriodictyol (Homo), and 3,4-Dihydroxyhydrocinnamic acid (3,4D).

[0072] In some examples, the one or more pharmaceutically acceptable carriers are selected from water, ethanol, polyethylene glycol, propylene glycol, chitosan polymers and chitosan derivatives (e.g., N-trimethylene chitosan chloride, chitosan esters, chitosan modified with hydrophilic groups such as amino, carboxyl, sulfate, etc.), methyl cellulose, oils, and combinations thereof. Other suitable carriers are known.

[0073] The pharmaceutical formulation comprises an effective amount of STING antagonist(s) to inhibit or reduce STING activation and STING-mediated type I interferon (IFN-I) production. In some examples, the STING antagonist(s) is present at a concentration ranging from about 1 μΜ to about 1 mM, about 10 μΜ to 500 μΜ, about 10 μΜ to 200 μΜ, or about 25 μΜ to 100 μΜ of the pharmaceutical formulation, and individual values and subranges within the foregoing ranges are also included. In some other examples, the STING antagonist(s) is present at a concentration ranging from about 1 μΜ to about 10 mM, about 1 μΜ to about 5 mM, about 10 μΜ to about 1 mM, or about 10 μΜ to about 500 μΜ of the pharmaceutical formulation, and individual values and subranges within the foregoing ranges are also included. In some other examples, the STING antagonist(s) is present at a concentration ranging from about 0.1 to about 100 mg / mL, about 0.1 to about 75 mg / mL, about 0.1 to about 50 mg / mL, about 0.1 to about 25 mg / mL, about 0.1 to about 20 mg / mL, about 0.1 to about 15 mg / mL, about 0.1 to about 10 mg / mL, or about 0.1 to about 5 mg / mL of the total volume of the pharmaceutical formulation, and individual values and subranges within the foregoing ranges are also included. In some other examples, the STING antagonist(s) is present at a concentration of about 0.1, 1, 5, 10, 25, 50, 75, or 100 mg / mL of the pharmaceutical formulation.

[0074] In some examples, the effective amount of the STING antagonist(s) in a formulation can be 0.01 to 1000 mg per kilogram of body weight of the subject per day, 0.1 to 500 mg per kilogram of body weight of the subject per day, such as 1 to 250 mg, for example about 5, 10, 20, 50, 100, 150, 200, or 250 mg, which can be administered as a single daily dose, divided into one or more daily doses, depending on the route of administration. The amount of the STING antagonist(s) administered, the route of administration, and further treatment regimens can be determined by the treating clinician or testing technician, depending on the age, sex, and general condition of the subject, the nature and severity of the disease / symptoms being prevented, treated, or diagnosed, and / or the sample to be tested, among other factors.

[0075] Pharmaceutical formulations containing a therapeutically effective amount of the STING antagonist(s) and optionally one or more additional therapeutic, prophylactic, and / or diagnostic agents are also provided. The pharmaceutical formulations can be for any suitable route of administration, preferably oral administration. Other less preferred routes of administration can include parenteral (intramuscular, intraperitoneal, intravenous (IV), or subcutaneous injection), enteral, or transmucosal (intranasal, vaginal, rectal, or sublingual) administration routes or use of a bioerodible insert, and can be formulated into a dosage form suitable for each route of administration.

[0076] i. Oral formulations

[0077] Pharmaceutical formulations containing the STING antagonist(s) can be provided to a subject in need thereof, such as a mammal, in a form suitable for oral administration (i.e., oral compositions). In some examples, oral formulations are preferred. Oral administration can involve swallowing, in which case the STING antagonist(s) and optionally additional active agent(s) can pass to the stomach without being broken down, or can be delivered by buccal or sublingual administration, in which case it can pass to the bloodstream directly via the oral cavity.

[0078] Compositions suitable for oral administration include solid compositions, such as tablets, capsules containing particulates, liquids, powders, lozenges (including liquid-filled lozenges), chewable tablets, multi- and nano-particulates, gels, solid solution, liposome, films, ovules, sprays, and liquid compositions, for example.

[0079] Liquid compositions for oral administration include suspensions, solutions, syrups, and elixirs. Such oral compositions can be used as fillers in soft or hard capsules and can contain one or more suitable carriers and / or excipients, such as water, ethanol, polyethylene glycol, propylene glycol, chitosan polymers and chitosan derivatives (e.g., N-trimethylene chitosan chloride, chitosan esters, chitosan modified with hydrophilic groups such as amino, carboxyl, sulfate, etc.), methyl cellulose, suitable oils, one or more emulsifying and / or suspending agents. Liquid compositions for oral administration can also be prepared by reconstituting solids, for example, from a sachet.

[0080] For tablet or capsule dosage forms, the tablet typically contains, in addition to the STING antagonist(s) described herein, a disintegrant, a binder, a diluent, a surfactant, a lubricant, a glidant, an antioxidant, a colorant, a flavoring agent, a preservative, or a taste-masking agent, or a combination thereof.

[0081] Examples of suitable disintegrants for forming tablet or capsule dosage forms containing the STING antagonist(s) can include, but are not limited to, sodium carboxymethyl starch, sodium carboxymethyl cellulose, calcium carboxymethyl cellulose, cross-linked sodium carboxymethyl cellulose, cross-linked polyvinyl pyrrolidone, polyvinyl pyrrolidone, methyl cellulose, microcrystalline cellulose, lower alkyl-substituted hydroxypropyl cellulose, starch, pregelatinized starch, and sodium alginate. Typically, the concentration of the disintegrant can be in the range of about 1% to about 25%, about 5% to about 20% by weight of the tablet or capsule dosage form containing the STING antagonist(s).

[0082] Binders are typically used to impart cohesiveness to tablet compositions containing the STING antagonist(s). Suitable binders for forming tablet or capsule formulations can include, but are not limited to, microcrystalline cellulose, gelatin, sugars, polyethylene glycols, natural and synthetic gums, polyvinyl pyrrolidone, pregelatinized starch, chitosan polymers and chitosan derivatives (e.g., N-trimethylene chitosan chloride, chitosan esters, chitosan modified with hydrophilic groups such as amino, carboxyl, sulfate, etc.), hydroxypropyl cellulose, and hydroxypropyl methyl cellulose.

[0083] Suitable diluents for forming tablet or capsule compositions containing the STING antagonist(s) can include, but are not limited to, lactose (e.g., monohydrate, spray-dried monohydrate, or anhydrous forms), chitosan polymers and chitosan derivatives (e.g., N-trimethylene chitosan chloride, chitosan esters, chitosan modified with hydrophilic groups such as amino, carboxyl, sulfate, etc.), N-sulfonated derivatives of chitosan, quaternized derivatives of chitosan, carbonalkylated chitosan, microcrystalline chitosan, mannitol, xylitol, dextrose, sucrose, sorbitol, microcrystalline cellulose, starch, and dicalcium phosphate dihydrate.

[0084] The tablet or capsule compositions containing the STING antagonist(s) can also contain surfactants such as sodium lauryl sulfate and polysorbate 80, and glidants such as colloidal silicon dioxide and talc in the coating. When present, the concentration of surfactant can range from about 0.2% to 5% by weight of the tablet or capsule formulation.

[0085] The tablet or capsule compositions containing the STING antagonist(s) will generally also contain a lubricant such as magnesium stearate, calcium stearate, zinc stearate, sodium stearyl fumarate, and mixtures of magnesium stearate and sodium lauryl sulfate. The concentration of lubricant can range from about 0.25% to 10%, from about 0.5% to about 3% by weight of the tablet or capsule composition.

[0086] Other possible excipients included in the tablet or capsule formulations containing the STING antagonist(s) can include glidants (e.g., talc or colloidal anhydrous silica at about 0.1% to about 3% by weight of the tablet or capsule formulation), antioxidants, colorants, flavoring agents, preservatives, and taste-masking agents. When present, the concentration of glidant can range from about 0.2% to 1% by weight of the tablet or capsule composition.

[0087] The tablet or capsule mixture, including the STING antagonist(s) and one or more suitable excipients, can be directly compressed or compressed by roller compaction to form tablets. The tablet or capsule mixture or a portion of the mixture can be wet granulated, dry granulated, or melt granulated, melt- solidified, or extruded prior to tablet compression. The final tablet or capsule composition can comprise one or more layers and can be coated or uncoated; it can even be encapsulated in a particulate, such as a polymeric particulate or a liposomal particulate.

[0088] The solid formulations containing the STING antagonist(s) for oral administration can be formulated for immediate release and / or sustained release. Modified release formulations include delayed, sustained, pulsed, controlled, targeted, and programmed release formulations.

[0089] ii. Optional Therapeutic, Prophylactic, or Diagnostic Agent

[0090] In some forms, the pharmaceutical formulation can optionally comprise one or more additional active agents. Thus, in some forms, the pharmaceutical formulation comprises the STING antagonist(s) in addition to at least one of a therapeutic, prophylactic, and / or diagnostic agent. The additional agent(s) can be added with the STING antagonist(s) or can be a separate composition for co-administration.

[0091] Non-limiting examples of therapeutic, prophylactic, or diagnostic agents can include bronchodilators, corticosteroids, methylxanthines, phosphodiesterase-4 inhibitors, anti-angiogenic agents, antibiotics, antioxidants, antiviral agents, antifungal agents, anti-inflammatory agents, immunosuppressants, anti-allergic agents, and combinations thereof. The amount of any additional therapeutic, prophylactic, or diagnostic agent will generally depend on the severity of the disease and / or condition to be treated. A person of skill in the art can readily determine a specific dosage. See Ansel, Howard C. et al., Pharmaceutical Dosage Forms and Drug Delivery Systems (6th Ed.) Williams and Wilkins, Malvern, PA (1995).

[0092] iii. Pharmaceutically acceptable carriers and optional excipients

[0093] Pharmaceutical formulations can be prepared with one or more optional excipients and carriers appropriate for the route of administration specified. In some forms, the STING antagonist(s) is formulated in a manner suitable for treating human and / or veterinary subjects. In some forms, the pharmaceutical formulation includes mixing or combining the STING antagonist(s) with one or more of the following excipients: lactose, sucrose, starch powder, cellulose esters of alkanoic acids, cellulose alkyl esters, talc, stearic acid, magnesium stearate, magnesium oxide, sodium and calcium salts of phosphoric and sulfuric acids, gelatin, acacia, sodium alginate, polyvinylpyrrolidone, and / or polyvinyl alcohol. In some forms, such as for oral administration, the pharmaceutical formulation can be made into tablets or capsules. In some forms, the STING antagonist(s) can be made into a syrup in water, polyethylene glycol, propylene glycol, ethanol, corn oil, cottonseed oil, peanut oil, sesame oil, benzyl alcohol, sodium chloride, and / or various buffers. In some forms, the pharmaceutical formulation can be subjected to pharmaceutical operations, such as sterilization, and / or can contain carriers and / or excipients, such as preservatives, stabilizers, wetting agents, emulsifying agents, encapsulating agents such as lipids, dendrimers, polymers, proteins such as albumin, nucleic acids, and buffers.

[0094] iv. Dosage forms

[0095] In some forms, it can be advantageous to formulate the pharmaceutical preparation in dosage unit form for ease of administration and uniformity of dosage. As used herein, "dosage unit form" refers to physically discrete units suited as unitary dosages for the patients to be treated; each unit containing a predetermined quantity of therapeutic agent (i.e., STING antagonist(s)) calculated to produce the desired therapeutic effect in association with the pharmaceutical carrier. In some forms, the specification for the dosage unit forms are dictated by and directly dependent on (a) the unique characteristics of the therapeutic agent and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding such therapeutic agents for the treatment of patients as a selected disease. In some forms, the STING antagonist(s) is administered in a therapeutically effective dose sufficient to treat a condition associated with a patient, such as an autoimmune disease associated with INF-I production. For example, the efficacy of a pharmaceutical preparation containing STING antagonist(s) can be assessed in an animal model system, which can predict efficacy in treating a disease in a human or another animal.

[0096] In some forms, the effective dosage range of the therapeutic agent (STING antagonist(s)) can be extrapolated from the effective dosage determined in animal studies of various different animals. The precise amount of a pharmaceutical preparation administered to an individual will depend primarily on the judgment of the practitioner and will be specific to each individual. Other factors that influence dosing include the physical and clinical state of the subject, the route of administration, the intended goal of therapy, and the potency, stability, and toxicity of the particular pharmaceutical preparation.

[0097] The actual dose of STING antagonist(s) in a formulation of the disclosure to be administered to a subject can be determined by physical and physiological factors such as type of animal being treated, age, sex, weight, the severity of the condition, the type of condition being treated, prior or concurrent therapeutic interventions, idiopathic idiosyncratic responses of the patient, and the route of administration. These factors can be determined by one of skill in the art. The professional administering the dose will typically determine the concentration of active agent(s) in the formulation and the appropriate dose(s) for an individual subject. Individual physicians can adjust the dose if any complications arise.

[0098] Single or multiple doses of active agent(s), such as STING antagonist(s), can be contemplated. The desired interval between single dosages of active agent(s) can be determined by one of skill in the art using only routine experimentation. For example, a patient can take two doses per day at approximately 12 hour intervals. In some forms, the agent is administered once per day.

[0099] The pharmaceutical preparation can be administered on a regular schedule. As used herein, a regular schedule refers to a predetermined specified period of time. The regular schedule can include time periods that are the same or different in length, so long as the schedule is predetermined. For example, the regular schedule can involve twice daily, daily, every two days, every three days, every four days, every five days, every six days, weekly, monthly, or any set number of days or weeks therebetween. Alternatively, the predetermined regular schedule can involve twice daily administration for the first week, then daily administration for several months, and so on. In other forms, the present application provides that the agent(s) can be taken orally, with or without dependence on food intake. Thus, for example, the agent(s) can be taken in the morning and / or evening each day, regardless of when the patient eats or will eat.

[0100] In some forms, the pharmaceutical preparation can be in unit dosage form, which can be suitably packaged, for example, in a box, blister, vial, bottle, pouch, ampoule, or in any other suitable single- or multi-dose holder or container (which can be suitably labeled); optionally, with one or more brochures containing product information and / or instructions for use. Typically, such unit doses can contain 1 to 1000 mg, or 5 to 500 mg, of the disclosed STING antagonist(s), for example, about 10, 25, 50, 100, 200, 300, or 400 mg per unit dose.

[0101] B. Methods of using the STING antagonist pharmaceutical preparation

[0102] The pharmaceutical preparation can be used to treat a subject having, for example, a STING-related disease. The STING-related disease can be, for example, one or more of an autoimmune disease associated with type I interferon (IFN-I) production, such as systemic lupus erythematosus (SLE), Sjogren’s syndrome (SS), Systemic Sclerosis (SS) (PMID: 30685202), Parkinson’s disease, Alzheimer’s disease, and amyotrophic lateral sclerosis (ALS) (PMID: 36435817).

[0103] In one non-limiting embodiment, a method of delivering a stimulator of interferon genes (STING) antagonist to a subject in need thereof, the method comprising the steps of:

[0104] (a) administering to the subject a pharmaceutical preparation comprising eriodicytol (EDC) or a derivative thereof;

[0105] wherein the eriodictyol or derivative thereof is a STING antagonist present in the pharmaceutical formulation in an amount effective to inhibit or reduce STING activation, which inhibits or reduces STING-mediated production of type I interferon (IFN-I).

[0106] In some examples, the derivative of eriodictyol is selected from the group consisting of eriodictyol-7-O-glucoside (E7G), hesperetin (Hesp), homoeriodictyol (Homo), and 3,4-dihydroxyhydrocinnamic acid (3,4D).

[0107] In certain examples, in step (a), the dose of the STING antagonist(s) in the pharmaceutical composition administered to the subject is about 0.1 pg to about 100 pg, about 0.5 pg to about 50 pg, about 1 pg to about 100 pg, about 1 pg to about 50 pg, about 1 pg to about 25 pg, about 1 pg to about 10 pg, about 1 pg to about 5 pg, about 4 pg to about 10 pg, or about 1 pg to about 4 pg, per gram of body weight of the subject, or subranges or individual values within these ranges. In some examples, the dose of the STING antagonist(s) is in a concentration range of about 0.1 to about 100 mg / mL, about 0.1 to about 75 mg / mL, about 0.1 to about 50 mg / mL, about 0.1 to about 25 mg / mL, about 0.1 to about 20 mg / mL, about 0.1 to about 15 mg / mL, about 0.1 to about 10 mg / mL, or about 0.1 to about 5 mg / mL, based on the total volume of the pharmaceutical formulation administered to the subject, and each value and sub-range within the foregoing ranges. In some other examples, the dose of the STING antagonist(s) is at a concentration of about 0.1, 1, 5, 10, 25, 50, 75, or 100 mg / mL, based on the total volume of the pharmaceutical formulation administered to the subject. In other words, the total dose administered is determined based on the mg / mL concentration of the STING antagonist(s) in the formulation multiplied by the volume of the formulation administered.

[0108] The administration in step (a) can be performed using any suitable technique, such as oral administration, intranasal administration, intramuscular administration, intravenous administration, intraperitoneal administration, or subcutaneous administration, or a combination thereof. In certain cases, oral administration is preferred.

[0109] In some examples, following the method, the subject exhibits a decrease in production of type I interferon inducible genes (ISGs). In some examples, following the method, the subject exhibits a decrease in production of STING-mediated type I interferon (IFN-I) and / or a decrease in production of type I interferon inducible genes (ISGs) occurring in macrophages and / or monocytes of the subject. In some examples, following the method, epicatechin or a derivative thereof is detected in the serum, plasma, salivary glands, lacrimal glands, and / or spleen of the subject after the administration step. This can occur within about 1 to 5 hours after administration, as well as individual time values or subranges of the foregoing ranges.

[0110] In step (a), the administration of the pharmaceutical preparation can occur once or multiple times. When more than one administration step is performed, each administration can be performed periodically, every 5 minutes, every 10 minutes, every 20 minutes, every 30 minutes, every hour, every 2 hours, every day, every two days, every 3 days, every week, every two weeks, every month, etc.; or irregularly, each administration can be performed irregularly with time intervals of 5 minutes, 10 minutes, 20 minutes, 30 minutes, 1 hour, 2 hours, 1 day, 2 days, 3 days, 5 days, 1 week, 2 weeks, etc. The specific number of treatments and the time interval of the treatment can be determined by the treating clinician or the testing technician, depending on factors such as the age, sex, and general condition of the subject, the nature and severity of the disease / symptoms to be prevented, treated, or diagnosed, and / or the sample to be tested, etc.

[0111] In some examples of the method, the pharmaceutical preparation can further include one or more therapeutic, prophylactic, or diagnostic agents. In some examples of the method, the method includes co-administering one or more therapeutic, prophylactic, or diagnostic agents to the subject before, during, or after step (a). Such therapeutic, prophylactic, or diagnostic agents are described above.

[0112] The application is further described in detail by reference to the specific examples given below, which are provided for the purpose of illustration only and are not intended to limit the scope of the application.

[0113] Example 1: Epicatechin (EDC) STING antagonists and their use

[0114] In the following examples, EDC was investigated as a STING antagonist and the previously established experimental Sjogren’s syndrome (ESS) model was utilized [Lin, X., Rui, K., Deng, J., Tian, J., Wang, X., Wang, S., Ko, K. H., Jiao, Z., Chan, V. S., Lau, C. S., Cao, X., Lu, L. (2015) Th17 cells play a critical role in the development of experimental Sjogren’s syndrome. Ann Rheum Dis 74, 1302-10]. It was found that STING agonists significantly promoted ESS pathology, while STING- / - mice were completely resistant to the development of ESS. Thus, STING was shown to play a role in the pathogenesis of ESS.

[0115] Experimental procedure: First, C57BL / 6N mice were divided into 4 groups, the first group was the control group, the second group was only ESS modeling, the third group was STING agonist treatment + ESS modeling, and the fourth group was STING- / - mice + ESS modeling. The ESS modeling process was as follows: the mice were subcutaneously injected with an emulsion (200ul / each) mixed from mouse salivary gland protein (5mg / ml) and complete Freund’s adjuvant at a ratio of 4:6 on day 1 and day 14 for immunization. The third group of mice were subcutaneously injected with STING agonist DMXAA (20 mg / kg) on day 1 and day 21 after immunization. All mice were killed at 40wk, saliva secretion function was measured, SG was taken for frozen section to evaluate histopathological changes, serum autoantibody level was measured, spleen cells were measured for ISG expression level, etc.

[0116] According to the results, STING activation during the development of SS was shown, which indicates that STING activation during the development of SS is prolonged, possibly due to the continuous release of nuclear antigens (NA) by systemic inflammation [Decout, A., Katz, J. D., Venkatraman, S., Ablasser, A. (2021) The cGAS-STING pathway as a therapeutic target in inflammatory diseases. Nat Rev Immunol 21, 548-569].

[0117] The studies of the present embodiment also found that STING- / - mice were resistant to ESS induction with reduced IFN-I production. To investigate whether STING activation is involved in the pathogenesis of SS, DMXAA (vadimezan, also called 2,5-hexanedione theobromine), a selective murine STING agonist, was injected subcutaneously in mice after ESS induction. Notably, DMXAA significantly promoted the production of autoantibodies and histopathology in ESS mice, which was associated with ISG elevation. However, this was greatly attenuated after IFNAR1 blockade. In contrast, STING- / - mice were found to be resistant to ESS induction, showing unaltered saliva secretion, reduced autoantibody levels, and reduced IFN-I production in response to SG-derived NA [Bave, U., Nordmark, G., Lovgren, T., Ronnelid, J., Cajander, S., Eloranta, M. L., Alm, G. V., Ronnblom, L. (2005) Activation of the type I interferon system in primary Sjogren's syndrome: a possible etiopathogenic mechanism. Arthritis Rheum 52, 1185-95]. Therefore, these results indicate that STING plays a critical role in IFN-I production and disease induction in ESS mice.

[0118] The studies of the present embodiment also found that EDC dose-dependently inhibited STING-mediated IFN-I production. Based on a drug screening platform, including BMDM and THP-1 cells [Li, Q., Tian, S., Liang, J., Fan, J., Lai, J., Chen, Q. (2021) Therapeutic Development by Targeting the cGAS-STING Pathway in Autoimmune Disease and Cancer. Front Pharmacol 12, 779425], it was found that EDC effectively inhibited STING activation, which was reflected in the reduction of IFN-I and ISG expression in murine immune cells ( Figure 2A ) and human immune cells ( Figure 2B ).

[0119] wherein, Figure 2AExperimental process: Take naive mouse bone marrow, lyse it with red blood cell lysis solution to obtain bone marrow cells, add mouse macrophage colony stimulating factor (M-CSF, 15 ng / ml) to the DMEM culture medium containing 10% FBS, and culture the cell culture plate (8x10 5 / mL per well) in a 37°C, 5% CO2 incubator for 7 days, replace the culture medium on the 3rd and 6th days, and obtain adherent mouse macrophages (BMDM). Then, the BMDM is pretreated with different concentrations of EDC (concentrations such as Figure 2A indicated) for 1h, then treated with cGAMP (10uM, human and mouse STING agonist) for 6h, and then the gene expression level is measured by qPCR.

[0120] The primer information is as follows:

[0121] mIFNβ:

[0122] Forward primer: CGTGGGAGATGTCCTCAACT (SEQ ID NO: 1)

[0123] Reverse primer: AGATCTCTGCTCGGACCACC (SEQ ID NO: 2)

[0124] mISG56:

[0125] Forward primer: TCTGCTCTGCTGAAAACCCA (SEQ ID NO: 3)

[0126] Reverse primer: CACCATCAGCATTCTCTCCCAT (SEQ ID NO: 4)

[0127] When performing real-time quantitative PCR, reverse transcribe and synthesize cDNA using PrimeScript RT Reagent Kit (TaKaRa), perform quantitative PCR using TB Green Premix Ex Taq II (TaKaRa), and detect the expression amount of the gene using LC480 fluorescence quantitative PCR instrument (Roche). The experimental process complies with the instructions of the reagent manufacturer.

[0128] Among them, Figure 2B Experimental process: After the THP-1 cell line (THP-1-TIB-202) is resuscitated, it is cultured in RPMI1640 culture medium containing 10% fetal bovine serum containing 50 ng / ml PMA (Phorbol 12-myristate 13-acetate, phorbol ester) for 24h, inducing THP-1 monocytes to differentiate into THP-1 macrophages. Then, the macrophages are pretreated with different concentrations of EDC (concentrations such as Figure 2B(As shown) Pretreated for 1 h, then treated with cGAMP (10 μM) for 6 h, and then gene expression level was measured by qPCR.

[0129] Primer information is as follows:

[0130] hIFNβ:

[0131] Forward primer: AGTAGGCGACACTGTTCGTG (SEQ ID NO: 5)

[0132] Reverse primer: ATAGATGGTCAATGCGGCGT (SEQ ID NO: 6)

[0133] hISG15:

[0134] Forward primer: CGCAGATCACCCAGAAGAT (SEQ ID NO: 7)

[0135] Reverse primer: TCCTCACCAGGATGTTCAGA (SEQ ID NO: 8)

[0136] The specific PCR process is the same as that for mIFNβ and mISG56.

[0137] The inhibitory effect of EDC is further demonstrated in the downstream pathway by the inhibition of TBK1 / IRF3 phosphorylation. Figure 2C ). Figure 2C Experimental procedure: BMDM was first used with different concentrations of EDC (concentration such as...) Figure 2C (As shown) Pretreated for 1 h, then treated with cGAMP (10 μM) for 2 h. After cell lysis, the phosphorylation levels of TBK1 and IRF3 proteins were measured by Western Blot. Specific method: Cell samples were lysed with RIPA (Thermo Fisher) containing 1% protease / phosphatase inhibitor (Cell Signaling Technology), separated by 10% SDS-PAGE gel electrophoresis (120V, 80 min), and then transferred to a PVDF membrane (100V, 2 h). Subsequently, the PVDF membrane was blocked in TBST containing 5% BSA for 1 h and incubated overnight at 4°C with primary antibodies p-TBK1, p-IRF3, and GAPDH (all antibodies purchased from Cell Signaling Technology). After washing with TBST, the membrane was incubated with secondary antibody at room temperature for 2 h. After washing, the membrane was developed with ECL (Bio-Rad) contrast agent.

[0138] Furthermore, this study also found that EDC treatment can prevent the translocation of STING from the endoplasmic reticulum (ER) to the Golgi apparatus. Figure 2D ).Figure 2D Experimental procedure: BMDM were pre-treated with EDC (20 μΜ) for 1 h, then treated with cGAMP (10 μΜ) for 30 min before immunofluorescence staining and observed by LSM 900 inverted confocol. Figure 2D The results indicate that EDC can inhibit the activation of STING in the initial stage. The STING antagonistic effect of EDC was further demonstrated using PBMCs from healthy donors (HD), while BAFF was found to be reduced, which is a characteristic ISG and therapeutic target in the pathogenesis of SS [Groom, J., Kalled, S. L., Cutler, A. H., Olson, C., Woodcock, S. A., Schneider, P., Tschopp, J., Cachero, T. G., Batten, M., Wheway, J., Mauri, D., Cavill, D., Gordon, T. P., Mackay, C. R., Mackay, F. (2002) Association of BAFF / BLyS overexpression and altered B cell differentiation with Sjogren's syndrome. J Clin Invest 109, 59-68; Nocturne, G. and Mariette, X. (2013) Advances in understanding the pathogenesis of primary Sjogren's syndrome. Nat Rev Rheumatol 9, 544-56].

[0139] Finally, Figure 2EComputer simulation docking was used to determine the interaction between candidate drug (STING antagonist) and human STING (PDB ID: 4EF5) between the C-terminal domain. Therefore, the discovery that EDC can form a stable binding with human STING dimer at -7.68 in AG (kilo-cal / mol) was also supported by computer calculation (AutoDock). Computer simulation molecular-protein docking (AutoDock) process: search the PDB ID of the target protein STING on Uniprot as 4EF5, obtain the three-dimensional structure file of the target protein through RSCB PBD database (https: / / www.rcsb.org / ), and download it into PDB format. The target protein is pretreated with AutoDockTools-1.5.6 and PyMOL software, the Gasteiger charge of the structure is calculated, and the PDBQT file is saved. Autodock is used to evaluate the binding affinity of small molecule drugs (EDC) and human STING protein, and the conformation with the lowest binding energy of the two is selected in the docking simulation. In general, the lower the binding energy, the more likely the two will bind.

[0140] According to the current research results, the bioavailability of EDC shows that EDC can be detected in salivary glands (SG), plasma and urine within 4 hours after oral treatment. In order to understand whether this also occurs in lymphoid organs, the mice were orally administered with 50 mg / mL EDC, 0.2 mL per mouse, and the lysates of immune cells were collected at the same time. Subsequently, the spleen cell samples of the experimental mice and the control mice were analyzed using liquid chromatography-tandem mass spectrometry (LC-MS / MS), and the standard EDC was dissolved in acetonitrile and diluted to a concentration gradient (0.1-100 μg / mL). The analysis of the chromatogram shows that EDC exists in the spleen (see Figure 3), and most of the IFN-I producing cells (macrophages, plasmacytoid dendritic cells, etc.) exist in the spleen. Therefore, the mice were pretreated with EDC for 1 hour, and then subcutaneously injected with DMXAA. Notably, DMXAA enhanced the IFN-I signal in the spleen, but was significantly inhibited by EDC.

[0141] This example also studies the therapeutic effect of EDC on ESS mice. Since the production of IFN-I mainly depends on the dependence on STING during ESS induction, the inhibitory effect of EDC on IFN-I of ESS spleen cells was studied. Consistently, it was found that EDC treatment in the culture significantly inhibited the expression levels of IFN-I and BAFF after NA stimulation (see Figure 4A). Experimental procedure: Spleens from mice 3 weeks after ESS were taken and ground to obtain splenocytes. RPMI 1640 medium containing 10% FBS was added with mouse GM-CSF (15 ng / ml) and M-CSF (15 ng / ml) to maintain the activity of dendritic cells and macrophages in the spleen cells, and PMA (Phorbol ester) and Ionomycin (ionomycin) stimulators were added, and A353 apoptosis protein and mouse autologous serum were added. The experimental group was given positive control H151 or different concentrations of EDC (concentrations such as Figure 4A shown), and the cells were subjected to qPCR after 20h of culture to measure ISG expression level.

[0142] Primer information is as follows:

[0143] mIFNα:

[0144] Forward primer: GGATGTGACCTTCCTCAGACTC (SEQ ID NO: 9)

[0145] Reverse primer: ACCTTCTCCTGCGGGAATCCAA (SEQ ID NO: 10)

[0146] mBAFF:

[0147] Forward primer: CTACCGAGGTTCAGCAACACCA (SEQ ID NO: 11)

[0148] Reverse primer: GAAAGCGCGTCTGTTCCTGTGG (SEQ ID NO: 12)

[0149] The specific PCR process is the same as above, except that the primers are replaced.

[0150] The in vivo therapeutic effect of EDC was also studied in this example. It is worth noting that ESS mice receiving higher doses of oral EDC treatment or H-151 (intraperitoneal injection) showed improvement in disease pathology, showing the preservation of salivary function and the reduction of serum autoantibodies (see Figure 4B ). In line with the splenic distribution of EDC, inhibition of the STING / IFN-I axis was evident, as reflected by reduced ISG56 expression (see Figure 4C ). Given the role of IFN-I in B cell responses, phenotypic analysis showed a significant reduction in germinal center (GC) B cells and plasma cells after treatment with EDC or H-151 (see Figure 4DExperimental procedure: 6-8 week old mice were randomly divided into four groups: ESS group, high-dose EDC group (oral administration 50 mg / kg), low-dose EDC group (oral administration 25 mg / kg), and H151 group (intraperitoneal injection 10 mg / kg). ESS modeling began 3 days after immunization, with medication administered once daily until day 21, at which point the mice were sacrificed. Saliva function was measured, and serum autoantibodies were detected using ELISA (MyBioSource, catalog number MBS260777). Figure 4B Splenic cells were cultured in RPMI 1640 medium for 20 h after stimulation with A253 apoptosis protein and autologous serum, and the expression level of ISG56 was detected by PCR (the primer sequence and PCR procedure for mISG56 were the same as above). Figure 4C Simultaneously, flow cytometry was used to detect the levels of germinal center cells and plasma cells in spleen cells. Figure 4D Finally, given the structural similarity between EDC and its derivatives, other similarities were also evaluated. Figure 1 The EDC derivatives shown inhibit the ability of human and mouse macrophages to produce IFN-I. The results indicate that these chemicals can effectively inhibit STING-induced IFN-I and ISG, such as... Figure 5 As shown. Experimental methods: The molecular structures of eriodictyol (EDC) and its derivatives, eriocitrin (ECT), hesperetin (Hes), eriodictyol-7-O-glucoside (E7G), 3,4-dihydroxyhydrocinnamic acid (3,4D), and homoeriodictyol (Homo) are shown below. Figure 1 As shown. The inhibitory effects of the above six compounds on STING-induced IFN-I and ISG were detected in human THP-1 macrophages and mouse BMDM macrophages, respectively. The procedure is as follows: First, six different concentrations (concentrations are shown in the figure) were used. Figure 5 Cells were pretreated with the compound shown in the figure for 1 h, followed by stimulation with cGAMP (10 uM), a human-mouse STING agonist, for 6 h. Cells were then collected and qPCR was performed to measure IFN-I and ISG expression levels. The results are shown in the figure. Figure 5 As shown. The primer sequences for mIFNβ and hIFNβ are the same as before.

[0151] mIL6:

[0152] Forward primer: CCAAGGCAAGAGCTATGTCCTG (SEQ ID NO: 13)

[0153] Forward primer: CAGTTCCTGCAGAAAAAGGCAA (SEQ ID NO: 15)

[0154] hIL6:

[0155] Forward primer: CAGTTCCTGCAGAAAAAGGCAA (SEQ ID NO: 15)

[0156] Reverse primer: AGCTGCGCAGAATGAGATGA (SEQ ID NO: 16)

[0157] The specific PCR procedure is the same as above, except that the primers are replaced.

[0158] Summary:

[0159] In this example, EDC was studied and found to have a strong inhibitory effect on both human and murine STING-mediated IFN-I signaling. Oral administration of EDC significantly improved the development of experimental dry syndrome (ESS) in mice, indicating that EDC is a STING antagonist that can be used to treat STING-related inflammatory diseases. In addition, it was found that:

[0160] (1) Eriodictyol (EDC) effectively inhibited STING-mediated IFN-I production and IFN-I induced genes (ISGs) in human macrophages (THP-1 cell line), monocytes (primary culture), and murine macrophages (primary culture);

[0161] (2) After oral treatment, EDC can be rapidly detected in serum and spleen and effectively inhibits STING-mediated IFN-I and ISG in mice;

[0162] (3) Based on the advantages of the established ESS mouse model [Lin, X., Rui, K., Deng, J., Tian, J., Wang, X., Wang, S., Ko, K. H., Jiao, Z., Chan, V. S., Lau, C. S., Cao, X., Lu, L. (2015) Th17 cells play a critical role in the development of experimental Sjogren's syndrome. Ann Rheum Dis 74, 1302-10; Wei, Y., Peng, N., Deng, C., Zhao, F., Tian, J., Tang, Y., Yu, S., Chen, Y., Xue, Y., Xiao, F., Zhou, Y., Li, X., Zou, H., Rui, K., Lin, X., Lu, L. (2022) Arylhydrocarbon receptor activation drives polymorphonuclear myeloid-derived suppressor cell response and efficiently attenuates experimental Sjogren's syndrome. Cell Mol Immunol 19, 1361-1372], the critical role of STING in the pathogenesis of SS was determined. EDC treatment significantly improved the disease pathology and IFN-I signaling in experimental SS (ESS) mouse models.

[0163] Overall, EDC was shown to effectively inhibit human and murine STING. In summary, oral treatment with EDC can inhibit IFN-I in ESS mice. Currently, the literature indicates that EDC is actually non-toxic, but has protective effects on neuronal cells and keratinocytes, and is anti-testicular toxic. Therefore, the results indicate that EDC and its derivatives can inhibit human and murine STING activation and IFN-I production. They have good bioavailability and therapeutic potential for STING-related inflammatory diseases. In particular, EDC can be detected in lymphoid organs and salivary glands, which are target organs for SS.

[0164] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosed application belongs. The publications cited herein and their citations are specifically incorporated by reference herein.

[0165] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific examples of the application described herein. Such equivalents are considered to be within the scope of the following claims.

Claims

1. Use of eriodictyol or a derivative thereof in the manufacture of a medicament for the prevention and / or treatment of a stimulator of interferon genes (STING)-associated disease.

2. Use according to claim 1, wherein, The derivative of eriodictyol is selected from one or more of eriodictyol, hesperetin, eriodictyol-7-0-glucoside, 3,4-dihydroxyhydrocinnamic acid, and homoeriodictyol.

3. Use according to claim 1, wherein, The STING-associated disease is a STING-associated inflammatory disease or an autoimmune disease associated with type I interferon (IFN-I) production; Preferably, the autoimmune disease associated with IFN-I production is selected from one or more of Sjogren's syndrome (SS), systemic lupus erythematosus (SLE), multiple sclerosis, Parkinson's syndrome, Alzheimer's disease, and amyotrophic lateral sclerosis.

4. The use according to claim 1, wherein, The prevention and / or treatment of the STING-associated disease is inhibition or reduction of STING activation, STING-mediated IFN-I production, and / or type I interferon inducible gene (ISG) production.

5. The use according to claim 1, wherein, The medicament comprises: eriodictyol or a derivative thereof; one or more pharmaceutically acceptable carriers; and optionally one or more pharmaceutically acceptable excipients; wherein the eriodictyol or a derivative thereof is present in the medicament in an amount effective to inhibit or reduce STING activation, STING-mediated IFN-I production, and / or ISG production.

6. Use according to claim 5, wherein, The concentration of the eriodictyol or a derivative thereof in the medicament is 1 μΜ to 10 mM, 1 μΜ to 5 mM, 10 μΜ to 1 mM, or 10 μΜ to 500 μΜ; or the concentration of the eriodictyol or a derivative thereof is 0.1 to 100 mg / mL, 0.1 to 75 mg / mL, 0.1 to 50 mg / mL, 0.1 to 25 mg / mL, 0.1 to 20 mg / mL, 0.1 to 15 mg / mL, 0.1 to 10 mg / mL, or 0.1 to 5 mg / mL, based on the total volume of the medicament; or the effective amount of the eriodictyol or a derivative thereof in the medicament is 0.01 to 1000 mg per kilogram of body weight of the subject per day, preferably 0.1 to 500 mg per kilogram of body weight of the subject per day, and more preferably 1 to 250 mg per kilogram of body weight of the subject per day.

7. Use according to claim 5, wherein, The medicament further comprises one or more therapeutic, prophylactic, and / or diagnostic agents; Preferably, the therapeutic, prophylactic, and / or diagnostic agent is selected from a bronchodilator, a corticosteroid, a methylxanthine, a phosphodiesterase-4 inhibitor, an anti-angiogenic agent, an antibiotic, an antioxidant, an antiviral agent, an antifungal agent, an anti-inflammatory agent, an immunosuppressant, an anti-allergic agent, and combinations thereof.

8. The use according to claim 1, wherein, The medicament is an oral dosage form or a dosage form for parenteral, enteral, or transmucosal administration.

9. The use according to claim 7, wherein, The oral dosage form is an oral solid dosage form or an oral liquid dosage form; Preferably, the oral solid dosage form is selected from the group consisting of tablets, capsules, powders, lozenges, chewable tablets, multiparticulates and nanoparticles, gels, solid solutions, liposomes and films; more preferably, the oral solid dosage form is formulated for immediate release or sustained release; further preferably, the sustained release is selected from the group consisting of delayed release, sustained release, pulsatile release, controlled release, targeted release and programmed release; Preferably, the oral liquid dosage form is selected from the group consisting of sprays, suspensions, solutions, syrups and elixirs.

10. Use of eriodictyol or a derivative thereof in the manufacture of a STING antagonist.

Images