Saccharomyces cerevisiae genetically engineered bacterium with ATF1 and ALD6 genes knocked out as well as construction method and application of saccharomyces cerevisiae genetically engineered bacterium

Abstract

The invention relates to the technical field of genetically engineered microorganisms, and particularly discloses a saccharomyces cerevisiae genetically engineered bacterium with ATF1 and ALD6 genes knocked out as well as a construction method and application of the saccharomyces cerevisiae genetically engineered bacterium, and the preservation number of the saccharomyces cerevisiae genetically engineered bacterium is CCGMCC No.35992. The original saccharomyces cerevisiae gene knockout ATF1 and ALD6 genes are modified to obtain the saccharomyces cerevisiae genetically engineered bacterium, and compared with the original saccharomyces cerevisiae, the saccharomyces cerevisiae genetically engineered bacterium with the ATF1 and ALD6 genes knockout shows higher ethanol yield and lower acetate substance concentration in the beer fermentation process; the ethanol yield and the taste of the upper fermentation type beer fermented by the saccharomyces cerevisiae are greatly improved.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of genetic engineering and microbial technology, and particularly relates to a Saccharomyces cerevisiae genetic engineering strain with ATF1 and ALD6 genes knocked out by CRISPR / Cas9 technology, a construction method thereof and application. BACKGROUND

[0002] The process of beer brewing is the process of Saccharomyces cerevisiae fermenting sugar substances such as maltose and glucose to produce ethanol. In the fermentation process, yeast produces various alcohol substances and ester substances through bypass metabolism, which together constitute the rich taste of beer. Ester substances are the main components of beer flavor substances, mainly including acetate, lactate, hexanoate, etc., which impart fruity or floral flavors to the product. However, when the content of ester substances is too high, the taste of the fermented product will change, and off-flavor substances will appear. For example, when the content of ethyl acetate exceeds a certain threshold, the wine body will have a heavy bitter taste.

[0003] Higher alcohols are a general term for alcohols with more than 2 carbon atoms, which usually have a rich smell and taste and are directly related to the quality of beer. An appropriate amount of higher alcohols can impart a rich, soft, full-bodied and harmonious taste to beer. However, when the content of higher alcohols exceeds a certain threshold, the wine body will produce off-flavors, and excessive higher alcohols will also cause the drinker to have a "head" symptom. However, too low a content of higher alcohols will make the wine flavor tasteless and thin.

[0004] Controlling the content of higher alcohols and the ratio of esters is a key factor in improving the flavor of beer.

[0005] In addition to flavor substances such as higher alcohols and esters, the main flavor substance of fermented wine is ethanol. In the process of yeast fermentation to produce ethanol, glycerol is the main byproduct of this process, and excessive glycerol synthesis not only affects the sugar-alcohol conversion efficiency, but also affects the energy allocation and consumption of yeast cells. According to the synthesis pathway, decomposition pathway and energy metabolism pathway of glycerol, it is an effective way to improve the ethanol yield by reasonably constructing an engineering strain with low glycerol production and no metabolic burden.

[0006] The above is the analysis of the inventors on the problems existing in the fermentation process technology, which does not constitute the general understanding of the prior art. SUMMARY

[0007] The purpose of the present application is to overcome the technical problems in the prior art, and to provide a Saccharomyces cerevisiae genetic engineering strain with ATF1 and ALD6 genes knocked out by CRISPR / Cas9 technology, in order to improve the ethanol production capacity of Saccharomyces cerevisiae and reduce the excessive generation of ester substances in the fermentation process, and improve the bitter taste of the wine body.

[0008] The application also aims to provide a construction method of the genetically engineered Saccharomyces cerevisiae strain.

[0009] The application also aims to provide an application of the genetically engineered Saccharomyces cerevisiae strain.

[0010] Invention idea: Ethanol acetyltransferase ATF1 is involved in the metabolic pathways of various ester substances. Regulating the synthesis of ATF is a key factor for changing the synthesis of total ester substances in the fermentation process. Acetaldehyde dehydrogenase (encoded by the ALD6 gene) is a key enzyme for catalyzing acetaldehyde to generate acetic acid, and the accumulation of acetic acid not only is a direct precursor of ethyl acetate, but also causes the pH of the fermentation broth to drop, produces a sharp sour taste, affects the flavor balance of the product, and may inhibit the growth of the strain.

[0011] To achieve the above-mentioned application purposes, the application provides the following technical solutions. In a first aspect, the application provides a brand-new genetically engineered yeast strain.

[0012] A genetically engineered Saccharomyces cerevisiae strain, which has a preservation number of CCGMCC No. 35992.

[0013] The engineered strain is named Saccharomyces cerevisiae Saccharomyces cerevisiae, and belongs to yeast.

[0014] The preservation conditions are as follows: Culture medium: culture medium yeast extract 10 g / L, peptone 20 g / L, glucose 20 g / L, and agar powder 20 g / L, culture temperature 30 degrees Celsius, culture pH 6.0-6.5, temperature (℃): 30, culture time (days): 2-3. Long-term preservation method: ultra-low temperature freezing. It is a non-pathogenic bacteria, and is used for fermentation strains.

[0015] Further, a genetically engineered Saccharomyces cerevisiae strain, wherein the engineered strain is obtained by knocking out the ATF1 and ALD6 genes from the original Saccharomyces cerevisiae.

[0016] The original Saccharomyces cerevisiae is Saccharomyces cerevisiae.

[0017] Preferably, the original Saccharomyces cerevisiae is SafAle Ale Yeast S-04. Preferably, the SafAle Ale Yeast S-04 is purchased from Fermentis, France.

[0018] The nucleotide sequences of the ATF1 and ALD6 genes before inactivation are shown in SEQ ID NO. 17 and SEQ ID NO. 18.

[0019] The ATF1 and ALD6 genes are knocked out by CRISPR-Cas9 technology, and the inactivated nucleotide sequences are shown in SEQ ID NO. 19 and SEQ ID NO. 20.

[0020] In a second aspect, the present application provides a genetic engineering construction method of the above-mentioned yeast, to obtain a corresponding genetically edited yeast strain.

[0021] A construction method of the above-mentioned genetically engineered Saccharomyces cerevisiae strain comprises the following steps: The Cas9-NAT plasmid is introduced into the Saccharomyces cerevisiae S04 to obtain a yeast strain containing Cas9; the gRNA fragment of the ATF1 gene is connected to the pMEL13 skeleton to construct the ATF1-gRNA plasmid; then, the ATF1-gRNA plasmid and the repair fragment of the ATF1 gene are co-transformed into the Saccharomyces cerevisiae S04 containing the Cas9 plasmid to knock out the ATF1 gene, thereby constructing the S04-ΔATF1 recombinant strain. The Cas9-NAT plasmid is introduced into the S04-ΔATF1 recombinant strain, the gRNA fragment of the ALD6 gene is connected to the pMEL13 skeleton to construct the ALD6-gRNA plasmid; then, the ALD6-gRNA plasmid and the repair fragment of the ALD6 gene are co-transformed into the S04-ΔATF1 recombinant strain containing the Cas9 plasmid to knock out the ALD6 gene, thereby constructing the S04-ΔATF1ΔALD6 recombinant strain.

[0022] Further, a construction method of the above-mentioned genetically engineered Saccharomyces cerevisiae strain comprises the following steps: (1) The gRNA and repair fragment for the ATF1 gene are designed based on the Saccharomyces cerevisiae S04 as the original Saccharomyces cerevisiae.

[0023] (2) Construction of the gRNA plasmid of the ATF1 gene: the gRNA fragment of the ATF1 gene is connected to the pMEL13 skeleton by assembly, and the E. coli DH5α is transformed and the ATF1-gRNA plasmid is extracted.

[0024] (3) Transformation of the Cas9 plasmid: the Cas9-NAT plasmid is introduced into the Saccharomyces cerevisiae S04.

[0025] (4) Preparation of the repair fragment: a double-stranded DNA fragment containing the homologous arms upstream and downstream of the ATF1 gene is synthesized.

[0026] (5) Co-transformation of the gRNA plasmid of the ATF1 gene and the repair fragment: the gRNA plasmid obtained in step (2) and the repair fragment obtained in step (4) are co-transformed into the yeast strain containing Cas9, and the transformants are obtained by resistance screening.

[0027] (6) Verify the knockout of the ATF1 gene: The knockout of the ATF1 gene is verified by colony PCR and sequencing, and the S04-ΔATF1 recombinant strain is successfully constructed.

[0028] (7) The S04-ΔATF1 strain successfully constructed is designed with a gRNA and a repair fragment for the ALD6 gene for the original Saccharomyces cerevisiae.

[0029] (8) Construct the gRNA plasmid of the ALD6 gene: The gRNA fragment of the ALD6 gene is connected to the pMEL13 backbone by Gibson assembly, and the ALD6-gRNA plasmid is extracted after transforming Escherichia coli DH5α.

[0030] (9) Transform the Cas9 plasmid: The Cas9-NAT plasmid is introduced into the S04-ΔATF1 recombinant strain successfully constructed in step (6).

[0031] (10) Prepare the repair fragment: A double-stranded DNA fragment containing the homologous arms upstream and downstream of the ALD6 gene is synthesized.

[0032] (11) Co-transform the gRNA plasmid of the ALD6 gene and the repair fragment: The gRNA plasmid obtained in step (8) and the repair fragment obtained in step (10) are co-transformed into the S04-ΔATF1 yeast strain containing Cas9, and the transformants are obtained by resistance screening.

[0033] (12) Verify the knockout of the ALD6 gene: The knockout of the ALD6 gene is verified by colony PCR and sequencing, and the S04-ΔATF1ΔALD6 recombinant strain is successfully constructed.

[0034] Further, in step (2), the nucleotide sequences of the ATF1 gene gRNA target site primers are shown in SEQ ID NO. 1 and SEQ ID NO. 2.

[0035] Further, in step (2), the nucleotide sequences of the pMEL13 backbone amplification primers are shown in SEQ ID NO. 3 and SEQ ID NO. 4.

[0036] Further, in step (2), the nucleotide sequences of the sequencing primers for constructing the gRNA plasmid of the ATF1 gene are shown in SEQ ID NO. 5 and SEQ ID NO. 6.

[0037] Further, in step (4), the nucleotide sequences of the primers for constructing the repair fragment of the ATF1 gene are shown in SEQ ID NO. 7 and SEQ ID NO. 8.

[0038] Further, in step (6), the nucleotide sequences of the colony PCR sequencing verification primers are shown as SEQ ID NO. 9 and SEQ ID NO. 10.

[0039] Further, in step (8), the nucleotide sequences of the ALD6 gene gRNA target site primers are shown as SEQ ID NO. 11 and SEQ ID NO. 12.

[0040] Further, in step (8), the nucleotide sequences of the pMEL13 backbone amplification primers are shown as SEQ ID NO. 3 and SEQ ID NO. 4.

[0041] Further, in step (8), the nucleotide sequences of the sequencing primers for constructing the ALD6 gene gRNA plasmid are shown as SEQ ID NO. 5 and SEQ ID NO. 6.

[0042] Further, in step (10), the nucleotide sequences of the ALD6 gene repair fragment primers are shown as SEQ ID NO. 13 and SEQ ID NO. 14.

[0043] Further, in step (12), the nucleotide sequences of the colony PCR sequencing verification primers are shown as SEQ ID NO. 15 and SEQ ID NO. 16.

[0044] To achieve the above-mentioned third aspect, the application provides the use of the above-mentioned yeast strain.

[0045] The use of the above-mentioned Saccharomyces cerevisiae genetically engineered strain in the fermentation preparation of ethanol should also be included in the protection scope of the application.

[0046] Further, the use of the above-mentioned Saccharomyces cerevisiae genetically engineered strain in the fermentation of ethanol-containing beverages, such as the use in the fermentation production of beer.

[0047] Further, the use is through liquid fermentation to produce beer.

[0048] Preferably, the seed liquid of the Saccharomyces cerevisiae genetically engineered strain is inoculated into the fermentation medium at a volume ratio of 5-20%. Preferably, the seed liquid is inoculated into the fermentation medium at a volume ratio of 10%.

[0049] Further, the fermentation temperature is 25-35℃. Preferably, 27-33℃, more preferably 28-32℃, and most preferably 29-31℃.

[0050] Further, the fermentation temperature is 30℃.

[0051] Further, the fermentation time is 20-30h.

[0052] Further, the fermentation production beer uses YPD culture medium.

[0053] Preferably, the YPD culture medium formula is as follows: 10-40g / L glucose, 10-30g / L peptone, 5-20g / L yeast extract, and the solvent is water.

[0054] Preferably, the YPD culture medium formula is as follows: 18-25g / L glucose, 18-22g / L peptone, 8-12g / L yeast extract, and the solvent is water.

[0055] Further, the fermentation YPD culture medium formula is as follows: 20g / L glucose, 20g / L peptone, 10g / L yeast extract, and the solvent is water.

[0056] Compared with the prior art, the present application has the following advantages: The Saccharomyces cerevisiae genetic engineering strain for knocking out ATF1 and ALD6 genes of the present application has higher ethanol yield, lower ester substance generation, improved wine body taste, and enhanced palatability compared with the original strain S04 in the fermentation process.

[0057] DEPOSIT DESCRIPTION Strain name: Saccharomyces cerevisiae.

[0058] Latin name: Saccharomyces cerevisiae .

[0059] Deposit unit: China General Microbiological Culture Collection Center.

[0060] Abbreviation of the deposit institution: CGMCC.

[0061] Address: No. 1, Yihuan Road, Beijing, China Institute of Microbiology, Chinese Academy of Sciences.

[0062] Postal code: 100101.

[0063] Deposit date: September 25, 2025.

[0064] Deposit center registration number: CGMCC No. 35992. BRIEF DESCRIPTION OF DRAWINGS

[0065] Figure 1 The pMEL13 linear skeleton obtained by cutting and recovering PCR amplification in Example 1, wherein M: DNA molecular weight marker, 1-2 is pMEL13 linear skeleton (6106bp).

[0066] Figure 2 PCR identification electrophoresis map of the transformant with ATF1 gene deletion in Example 1, wherein M: DNA molecular weight marker, 1-3 are ATF1 gene knockout fragments (675 bp).

[0067] Figure 3 PCR identification electrophoresis map of the transformant with ALD6 gene deletion in Example 2, wherein M: DNA molecular weight marker, 4-6 are ALD6 gene knockout fragments (742 bp).

[0068] Figure 4 Ethanol yield data of the original strain S04 (WT) and the S04-ΔATF1ΔALD6 gene knockout strain obtained in Example 2.

[0069] Figure 5 Ester data of the original strain S04 (WT) and the S04-ΔATF1ΔALD6 gene knockout strain obtained in Example 2. DETAILED DESCRIPTION

[0070] The present application will be further described in conjunction with test examples and specific embodiments. However, it should not be understood that the scope of the above-mentioned subject matter of the present application is limited to the following examples only, and any technology realized based on the content of the present application falls within the scope of the present application.

[0071] Some reagent formulations used in the following examples are as follows.

[0072] The formulation of YPD liquid medium is as follows: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract, and water as solvent.

[0073] The formulation of YPD solid medium is as follows: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract, 20 g / L agar, and water as solvent.

[0074] The formulation of LB+Kan liquid medium is as follows: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, 50 mg / L kanamycin, and water as solvent.

[0075] Example 1 Construction of recombinant strain S04-ΔATF1 I. Construction of gRNA plasmid (1) Refer to the model yeast S04, input the target gene: ATF1 at the website http: / / yeastriction.tnw.tudelft.nl to obtain gRNA primers: ATF1 pMEL fw / rv (SEQ ID NO. 1 and SEQ ID NO. 2), ATF1_repair oligo fw / rv (SEQ ID NO. 7 and SEQ ID NO. 8), ATF1_dg fw / rv (SEQ ID NO. 9 and SEQ ID NO. 10) for subsequent experiments. The nucleotide sequence before inactivation of the ATF1 gene is SEQ ID NO. 17.

[0076] (2) Construct gRNA plasmid, centrifuge the ATF1 pMEL fw / rv primers at 13000 rpm for 1 min, add sterile water to dilute to 50 μM concentration, mix the primers at a volume ratio of 1:1, 95℃ in the PCR instrument for 5 min; measure the concentration with Nanodrop.

[0077] (3) Take pMEL13 plasmid as template, amplify linear skeleton by pMEL13_F (SEQ ID NO. 3) and pMEL13_R (SEQ ID NO. 4) primers, the PCR reaction system is shown in Table 1 below, and the PCR reaction conditions are as follows: 1) 95℃ pre-denaturation for 5 min; 2) 95℃ denaturation for 15 s, 56℃ annealing for 15 s, 72℃ extension for 2 min, three steps for 35 cycles (polymerase chain reaction), and then 72℃ extension for 5 min. After the PCR product was confirmed by 1% agarose gel electrophoresis, see Figure 1 , the pMEL13 linear skeleton was recovered and purified by gel cutting.

[0078] Table 1: PCR reaction system

[0079] (4) Use Hieff Clone Universal II One Step Cloning Kit reagent to connect the double-stranded ATF1 gRNA fragment and the pMEL13 linear skeleton. Mix the gRNA fragment and the pMEL13 linear skeleton according to the molar ratio of 5:1, then add the connection system, the reaction system is shown in Table 2 below, and the reaction system is placed at 50℃ for 30 min.

[0080] (5) Take all the reaction solution into E. coli DH5a, spread the bacterial solution on LB+Kan antibiotic plate, and incubate at 37°C for 16 h. Pick single colony and inoculate in a test tube containing 5 mL LB+Kan liquid medium, and incubate at 37°C, 160 rpm for 12-16 h. Collect the bacterial cells, extract the plasmid using a plasmid extraction kit, and perform sequencing confirmation. The sequencing primer sequences pMseq1 and pMseq2 are shown in SEQ ID NO. 5 and SEQ ID NO. 6.

[0081] Table 2: Gibson connection reaction system

[0082] II. Preparation of repair fragments (1) When knocking out a gene, the repair fragment is a 120 bp sequence, including 60 bp upstream and 60 bp downstream of the coding sequence of the target gene. The repair primer sequences of ATF1 are ATF1_repair oligo fw and ATF1_repair oligo rv, as shown in SEQ ID NO. 7 and SEQ ID NO. 8.

[0083] Dilute the single-stranded primer to 10 μM with sterile water, mix the two complementary strands at a ratio of 1:1, heat at 95°C for 5 min, and obtain a double-stranded repair fragment after cooling to room temperature. Measure the concentration with a Nanodrop, and store at -20°C for standby use.

[0084] III. Preparation of Saccharomyces cerevisiae strain competence (1) Pick Saccharomyces cerevisiae strain S04 and inoculate in 5 mL YPD liquid medium, and incubate at 30°C, 200 r / min overnight to obtain activated seed solution.

[0085] (2) According to the inoculation ratio of 2%, transfer the seed solution to 50 mL fresh YPD liquid medium, and incubate at 30°C, 200 r / min overnight until OD600 (Eppendorf BioPhotometer plus, Germany) is between 0.8-1.2.

[0086] (3) Centrifuge the bacterial solution obtained in step (2) at 4°C, 4000 r / min for 5 min to collect the bacterial cells.

[0087] (4) Use 25 mL of pre-cooled sterile water to resuspend the bacteria, and use a low-temperature high-speed centrifuge at 4000 r / min for 5 min at 4°C to collect the bacteria, repeat twice; use 10 mL of pre-cooled 1M sorbitol aqueous solution to resuspend the bacteria, and use a low-temperature high-speed centrifuge at 4000 r / min for 5 min at 4°C to collect the bacteria, repeat twice.

[0088] (5) Use 1 mL of 1M sorbitol aqueous solution to resuspend the bacteria, and divide 100 μL per tube.

[0089] Four, Cas9 plasmid introduction (1) Take 1 tube of the yeast strain prepared in step three, add 1 μg of Cas9 plasmid, mix, and then transfer all to an ice-precooled electroporation cup.

[0090] (2) Place on ice for 5 min, wipe the electroporation cup dry, and set the parameters of the electroporation instrument to 1.5kv, 25 μF, 200Ω, and 5.0 ms.

[0091] (3) Add 1 mL of YPD medium to the electroporation cup after the electroporation is completed, use the liquid for pipette blowing and suction, and transfer to a 1.5 mL EP tube, and culture in a shaker at 30°C and 200 r / min for 1 h.

[0092] (4) Take 100 μL of bacterial solution and spread on a YPD medium plate containing NAT resistance, and culture at 30°C until colonies appear.

[0093] Five, gRNA plasmid and repair fragment transformation (1) Prepare the yeast strain containing the Cas9-NAT plasmid transformed successfully in step four into competence according to the method in step three.

[0094] (2) Take the prepared yeast strain into competence, and co-transform the gRNA plasmid constructed in step one and the repair fragment of the ATF1 gene constructed in step two into the competent cells.

[0095] (3) Add 1 mL of YPD medium to the electroporation cup after the electroporation is completed, use the liquid for pipette blowing and suction, and transfer to a 1.5 mL EP tube, and culture in a shaker at 30°C and 200 r / min for 1 h.

[0096] (4) Take 100 μL of bacterial solution and spread on a YPD medium plate containing NAT resistance and G418 resistance for double screening, and culture at 30°C until colonies appear.

[0097] Six, colony PCR verification (1) Take 1.5 mL centrifuge tube, add 95 μL 1% sterilized SDS, 5 μL 4 M lithium acetate, then randomly pick several transformants from YPD+NAT+G418 plate into the solution, vortex to mix.

[0098] (2) After heating at 75℃ for 10 min, add 300 μL anhydrous ethanol, vortex to mix, centrifuge at 13,000 rpm for 3 min.

[0099] (3) Carefully suck the supernatant, open the cover and place in 37℃ incubator to dry.

[0100] (4) Add 50 μL sterilized water into the centrifuge tube, vortex to mix, then centrifuge at 13,000 rpm for 1 min.

[0101] (5) Use Nano Drop 2000 spectrophotometer to determine the concentration of the supernatant, adjust the concentration to 20 ng / μL with sterilized water, then use it as template for PCR amplification, the primers are shown in SEQ ID NO. 9 and SEQ ID NO. 10. The colony PCR system is shown in Table 3 below, and the PCR reaction conditions are as follows: 1) 95℃ pre-denaturation for 5 min; 2) 95℃ denaturation for 15 s, 56℃ annealing for 15 s, 72℃ extension for 2 min, three steps for 30 cycles (polymerase chain reaction, PCR), 72℃ extension for 5 min.

[0102] (6) The length of the amplification band of the successfully knocked-out ATF1 gene is 675 bp, and the length of the control band of the unknocked-out ATF1 gene is 2253 bp. After confirming the PCR product by 1% agarose gel electrophoresis, the electrophoresis result is shown in Figure 2 .

[0103] Table 3: Colony PCR reaction system

[0104] Seven, plasmid removal (1) The single colony transformant picked in step six is streaked on YPD solid medium and activated at 30℃ for 24 h.

[0105] (2) The bacterial solution is inoculated in 5 mL YPD liquid medium and cultured at 30℃ for 16 h; the bacterial solution is gradiently diluted by 10 to the power of 5 times with sterilized water, 100 μL of the diluted solution is spread on YPD solid medium and cultured at 30℃ for 24 h.

[0106] (3) The single colony is picked and dispersed with 1 mL sterilized water, then spotted on YPD, YPD+NAT and YPD+G418 solid medium respectively and cultured at 30℃ for 1-2 d.

[0107] (4) Select the colony that only grows on YPD plate, repeat step (3).

[0108] (5) The transformant that only grows on YPD plate after two times of spot plate is the target strain S04-ΔATF1 after plasmid removal, select single colony in YPD liquid medium for overnight culture, mix with sterilized 50% glycerol 1:1, and store at -80°C.

[0109] The nucleotide sequence of ATF1 gene after inactivation is shown in SEQ ID NO. 19.

[0110] Example 2 Construction of recombinant strain S04-ΔATF1ΔALD6 I. Construction of gRNA plasmid Referring to step I in Example 1, taking ALD6 gene as target gene, and the nucleotide sequence of ALD6 gene before inactivation is SEQ ID NO. 18. ALD6 gene specific gRNA primers ALD6 pMEL fw / rv (SEQ ID NO. 11 and SEQ ID NO. 12), ALD6_repair oligo fw / rv (SEQ ID NO. 13 and SEQ ID NO. 14), ALD6_dg fw / rv (SEQ ID NO. 15 and SEQ ID NO. 16) are designed and synthesized through website http: / / yeastriction.tnw.tudelft.nl. The linear skeleton is amplified by PCR with pMEL13 plasmid as template, and the gRNA plasmid of ALD6 gene is constructed by assembly, and verified correct by sequencing.

[0111] II. Preparation of repair fragment According to the method described in step II in Example 1, the repair primers ALD6_repair oligo fw and ALD6_repair oligo rv of ALD6 gene are synthesized, annealed to form double-stranded repair fragment, and stored for later use.

[0112] III. Preparation of Saccharomyces cerevisiae strain competence Taking S04-ΔATF1 as the starting strain, the competent cells are prepared according to the method of step III in Example 1.

[0113] IV. Introduction of Cas9 plasmid The Cas9 plasmid is introduced into the competent cells according to the method of step IV in Example 1.

[0114] V. Transformation of gRNA plasmid and repair fragment The gRNA plasmid of ALD6 gene and the repair fragment were co-transformed into S04-ΔATF1 competent cells containing Cas9 plasmid according to the method of step five in Example 1, and the transformants were screened on double-resistant plates (YPD+NAT+G418).

[0115] Six, colony PCR verification According to the method of step six in Example 1, the transformants were verified by PCR using ALD6_dg fw / rv primers, and the results are shown in Figure 3 The PCR identification electrophoretogram shows that the ALD6 gene is deleted, indicating that the ALD6 gene is successfully knocked out. The amplified band size of the strain with successfully knocked out ALD6 gene is 742 bp, and the band size of the control without knocking out is 2245 bp.

[0116] Seven, plasmid removal According to the method of step seven in Example 1, the recombinant strain S04-ΔATF1-ΔALD6 without any exogenous plasmid was obtained by continuous passage and spot plate screening.

[0117] The nucleotide sequence after inactivation of the ALD6 gene is shown in SEQ ID NO. 20.

[0118] Example 3 Introduction of Cas9 plasmid by lithium acetate transformation method I. Preparation of Saccharomyces cerevisiae competent cells Saccharomyces cerevisiae S04 and Saccharomyces cerevisiae S288C were used as the starting strains, and the competent cells were prepared according to the method of step three in Example 1.

[0119] II. Transformation of Cas9 plasmid by lithium acetate method (1) Heat salmon sperm DNA (ssDNA) at 100℃ for 5 min, and quickly place it on ice for standby.

[0120] (2) Prepare the transformation system in a 1.5 mL centrifuge tube according to the following Table 4, add 100 μL of the bacterial solution obtained in step one to the system, shake well, and heat shock at 42℃ for 40 min, invert the system every 20 min.

[0121] (3) Centrifuge at 8,000×g for 2 min, discard the transformation solution, wash twice with sterile water, then add 1 mL of YPD liquid medium, and incubate at 30℃, 160 rpm shaker for 4 h.

[0122] (4) Centrifuge at 8,000×g for 2 min, discard the medium, wash twice with sterile water, then resuspend the cells with 1 mL of sterile water, take 100 μL of the bacterial solution and spread it on YPD+NAT plate, and incubate in a constant temperature incubator at 30℃ for 1-2 d.

[0123] Table 4: Cas9 plasmid transformation system

[0124] From the transformation results, to quantitatively evaluate the transformation efficiency of lithium acetate method, standard Saccharomyces cerevisiae strain S288C and industrial Saccharomyces cerevisiae strain S04 were selected for comparison, and three independent repeated experiments were performed. The calculation formula of transformation efficiency is: the number of transformants (CFU) / the amount of plasmid DNA used (μg), and the results are shown in Table 5.

[0125] Table 5: Transformation efficiency of Cas9 plasmid by lithium acetate method

[0126] Note: The data is the average value of three independent experiments; "average number of transformants" refers to the number of colonies grown on the NAT-resistant plate.

[0127] The experimental results show that the lithium acetate method fails to successfully transform the Cas9 plasmid for the industrial Saccharomyces cerevisiae strain S04 (transformants are 0), but is effective for the standard strain S288c. Not all transformation methods can achieve the corresponding gene editing purpose, and the appropriate transformation method needs to be used to ensure the accuracy and reliability of knocking out the target gene.

[0128] Test Example 1 Comparison of fermentation between original strain and genetically engineered strain (1) 2 mL of original strain S04 (WT) and double gene knockout strain (ΔATF1 ΔALD6) constructed in Example 2 were added to 100 mL of sterilized YPD liquid medium for overnight culture and activation.

[0129] (2) The bacterial liquid obtained in step (1) was transferred to 5 L of YPD medium at a volume ratio of 10% inoculation ratio, and continued to be cultured and fermented at 30°C, 200 r / min until the end; the fermentation medium formula is as follows: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract, and water as solvent.

[0130] (3) The fermentation results are shown in Figure 4 and Figure 5 . Figure 4 The ethanol production data of the original strain S04 (WT) and the ΔATF1 ΔALD6 gene knockout strain in Example 1. Figure 5 The ester substance data of the original strain S04 (WT) and the ΔATF1 ΔALD6 gene knockout strain in Example 1.

[0131] From the fermentation data, it can be seen that under the same fermentation temperature and period, the ethanol production of the original strain S04 and the knockout strain S04-ΔATF1ΔALD6 is 23.15 g / L and 28.47 g / L respectively, and the ester content is 83.65 mg / L and 64.72 mg / L respectively. The ethanol production of the knockout strain S04-ΔATF1ΔALD6 is increased by about 23%, which significantly promotes the generation of ethanol; at the same time, the ester content is reduced by about 22.6%. The genetically edited engineering strain of the present application changes the metabolic flow from the ester synthesis pathway to the ethanol synthesis pathway, strengthens the fermentation product ratio, controls the beer hetero-flavor, and enriches the flavor of the fermentation product.

[0132] The present application provides a Saccharomyces cerevisiae genetically engineered strain with double knockout of ΔATF1 and ΔALD6 genes, a construction method thereof, and an application idea and method, and there are many methods and approaches to realize the technical scheme.

[0133] The primer sequences used in the above examples are shown in the following table.

[0134] Table 6

[0135] The nucleotide sequences of the yeast strain related genes in the above examples are as follows: Nucleotide sequence before inactivation of ATF1 gene (SEQ ID NO. 17)

[0136] Nucleotide sequence before inactivation of the ALD6 gene (SEQ ID NO. 18)

[0137] Nucleotide sequence after inactivation of the ATF1 gene (SEQ ID NO. 19) TGAACCCGGATAATTAAGAAGTGGTAAGCTTATGTTAGAGTACTTGTA CTTGACAAGTA AAATCAGAATTGGGAATTATCAATTGAGATCACGTGCAAACCGAAGAAATGCAA GAAGTAAGGT TAGGGTTTATGGACCCAGGCAGCAGAAAATTGTA GCTTCATTTGTTGGCACAGGACTAT TCCACCCTTAGAATTGACTTTTTGGACATTGAGCTAAGGTTCAATGC ACTCGATGGTCTTCTC ACTTCCGAATATATAGATCTAGCGTGTGAGGACTACTCATTGGCTTGC GATTACGGTTTTT ATATTTTTTTGCCGCACATCATTTTTTGGCCTGGTATTGT CATCGC GTTGAGCGGACTCTGAATATAATCCTATTGTTTTTTATGGATCTCTGGAAGCGTCTTTTT GAAGCCAACCCAACAAAAATT CGAGACAAGAAAATAAAAAACGGC ACTT CATCAGTATCACAAATACCATCAATTATCAGCTCTCATCTCACATGATGCTTGACTGATATTA TTTCGACAATATGATTATGTCGTGTA AATAACCCACTTTCATGTTGTC ACTCCCTCGGCTTTGGTTGGTTAAAGGGACTTATCGGTTTCTTTTTTTAGAGTTGATT TAAGATCAGATCGAAGTAAATAACGTGCAGAACATTG CATATGATAGATAACAACCTATAGT ATATATTTCAAATCGCGACAAATCTGAAATATTAATTGATTGATTAGCTGCAGAGATCTTCTC GATGTAAGGAGCTATTTAAATAGAAAGGGTCAGAATCGTCGTCCTGTGGGAGCTGGTATAT ACTAAATTGATGAACAAC TAAAATAGC ACTCTCATTGTCATTTGGGTGTGAGACCTTAAGCAAGGAGAGATATTTTTAATGGATGTAT TAGCGCAGCCGTTGCTTACGGTATT CCTTGGCATATTGTCCCTGAAAAAAAACC GTGTGTAC ACTCGGATACGCATTTTTCGGACTTCTCCC.

[0138] Nucleotide sequence after inactivation of the ALD6 gene (SEQ ID NO. 20) gctcgcctcatccccacgggaataaggcagccgacaaaagaaaaacgaccgaaaaggaaccagaaagaaaaaagagggtgggcgcgccgcggacgtgtaaaaagatatgcatccagcttctatatcgctttaactttaccgttttgggcatcgggaacgtatgtaacattgatctcctcttgggaacggtgagtgcaacgaatgcgatatagcaccgaccatgtgggcaaattcgtaataaattcggggtgagggggattcaagacaagcaaccttgttagtcagctcaaacagcgatttaacggttgagtaacacatcaaaacaccgttcgaggtcaagcctggcgtgtttaacaagttcttgatatcatatataaatgtaataagaagtttggtaatattcaattcgaagtgttcagtcttttacttctcttgttttatagaagaaaaaacatcaagaaacatctttaacatacacaaacacatactatcagaatacatgtaccaacctgcatttctttccgtcatatacacaaaatactttcatataaacttacttggtcttacgtcataaataaatatgtatacatataaattaaaaaatttggttttatatttttacaaaaagaatcgtttacttcatttctcccttttaagcgatacaatccatgaaaaaagagaaaaagagagaacaggcttgtgccttctttaaaacatcccacacaaaatcatattgaattgaattttacatcttaagctagtgtacaacaactgctatatccaaagaaaactaacgtggaccgcttttagagttgagaaaaaggtttgaaaaaaatagcaatacaaagacttgtttcatatataaaatacagggagcacattgagctaatataacataaacactgcgaaccaattccaatcaaaaggtacacatgagagcattcccccgagtactgccatttcgccatcagagatcatataataacatccttcttcgaac

[0139] It should be noted that, for those skilled in the art, several improvements and refinements can be made without departing from the principles of the present application, and these improvements and refinements should also be considered within the scope of protection of the present application. The components not explicitly described in the embodiments can be implemented using existing technologies.

[0140] Unless otherwise specified, the percentages appearing in the present application, if referring to solid raw materials, should be understood as mass percentages, and if referring to the percentages of two liquids, should be understood as volume percentages.

[0141] In the above embodiments, M represents molar concentration, which refers to the amount of substance of solute contained in a unit volume of solution. The commonly used unit is mol / L. For example, 1M represents a concentration of 1 mol / L; 2M represents a concentration of 2 mol / L.

[0142] EP tube, centrifuge tube, i.e. Eppendorf Tube, is the most commonly used microcentrifuge tube in molecular biology, biochemistry and clinical laboratory. EP tubes of different brands can be used without affecting the implementation of the present application.

[0143] NAT, i.e. Nourseothricin, is used to construct selective YPD medium. For example, a double screening YPD medium containing NAT resistance and G418 resistance.

[0144] SDS, i.e. sodium dodecyl sulfate, is a surfactant.

[0145] “Δ” is used to mark the deletion of a gene in a strain, for example, “ΔATF1” represents the knockout of the ATF1 gene.

[0146] In addition, the terms “first”, “second”, “third” and the like appearing in the description of the embodiments of the present application are only used to distinguish the same or similar components for description, and should not be understood as emphasizing or implying the relative importance of the specific components.

[0147] In addition, in the description of the embodiments of the present application, “several”, “a plurality of”, “several” represent at least 2. It can be 2, 3, 4, 5, 6, 7, 8, 9, etc. in any case, and even more than 9.

Claims

1. A genetically engineered strain of *Saccharomyces cerevisiae*, characterized in that, Its accession number is: CCGMCC No.35992.

2. The genetically engineered Saccharomyces cerevisiae strain according to claim 1, characterized in that, The engineered bacteria were obtained by knocking out the ATF1 and ALD6 genes from the original Saccharomyces cerevisiae.

3. The method for constructing a genetically engineered strain of *Saccharomyces cerevisiae* according to claim 1 or 2, characterized in that, Includes the following steps: Using the original S04 Saccharomyces cerevisiae, the Cas9-NAT plasmid was introduced to obtain a yeast strain containing Cas9; the gRNA fragment of the ATF1 gene was ligated into the pMEL13 backbone to construct the ATF1-gRNA plasmid; then, the ATF1-gRNA plasmid and the ATF1 repair fragment were co-transformed into the original S04 Saccharomyces cerevisiae containing the Cas plasmid to knock out the ATF1 gene and construct the S04-ΔATF1 recombinant strain. The Cas9-NAT plasmid was introduced into the S04-ΔATF1 recombinant strain, and the gRNA fragment of the ALD6 gene was ligated into the pMEL13 backbone to construct the ALD6-gRNA plasmid. Then, the ALD6-gRNA plasmid and the ALD6 repair fragment were co-transformed into the S04-ΔATF1 recombinant strain containing the Cas plasmid to knock out the ALD6 gene and construct the S04-ΔATF1ΔALD6 recombinant strain.

4. The method for constructing a genetically engineered strain of *Saccharomyces cerevisiae* according to claim 3, characterized in that, Includes the following steps: (1) Using Saccharomyces cerevisiae S04 as the original brewer's yeast, gRNA and repair fragments targeting the ATF1 gene were designed. (2) Constructing the gRNA plasmid of the ATF1 gene: The gRNA fragment of the ATF1 gene was ligated into the pMEL13 backbone by Gibson assembly, transformed into E. coli DH5α and the plasmid was extracted. (3) Transformation of Cas9 plasmid: The Cas9-NAT plasmid was introduced into yeast strain Saccharomyces cerevisiae S04; (4) Preparation of repair fragment: Synthesize a double-stranded DNA fragment containing the upstream and downstream homologous arms of the ATF1 gene; (5) Co-transformation of ATF1 gene gRNA plasmid and repair fragment: The gRNA plasmid obtained in step (2) and the repair fragment obtained in step (4) were co-transformed into yeast containing Cas9, and transformants were obtained by resistance selection; (6) Verification of ATF1 gene knockout: The knockout of ATF1 gene was verified by colony PCR and sequencing, and the S04-ΔATF1 recombinant strain was successfully constructed. (7) Design gRNA and repair fragments targeting the ALD6 gene using the successfully constructed S04-ΔATF1 strain as the original Saccharomyces cerevisiae. (8) Constructing the gRNA plasmid of the ALD6 gene: The gRNA fragment of the ALD6 gene was ligated into the pMEL13 backbone by Gibson assembly, transformed into E. coli DH5α and the plasmid was extracted. (9) Transformation of Cas9 plasmid: The Cas9-NAT plasmid was introduced into the S04-ΔATF1 recombinant strain successfully constructed in step (6); (10) Preparation of repair fragment: Synthesize a double-stranded DNA fragment containing the upstream and downstream homologous arms of the ALD6 gene; (11) Co-transformation of gRNA plasmid and repair fragment of ALD6 gene: The gRNA plasmid obtained in step (8) and the repair fragment obtained in step (10) were co-transformed into S04-ΔATF1 yeast containing Cas9, and transformants were obtained by resistance selection; (12) Verification of ALD6 gene knockout: The knockout of ALD6 gene was verified by colony PCR and sequencing, and the S04-ΔATF1ΔALD6 recombinant strain was successfully constructed.

5. The method for constructing a genetically engineered strain of *Saccharomyces cerevisiae* according to claim 4, characterized in that, In step (2), the nucleotide sequences of the primers for the ATF1 gene gRNA target site are shown in SEQ ID NO.1 and SEQ ID NO.

2.

6. The method for constructing a genetically engineered strain of *Saccharomyces cerevisiae* according to claim 4, characterized in that, In step (2), the nucleotide sequences of the pMEL13 backbone amplification primers are shown in SEQ ID NO.3 and SEQ ID NO.

4.

7. The method for constructing a genetically engineered strain of *Saccharomyces cerevisiae* according to claim 4, characterized in that, The nucleotide sequences of the sequencing primers used to construct the gRNA plasmid of the ATF1 gene are shown in SEQ ID NO.5 and SEQ ID NO.

6.

8. The application of a genetically engineered Saccharomyces cerevisiae strain according to claim 1 or 2, characterized in that, Application of engineered bacteria in the fermentation preparation of ethanol-containing beverages.

9. The application of the genetically engineered Saccharomyces cerevisiae strain according to claim 8, characterized in that, The application involves producing beer through liquid fermentation.

10. The application of the genetically engineered Saccharomyces cerevisiae strain according to claim 9, characterized in that, YPD medium is used for fermentation production of beer.

Images