Methods of making organosilicon compounds with selective cytochrome p450 variants and related compounds and compositions

Abstract

The present disclosure provides a method of preparing an organosilicon compound having at least one silicon-bonded methanol group and / or at least one silanol group from a cytochrome P450 variant that promotes oxidation of a silicon-bonded hydrocarbon group in the presence of an oxidizing agent. The method comprises combining the cytochrome P450 variant, an initial organosilicon compound having at least one silicon-bonded hydrocarbyl group, and a cofactor to obtain a reaction mixture, and exposing the reaction mixture to an oxidizing agent to oxidize the silicon-bonded hydrocarbyl group of the initial organosilicon compound, thereby producing the organosilicon compound having at least one silicon-bonded methanol group and / or at least one silanol group. Also disclosed are cytochrome P450 variants suitable for use in the methods, as well as methods for engineering and optimizing the cytochrome P450 variants. Nucleic acids encoding the cytochrome P450 variants as well as compositions, expression vectors and host cells comprising the nucleic acids are also disclosed.

Description

[0001] Cross Reference to Related Applications

[0002] This application claims priority to and all advantages of U.S. Provisional Patent Application No. 63 / 458,712, filed April 12, 2023, the contents of which are incorporated herein by reference. TECHNICAL FIELD

[0003] The present disclosure relates generally to catalysts and methods for preparing organosilicon compounds having at least one silicon-bonded methanol group and / or at least one silanol group, and more particularly to a cytochrome protein variant catalyst and to a method of using the cytochrome protein variant catalyst that selectively oxidizes a silicon-bonded hydrocarbon group to at least one silicon-bonded methanol group and / or at least one silanol group in an organosilicon compound. BACKGROUND

[0004] Silicones are polymeric materials used in many commercial applications primarily due to their having significant advantages over many carbon-based analogs. Silicones, more specifically known as polymeric siloxanes or polysiloxanes, include inorganic silicon-oxygen backbones (…-Si-O-Si-O-Si-O-…), which have organic side groups attached to the silicon atoms. The organic side groups can be used to connect two or more of these backbones together. By varying the -Si-O- chain length, side groups, and crosslinking, silicones can be synthesized with a wide variety of properties and compositions, where the consistency of the silicone network ranges from liquid to gel to rubber to hard plastic. Silicone materials and siloxane-based materials are used in a variety of end-use applications and environments, including as components in a wide variety of industrial, home care, and personal care formulations.

[0005] Various organosilicon compounds and organopolysiloxanes are used as precursors or diluents to prepare many silicone- and siloxane-based materials, as well as other products in the silicon industry. Such organosilicon compounds and organopolysiloxanes are also used as synthetic intermediates in organic synthesis, as monomeric building blocks for silicone-organic hybrid materials, and as catalysts for certain reactions.

[0006] Such organosilicon compounds and organopolysiloxanes have desirable properties, including stability and longevity under extreme conditions, including exposure to temperature changes, ultraviolet light, and the like. However, while these properties are desirable in many end-use applications, the stability of many organosilicon compounds and organopolysiloxanes results in their accumulation in the environment.

[0007] Further, when such organosilicon compounds and organopolysiloxanes are non-functional, they cannot readily react to form other reaction products, and thus are more difficult to filter or remove, for example, from waste or reaction products. SUMMARY

[0008] A method of preparing an organosilicon compound having at least one silicon-bonded methanol group and / or at least one silanol group is provided. The method includes combining a cytochrome P450 variant, an initial organosilicon compound, and a cofactor to prepare a reaction mixture. The cytochrome P450 variant facilitates oxidation of a silicon-bonded hydrocarbon group to a silicon-bonded methanol group or a silanol group in the presence of an oxidizing agent, and the initial organosilicon compound has at least one silicon-bonded hydrocarbon group. The method also includes exposing the reaction mixture to the oxidizing agent to oxidize the silicon-bonded hydrocarbon group of the initial organosilicon compound and convert the silicon-bonded hydrocarbon group to a silicon-bonded methanol group or a silicon-bonded silanol group of the organosilicon compound, thereby preparing the organosilicon compound having at least one silicon-bonded methanol group and / or at least one silanol group.

[0009] A method of preparing a reaction product is also provided. The method includes preparing a reaction mixture; exposing the reaction mixture to an oxidizing agent to oxidize a silicon-bonded hydrocarbon group and convert the silicon-bonded hydrocarbon group to a functional group and result in an organosilicon compound having the functional group; and reacting the functional group of the organosilicon compound with a group that is reactive to the functional group of the organosilicon compound, thereby preparing the reaction product.

[0010] Cytochrome P450 variants are also provided. One of the cytochrome P450 variants comprises or is encoded by the nucleic acid sequence of SEQ ID NO: 1, or a conservatively modified variant thereof. One of the cytochrome P450 variants comprises or is encoded by the nucleic acid sequence of SEQ ID NO: 2, or a conservatively modified variant thereof. Another of the cytochrome P450 variants comprises or is encoded by the nucleic acid sequence of SEQ ID NO: 3, or a conservatively modified variant thereof. Another of the cytochrome P450 variants comprises or is encoded by the nucleic acid sequence of SEQ ID NO: 4, or a conservatively modified variant thereof. Another of the cytochrome P450 variants comprises or is encoded by the nucleic acid sequence of SEQ ID NO: 5, or a conservatively modified variant thereof. Another of the cytochrome P450 variants comprises or is encoded by the nucleic acid sequence of SEQ ID NO: 6, or a conservatively modified variant thereof. Another of the cytochrome P450 variants comprises or is encoded by the nucleic acid sequence of SEQ ID NO: 7, or a conservatively modified variant thereof. Another of the cytochrome P450 variants comprises or is encoded by the nucleic acid sequence of SEQ ID NO: 8, or a conservatively modified variant thereof. Another of the cytochrome P450 variants comprises or is encoded by the nucleic acid sequence of SEQ ID NO: 9, or a conservatively modified variant thereof. Another of the cytochrome P450 variants comprises or is encoded by the nucleic acid sequence of SEQ ID NO: 10, or a conservatively modified variant thereof. DETAILED DESCRIPTION

[0011] A method of preparing an organosilicon compound having at least one silicon-bonded methanol group and / or at least one silanol group is provided. Generally, the method includes exposing a reaction mixture comprising a cytochrome P450 variant and an initial organosilicon compound to an oxidizing agent to prepare the organosilicon compound having at least one silicon-bonded methanol group and / or at least one silanol group. More specifically, the cytochrome P450 variant is capable of facilitating the oxidation and conversion of at least one silicon-bonded hydrocarbon group to at least one silicon-bonded methanol group and / or at least one silanol group, and the initial organosilicon compound comprises at least one silicon-bonded hydrocarbon group that is capable of being oxidized to yield the organosilicon compound having at least one silicon-bonded methanol group and / or at least one silanol group.

[0012] It is noteworthy that, although enzymatic manipulation of silicon-bound functional groups in various organosilicon compounds is known, the present invention is believed, as illustrated by examples and described herein, to represent the first biocatalytic transformation of silicon-bonded hydrocarbon groups (i.e., Si-R, where R is a hydrocarbon group) to silanol groups (i.e., Si-OH) or silicon-bonded methanol groups (i.e., Si-R'-OH, where R' is also a hydrocarbon group). Therefore, it should be understood that certain aspects of the invention related to this method described herein can be practiced individually or in various combinations, i.e., not limited to any particular end use, composition, formulation, etc. Such aspects include novel cytochrome P450 variants, associated materials and compositions, and various methods for preparing them.

[0013] As those skilled in the art will understand, the methods and materials described herein generally relate to biocatalysis (i.e., using biological systems and / or materials to facilitate chemical reactions), and more specifically to protein-based biocatalysts. For clarity, certain terms used herein are set forth and described below.

[0014] The terms “protein,” “peptide,” and “polypeptide” are used interchangeably herein to refer to polymers of amino acid residues (i.e., molecules having two or more amino acids linked together by peptide bonds) or assemblies of multiple polymers of amino acid residues. In some cases, more specific terms may be used, such as those relating to one or more specific oligopeptides (i.e., peptides containing 20 or fewer, optionally 10 or fewer amino acids, such as dipeptides, tripeptides, tetrapeptides, and pentapeptides, etc.), polypeptides (i.e., peptides containing more than 10, optionally more than 20 amino acids), proteins (i.e., organic compounds containing amino acids linked in a linear chain via peptide bonds and folded into a globular shape), enzymes (i.e., functional proteins, optionally containing cofactors, multiple proteins, etc.), etc., which may be modified (e.g., naturally occurring and / or synthesized via glycosylation, acetylation, phosphorylation, etc.), branched, etc. Such terms apply to amino acid polymers in which one or more amino acid residues are artificial chemical mimics of naturally occurring amino acids, as well as to both naturally occurring (i.e., native) amino acid polymers and non-natural (i.e., synthetic, engineered, etc.) amino acid polymers. The identity and order of specific amino acid residues in a protein are usually referred to as the "amino acid sequence".

[0015] The term "amino acid" includes both naturally occurring and non-naturally occurring amino acids as their stereoisomers. In this context, stereoisomers of amino acids generally refer to mirror-image isomers with opposite stereochemistry at the α-carbon atom, such as the L-stereomer (i.e., the levorotatory isomer) and D-stereomer (i.e., the dextrorotatory isomer) of the same α-amino acid. For example, a stereoisomer of a naturally occurring amino acid (which is an L-stereomer) refers to its mirror-image isomer, namely the D-stereomer. As will be understood from some of the examples below, amino acids herein may be referred to by their commonly known three-letter symbols or by the single-letter symbols recommended by the Biochemical Nomenclature Committee of the International Union of Pure and Applied Chemistry and the International Union of Biochemistry (IUPAC-IUB). For example, L-amino acids herein may be represented by their commonly known three-letter symbols (e.g., Arg for L-arginine) or by the capitalized single-letter amino acid symbol (e.g., R for L-arginine). D-amino acids may be represented in this paper by their commonly known three-letter symbols (e.g., D-Arg for D-arginine) or by lowercase single-letter amino acid symbols (e.g., r for D-arginine).

[0016] Naturally occurring amino acids are those encoded by the genetic code, as well as their natural derivatives / modifications (e.g., hydroxyproline, γ-carboxyglutamic acid, O-phosphoserine, etc.). Examples of naturally occurring α-amino acids include, in particular, alanine (Ala; A), cysteine ​​(Cys; C), aspartic acid (Asp; D), glutamic acid (Glu; E), phenylalanine (Phe; F), glycine (Gly; G), histidine (His; H), isoleucine (Ile; I), arginine (Arg; R), lysine (Lys; K), leucine (Leu; L), methionine (Met; M), asparagine (Asn; N), proline (Pro; P), glutamine (Gln; Q), serine (Ser; S), threonine (Thr; T), valine (Val; V), tryptophan (Trp; W), and tyrosine (Tyr; Y), as well as combinations thereof. Similarly, examples of naturally occurring stereoisomers of α-amino acids include D-alanine (D-Ala), D-cysteine ​​(D-Cys), D-aspartic acid (D-Asp), D-glutamic acid (D-Glu), D-phenylalanine (D-Phe), D-histidine (D-His), D-isoleucine (D-Ile), D-arginine (D-Arg), D-lysine (D-Lys), D-leucine (D-Leu), D-methionine (D-Met), D-asparagine (D-Asn), D-proline (D-Pro), D-glutamine (D-Gln), D-serine (D-Ser), D-threonine (D-Thr), D-valine (D-Val), D-tryptophan (D-Trp), and D-tyrosine (D-Tyr). Examples of non-natural (i.e., non-natural) amino acids include various amino acid analogs and simulants, as well as synthetic amino acids with L- or D-configurations (e.g., N-substituted glycine and N-methyl amino acids). Examples of amino acid analogs include non-natural amino acids that have the same basic chemical structure as naturally occurring amino acids (i.e., α-carbons bonded to hydrogen, carboxyl groups, and amino groups) but have modified side chain groups or modified peptide backbones (e.g., homoserine, ortholeucine, methionine sulfoxide, methionine methylsulfonium, etc.). An "amino acid simulant" is a compound that has a structure different from the general chemical structure of an amino acid but functions in a manner similar to that of a naturally occurring amino acid.

[0017] Regarding the amino acid sequence of a protein, those skilled in the art will recognize that individual substitutions, additions, or deletions of a single amino acid or a small percentage of amino acids in the altered, added, and / or deleted sequence can be referred to as “conserved modifications” of the amino acid sequence, wherein the alteration results in the substitution of an amino acid with a chemically similar amino acid, particularly in which the function of the protein remains largely or entirely unchanged. Similarly, a protein having a conserved modified sequence can be referred to as a “conserved modified variant” of a wild-type protein sequence or otherwise unmodified protein sequence. Unless otherwise specified, a particular amino acid sequence should be understood to implicitly encompass a variant of the conserved modification in addition to the explicitly stated sequence.

[0018] As those skilled in the art will understand, chemically similar amino acids are not limited, and the listing of conservative substitutions for functionally similar amino acids is well known in the art. For example, substitutions can be made in which one aliphatic amino acid (e.g., G, A, I, L, V, etc.) is substituted by another aliphatic amino acid, wherein an aliphatic amino acid having a polar, uncharged group (e.g., C, S, T, M, N, Q, etc.) is substituted by another such aliphatic amino acid, wherein a basic amino acid (e.g., K, R, H, etc.) is substituted with a different basic amino acid, etc. In some cases, conservative substitutions include replacing an amino acid having an acidic side chain (e.g., E or D) with an uncharged counterpart (e.g., Q or N, respectively), or vice versa. Each of the following eight groups contains other exemplary amino acids that can be conservatively substituted for each other:

[0019] 1) Alanine (A) and glycine (G);

[0020] 2) Aspartic acid (D) and glutamic acid (E);

[0021] 3) Asparagine (N) and glutamine (Q);

[0022] 4) Arginine (R) and lysine (K);

[0023] 5) Isoleucine (I), leucine (L), methionine (M), and valine (V);

[0024] 6) Phenylalanine (F), tyrosine (Y), and tryptophan (W);

[0025] 7) Serine (S) and threonine (T); and

[0026] 8) Cysteine ​​(C) and methionine (M).

[0027] The terms “oligonucleotide,” “nucleic acid,” and “polynucleotide” are used interchangeably herein to refer to polymers containing nucleotides, i.e., deoxyribonucleic acid (DNA) and / or ribonucleic acid (RNA) in single-stranded, double-stranded, or multi-stranded forms (i.e., single-stranded, double-stranded, and multi-stranded DNA and / or RNA, including genomic DNA, cDNA, and DNA-RNA hybrids), and polymers containing purine, pyrimidine, or other nucleotide bases, which may be naturally occurring or non-naturally occurring bases (e.g., chemically modified, biochemically modified, synthetic, and / or derived nucleotide bases). As those skilled in the art will understand, polynucleotides can be described with respect to the peptides they encode, such that the terms “nucleotide sequence encoding a peptide,” etc., can be used to refer to DNA segments involved in the production of peptide chains. Such segments may include regions before and / or after a given coding region (i.e., leader and / or trailing sequences) involved in the transcription / translation of a gene product or its regulation, as well as intercalation sequences (introns) between individual coding segments (exons). Therefore, the term "nucleic acid" is used interchangeably with gene, cDNA, and mRNA encoded by gene. Unless otherwise specified, the term also covers nucleic acids containing known analogs of natural / reference nucleotides that have similar binding properties to the reference nucleic acid and that can be metabolized in a manner similar to naturally occurring nucleotides.

[0028] The identity and order of specific nucleotide bases in a polynucleotide are generally referred to as a “nucleic acid sequence.” As with the amino acid sequence described above, unless otherwise stated, a specific nucleic acid sequence should be understood to implicitly encompass conserved modified variants of that sequence in addition to explicitly stated nucleic acid sequences. Conserved modified variants of a polynucleotide typically contain degenerate codon substitutions, or complementary or orthologous sequences, compared to a given wild-type or otherwise unmodified nucleic acid sequence. As is known in the art, degenerate codon substitutions can be achieved by generating a sequence in which the third position of a selected codon is substituted with a mixture of bases and / or deoxyinosine residues.

[0029] As used herein, the term "homology" in relation to the original enzyme or gene of a first family or species refers to a different enzyme or gene of a second family or species that has been identified by functional, structural, or genomic analysis as an enzyme or gene of the second family or species corresponding to the original enzyme or gene of the first family or species.

[0030] The terms “homologous” or “homology” are used herein with respect to similar sequences of polynucleotides and / or nucleic acids. For example, a first protein is “homologous” to a second protein if the amino acid sequence encoded by a gene has an amino acid sequence similar to that of a second gene. Alternatively, two proteins are homologous if a first protein has a “similar” amino acid sequence. Thus, the term “homologous protein” is intended to mean that two proteins have similar amino acid sequences. Similarly, the term “functional homolog” refers to each member of a subgroup of homologous sequences or homologous sequences that share a common function (i.e., the primary function for which a protein, gene, sequence, etc., is named and / or utilized). For example, the function of a promoter is to promote the transcription of a gene or nucleotide sequence, and the function of an enzyme is to catalyze a specific chemical reaction or family of chemical reactions. Thus, the term “functionality” encompasses all reaction rates and all enzymatic efficiencies exhibited by a given protein. In a particular embodiment, homology between two proteins indicates their shared ancestor through evolutionary association. It should be understood that homologous sequences most often share functional, structural, or genomic similarity. For example, in some embodiments, homologous sequences share at least 70% sequence identity, such as at least 80%, alternatively at least 90%, alternatively at least 95%, or alternatively at least 99% sequence identity. Techniques are known that allow for the easy cloning of homologous enzymes or genes using genetic probes and PCR. The identity of a cloned sequence as a homolog can be confirmed using functional assays and / or genome mapping of the gene.

[0031] As cited above, this method utilizes a cytochrome P450 variant capable of oxidizing silicon-bonded hydrocarbon groups to silicon-bonded methanol or silanol groups. More specifically, the cytochrome P450 variant facilitates the selective oxidation of at least one silicon-bonded hydrocarbon group (i.e., Si-R, where R is a hydrocarbon group) of the initial organosilicon compound to a silanol group (i.e., Si-OH) or a silicon-bonded methanol group (Si-R'OH, where R' is a hydrocarbon group), as further described in detail below, and is otherwise not particularly limited.

[0032] As will be understood by those skilled in the art, the term "cytochrome P450" as used herein refers to enzymes classified or otherwise characterized as members of the cytochrome P450 enzyme family, which is known to comprise a large superfamily of heme-thiolate proteins that typically have an active site containing a Fe(III)-protoporphyrin IX cofactor (i.e., the heme-iron center) tethered proximal to a highly conserved cysteine ​​thiolate residue. In the resting state, the remaining axial iron coordination sites are occupied by water molecules. However, the heme-iron center is capable of binding molecular oxygen at these axial iron coordination sites, thereby generating native catalytic reactivity.

[0033] Cytochrome P450 enzymes participate in the metabolism of a wide variety of exogenous and endogenous compounds, and typically act as terminal oxidases in multi-component electron transfer chains, such as P450-containing monooxygenase systems. Cytochrome P450 enzymes are known to catalyze numerous carbon-centric oxidative transformations, including carbon oxygenation and hydroxylation, epoxidation, oxidative ring coupling, and desaturation. The general chemical mechanisms that rationalize most of the oxidative activities of native cytochrome P450 enzymes involve perfenyl (FeO) 3+ Intermediates and odd-electrochemistry. Specifically, the heme-iron center activates molecular oxygen in the presence of an electron source (e.g., nicotinamide adenine dinucleotide (NADH) or nicotinamide adenine dinucleotide phosphate (NADPH), such as from adjacent fusion reductase domains, helper cytochrome P450 reductases, etc.) to generate water molecules and an iron(IV)-oxyporphyrin radical cationic intermediate commonly referred to as "P450 compound 1". More specifically, after inducing a first electron transfer (e.g., via substrate binding), molecular oxygen binds to the ferriheme center to generate a dioxy adduct (e.g., Fe-O2). The Fe-O2 adduct is reduced via a second electron transfer to give a peroxy intermediate, which undergoes rapid diprotonation (i.e., double protonation) to release water and yield the iron(IV)-oxygen intermediate (i.e., P450 compound 1). Alternatively, compound 1 of P450 can be formed using a hydrogen peroxide bypass, which bypasses the need for an electron source. The highly reactive iron(IV)oxo-intermediate then reacts with the substrate at the CH or C=C bond (e.g., via extraction of hydrogen atoms or electrons, followed by oxygen rebound, rearrangement, etc.) to influence oxidative transformations (e.g., hydroxylation, epoxidation, etc.).

[0034] As understood in the art, the two genes encoding cytochrome P450 enzymes, as well as the enzymes themselves, can be named using the root symbol “CYP” indicating a superfamily followed by the following, according to common nomenclature conventions: 1) a number indicating the gene family; 2) a capital letter indicating the subfamily; and 3) a number indicating the individual gene. For example, the gene named “CYP102A1” encodes the enzyme CYP102A1 (also known as cytochrome P450 BM3), which is isolated from the soil bacterium *Bacillus megaterium* and promotes NADPH-dependent hydroxylation of long-chain fatty acids at ω-1 to ω-3 positions. Typically, members of the CYP family share at least 40% amino acid identity, while members of the subfamily share at least 55% amino acid identity.

[0035] As described above, this method utilizes a cytochrome P450 variant. The term "variant," as used herein in the context of "protein variant" or "enzyme variant" (e.g., cytochrome P450 variant), describes a protein or enzyme containing at least one amino acid mutation (e.g., substitution) relative to its wild-type form, including chimeric enzymes containing recombinant amino acid sequences or blocks from two, three, or more different proteins. However, it should be understood that certain protein variants do not need to be prepared via targeted mutagenesis, but may instead be native enzymes exhibiting desired activities and / or substrate specificity (i.e., selective silane oxidation) that are not naturally observed by one or more homologous wild-type enzymes. Therefore, it should be understood that the term "cytochrome P450 variant," as used herein, encompasses specific cytochrome P450 variants specified by a given sequence and provided according to some aspects of this disclosure, as well as certain wild-type cytochrome P450 variants suitable for this method, which are further described in detail below. It should also be understood that cytochrome P450 variants may contain or be fragments of cytochrome P450 enzymes that exhibit the activity and / or substrate specificity required for the preparation of organosilicon compounds having at least one silicon-bonded methanol group and / or at least one silanol group.

[0036] The cytochrome P450 variants used in this method are capable of oxidizing the silicon-bonded hydrocarbon groups of the initial organosilicon compound to generate silicon-bonded methanol groups and / or silanol groups in the organosilicon compound, and are otherwise not particularly limited. Therefore, examples of cytochrome P450 variants suitable for this method include those that promote the selective oxidation of the silicon-bonded hydrocarbon groups (i.e., Si-R, where R is a hydrocarbon group) of the initial organosilicon compound to silicon-bonded methanol groups (i.e., Si-R'-OH, where R' is an oxidized hydrocarbon group derived from R) and / or silanol groups (i.e., Si-OH), as further described in detail below.

[0037] Cytochrome P450 variants are typically engineered variants of the P450 BM3 (CYP102A1) protein. For example, in some such embodiments, the cytochrome P450 variant is a mutant of cytochrome P450 BM3 that incorporates structural mutations such as amino acid substitutions, deletions, duplications, and / or insertions. In a particular embodiment, the structural mutation is an amino acid substitution.

[0038] As understood by those skilled in the art, cytochrome P450 BM3 is a self-sufficient 118 kDa monooxygenase possessing an NADPH-dependent reductase domain fused to the C-terminus of a heme domain, containing flavin adenine dinucleotide (FAD) and flavin mononucleotide (FMN). The nucleotide and amino acid sequences of cytochrome P450 BM3 are available from public databases such as GenBank, maintained by the National Center for Biotechnology Information (NCBI) under the International Nucleotide Sequence Database Consortium (INSDC), or the UniProt database, maintained by the UniProt Consortium under accession number P14779.

[0039] In some embodiments, the cytochrome P450 variant comprises a nucleic acid sequence having at least 70% identity with the nucleic acid sequence shown in SEQ ID NO:1, such as having at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95% identity with the nucleic acid sequence shown in SEQ ID NO:1. In a particular embodiment, the cytochrome P450 variant comprises a nucleic acid sequence having greater than 95%, or greater than 96%, or greater than 97%, or greater than 98%, or greater than 99%, or 100% identity with the nucleic acid sequence shown in SEQ ID NO:1. When the cytochrome P450 variant has the nucleic acid sequence shown in SEQ ID NO:1, the nucleic acid sequence of the cytochrome P450 variant relative to cytochrome P450 BM3 contains a V79 mutation, typically a V79A mutation. In these or other embodiments, the cytochrome P450 variant of SEQ IQ NO:1 contains an A83 mutation, typically an A83V mutation, relative to the nucleic acid sequence of cytochrome P450 BM3. In these or other embodiments, the cytochrome P450 variant of SEQ IQ NO:1 contains an F88 mutation relative to the cytochrome P450 BM3 nucleic acid sequence, typically an F88G mutation. In these or other embodiments, the cytochrome P450 variant of SEQ IQ NO:1 contains a P143 mutation relative to the cytochrome P450 BM3 nucleic acid sequence, typically a P143S mutation. In these or other embodiments, the cytochrome P450 variant of SEQ IQ NO:1 contains a T176 mutation relative to the cytochrome P450 BM3 nucleic acid sequence, typically a T176I mutation. In these or other embodiments, the cytochrome P450 variant of SEQ IQ NO:1 contains an A185 mutation relative to the cytochrome P450 BM3 nucleic acid sequence, typically an A185V mutation. In these or other embodiments, the cytochrome P450 variant of SEQ IQ NO:1 contains an S227 mutation relative to the cytochrome P450 BM3 nucleic acid sequence, typically an S227R mutation. In these or other embodiments, the cytochrome P450 variant of SEQ IQ NO:1 contains an H237 mutation relative to the cytochrome P450 BM3 nucleic acid sequence, typically an H237Q mutation. In these or other embodiments, the cytochrome P450 variant of SEQ IQ NO:1 contains an E253 mutation relative to the cytochrome P450 BM3 nucleic acid sequence, typically an E253G mutation. In these or other embodiments, the cytochrome P450 variant of SEQ IQ NO:1 contains an A291 mutation relative to the cytochrome P450 BM3 nucleic acid sequence, typically an A291V mutation.In these or other embodiments, the cytochrome P450 variant of SEQ IQ NO:1 contains an L354 mutation relative to the cytochrome P450 BM3 nucleic acid sequence, typically an L354V mutation. In these or other embodiments, the cytochrome P450 variant of SEQ IQ NO:1 contains an I367 mutation relative to the cytochrome P450 BM3 nucleic acid sequence, typically an I367V mutation. In these or other embodiments, the cytochrome P450 variant of SEQ IQ NO:1 contains an E443 mutation relative to the cytochrome P450 BM3 nucleic acid sequence, typically an E443K mutation. In these or other embodiments, the cytochrome P450 variant of SEQ IQ NO:1 contains an F108 silencing mutation relative to the cytochrome P450 BM3 nucleic acid sequence, typically an F108F silencing mutation. In these or other embodiments, the cytochrome P450 variant of SEQ IQ NO:1 contains an E273 silencing mutation relative to the cytochrome P450 BM3 nucleic acid sequence, typically an E273E silencing mutation. In a specific implementation, the cytochrome P450 variant of SEQ IQNO:1 contains the following nucleic acid sequences relative to cytochrome P450BM3: V79A, A83V, F88G, P143S, T176I, A185V, S227R, H237Q, E253G, A291V, L354V, I367V, E443K mutations, and F108F and E273E silencing mutations.

[0040] In specific embodiments, the cytochrome P450 variant contains a T328 mutation relative to the nucleic acid sequence of SEQ ID NO:1. For example, in some embodiments, the T328 mutation is a T328M mutation. In these or other embodiments, the cytochrome P450 variant contains an A329 mutation relative to the nucleic acid sequence of SEQ ID NO:1. For example, in some such embodiments, the A329 mutation is an A329F mutation. In these or other embodiments, the cytochrome P450 variant contains an I454 silencing mutation relative to the nucleic acid sequence of SEQ ID NO:1. For example, in some such embodiments, the I454 silencing mutation is an I454I silencing mutation. In a particular embodiment, the cytochrome P450 variant contains both T328M and A329F mutations relative to the nucleic acid sequence of SEQ ID NO:1 and an I454 silencing mutation relative to the nucleic acid sequence of SEQ ID NO:1. In some such embodiments, the cytochrome P450 variant comprises a nucleic acid sequence having at least 70% identity with the nucleic acid sequence shown in SEQ ID NO:2, such as having at least 75%, alternatively at least 80%, alternatively at least 85%, alternatively at least 90%, or alternatively at least 95% identity with the nucleic acid sequence shown in SEQ ID NO:2. In certain such embodiments, the cytochrome P450 variant comprises a nucleic acid sequence having greater than 95%, alternatively greater than 96%, alternatively greater than 97%, alternatively greater than 98%, alternatively greater than 99%, or alternatively 100% identity with the nucleic acid sequence shown in SEQ ID NO:2.

[0041] In specific embodiments, the cytochrome P450 variant contains a D35 mutation relative to the nucleic acid sequence of SEQ ID NO:2. For example, in some such embodiments, the D35 mutation is a D35G mutation. In these or other embodiments, the cytochrome P450 variant contains an I123 mutation relative to the nucleic acid sequence of SEQ ID NO:2. For example, in some such embodiments, the I123 mutation is an I123T mutation. In these or other embodiments, the cytochrome P450 variant contains an L250 silencing mutation relative to the nucleic acid sequence of SEQ ID NO:2. For example, in some such embodiments, the L250 silencing mutation is an L250L silencing mutation. In these or other embodiments, the cytochrome P450 variant contains an E338 silencing mutation relative to the nucleic acid sequence of SEQ ID NO:2. For example, in some such embodiments, the E338 silencing mutation is an E338E silencing mutation. In these or other embodiments, the cytochrome P450 variant contains an L342 silencing mutation relative to the nucleic acid sequence of SEQ ID NO:2. For example, in some such embodiments, the L342 silencing mutation is an L342L silencing mutation. In these or other embodiments, the cytochrome P450 variant contains an E381 silencing mutation relative to the nucleic acid sequence of SEQ ID NO:2. For example, in some such embodiments, the E381 silencing mutation is the E381E silencing mutation. In these or other embodiments, the cytochrome P450 variant contains a P387 silencing mutation relative to the nucleic acid sequence of SEQ ID NO:2. For example, in some such embodiments, the P387 silencing mutation is the P387P silencing mutation. In a particular embodiment, the cytochrome P450 variant contains D35G and I123T mutations, as well as L250L, E388E, L342L, E381E, and P387P silencing mutations relative to the nucleic acid sequence of SEQ ID NO:2. In some such embodiments, the cytochrome P450 variant comprises a nucleic acid sequence having at least 70% identity with the nucleic acid sequence shown in SEQ ID NO:3, such as having at least 75%, alternatively at least 80%, alternatively at least 85%, alternatively at least 90%, or alternatively at least 95% identity with the nucleic acid sequence shown in SEQ ID NO:3. In certain such embodiments, the cytochrome P450 variant comprises a nucleic acid sequence having greater than 95%, alternatively greater than 96%, alternatively greater than 97%, alternatively greater than 98%, alternatively greater than 99%, or alternatively 100% identity with the nucleic acid sequence shown in SEQ ID NO:3.

[0042] In specific embodiments, the cytochrome P450 variant contains a G353 mutation relative to the nucleic acid sequence of SEQ ID NO:3. For example, in some such embodiments, the D35 mutation is a D353E mutation. In these or other embodiments, the cytochrome P450 variant contains an L250 silencing mutation relative to the nucleic acid sequence of SEQ ID NO:3. For example, in some such embodiments, the L250 silencing mutation is an L250L silencing mutation. In these or other embodiments, the cytochrome P450 variant contains an E338 silencing mutation relative to the nucleic acid sequence of SEQ ID NO:3. For example, in some such embodiments, the E338 silencing mutation is an E338E silencing mutation. In these or other embodiments, the cytochrome P450 variant contains an L342 silencing mutation relative to the nucleic acid sequence of SEQ ID NO:3. For example, in some such embodiments, the L342 silencing mutation is an L342L silencing mutation. In these or other embodiments, the cytochrome P450 variant contains an E381 silencing mutation relative to the nucleic acid sequence of SEQ ID NO:3. For example, in some such embodiments, the E381 silencing mutation is an E381E silencing mutation. In these or other embodiments, the cytochrome P450 variant contains a P387 silencing mutation relative to the nucleic acid sequence of SEQ ID NO:3. For example, in some such embodiments, the P387 silencing mutation is the P387P silencing mutation. In a particular embodiment, the cytochrome P450 variant contains a D353E mutation relative to the nucleic acid sequence of SEQ ID NO:3, as well as L250L, E388E, L342L, E381E, and P387P silencing mutations. In some such embodiments, the cytochrome P450 variant contains a nucleic acid sequence having at least 70% identity with the nucleic acid sequence shown in SEQ ID NO:4, such as having at least 75%, alternatively at least 80%, alternatively at least 85%, alternatively at least 90%, or alternatively at least 95% identity with the nucleic acid sequence shown in SEQ ID NO:4. In certain implementations of this type, the cytochrome P450 variant comprises a nucleic acid sequence having greater than 95%, alternatively greater than 96%, alternatively greater than 97%, alternatively greater than 98%, alternatively greater than 99%, and alternatively 100% identity with the nucleic acid sequence shown in SEQ ID NO:4.

[0043] In specific embodiments, the cytochrome P450 variant contains the F329 mutation relative to the nucleic acid sequence of SEQ ID NO:4. For example, in some such embodiments, the F329 mutation is the F329S mutation. In these or other embodiments, the cytochrome P450 variant contains the D423 silencing mutation relative to the nucleic acid sequence of SEQ ID NO:4. For example, in some such embodiments, the D423 silencing mutation is the D423D silencing mutation. In a particular embodiment, the cytochrome P450 variant contains both the F329 mutation and the D432D silencing mutation relative to the nucleic acid sequence of SEQ ID NO:4. In some such embodiments, the cytochrome P450 variant contains a nucleic acid sequence having at least 70% identity with the nucleic acid sequence shown in SEQ ID NO:5, such as having at least 75%, alternatively at least 80%, alternatively at least 85%, alternatively at least 90%, or alternatively at least 95% identity with the nucleic acid sequence shown in SEQ ID NO:5. In certain implementations of this type, the cytochrome P450 variant comprises a nucleic acid sequence having greater than 95%, alternatively greater than 96%, alternatively greater than 97%, alternatively greater than 98%, alternatively greater than 99%, and alternatively 100% identity with the nucleic acid sequence shown in SEQ ID NO:5.

[0044] In specific embodiments, the cytochrome P450 variant contains the F166 mutation relative to the nucleic acid sequence of SEQ ID NO:5. For example, in some such embodiments, the F166 mutation is the F166L mutation. In some such embodiments, the cytochrome P450 variant contains a nucleic acid sequence having at least 70% identity with the nucleic acid sequence shown in SEQ ID NO:6, such as having at least 75%, alternatively at least 80%, alternatively at least 85%, alternatively at least 90%, or alternatively at least 95% identity with the nucleic acid sequence shown in SEQ ID NO:6. In certain such embodiments, the cytochrome P450 variant contains a nucleic acid sequence having greater than 95%, alternatively greater than 96%, alternatively greater than 97%, alternatively greater than 98%, alternatively greater than 99%, or alternatively 100% identity with the nucleic acid sequence shown in SEQ ID NO:6.

[0045] In specific embodiments, the cytochrome P450 variant contains a Y52 mutation relative to the nucleic acid sequence of SEQ ID NO:6. For example, in some such embodiments, the Y52 mutation is the Y52V mutation. In these or other embodiments, the cytochrome P450 variant contains a V185 mutation relative to the nucleic acid sequence of SEQ ID NO:6. For example, in some such embodiments, the V185 mutation is the V185M mutation. In a particular embodiment, the cytochrome P450 variant contains both the Y52V and V185M mutations relative to the nucleic acid sequence of SEQ ID NO:6. In some such embodiments, the cytochrome P450 variant contains a nucleic acid sequence having at least 70% identity with the nucleic acid sequence shown in SEQ ID NO:7, such as having at least 75%, alternatively at least 80%, alternatively at least 85%, alternatively at least 90%, or alternatively at least 95% identity with the nucleic acid sequence shown in SEQ ID NO:7. In certain implementations of this type, the cytochrome P450 variant comprises a nucleic acid sequence having greater than 95%, alternatively greater than 96%, alternatively greater than 97%, alternatively greater than 98%, alternatively greater than 99%, and alternatively 100% identity with the nucleic acid sequence shown in SEQ ID NO:7.

[0046] In specific embodiments, the cytochrome P450 variant contains an N96 mutation relative to the nucleic acid sequence of SEQ ID NO:7. For example, in some such embodiments, the N96 mutation is an N95S mutation. In these or other embodiments, the cytochrome P450 variant contains a D215 mutation relative to the nucleic acid sequence of SEQ ID NO:7. For example, in some such embodiments, the D215 mutation is a D215G mutation. In these or other embodiments, the cytochrome P450 variant contains a T439 mutation relative to the nucleic acid sequence of SEQ ID NO:7. For example, in some such embodiments, the T439 mutation is a T439S mutation. In these or other embodiments, the cytochrome P450 variant contains an H286 silent mutation relative to the nucleic acid sequence of SEQ ID NO:7. In a particular embodiment, the cytochrome P450 variant contains N96S, D215G, and T439S mutations and an H286H silent mutation relative to the nucleic acid sequence of SEQ ID NO:7. In some such embodiments, the cytochrome P450 variant comprises a nucleic acid sequence having at least 70% identity with the nucleic acid sequence shown in SEQ ID NO:8, such as at least 75%, alternatively at least 80%, alternatively at least 85%, alternatively at least 90%, or alternatively at least 95% identity with the nucleic acid sequence shown in SEQ ID NO:8. In certain such embodiments, the cytochrome P450 variant comprises a nucleic acid sequence having greater than 95%, alternatively greater than 96%, alternatively greater than 97%, alternatively greater than 98%, alternatively greater than 99%, or alternatively 100% identity with the nucleic acid sequence shown in SEQ ID NO:8.

[0047] In specific embodiments, the cytochrome P450 variant contains an S73 mutation relative to the nucleic acid sequence of SEQ ID NO:8. For example, in some such embodiments, the S73 mutation is the S73G mutation. In these or other embodiments, the cytochrome P450 variant contains a G86 mutation relative to the nucleic acid sequence of SEQ ID NO:8. For example, in some such embodiments, the G86 mutation is the V1G86A mutation. In a particular embodiment, the cytochrome P450 variant contains both the S73G and G86A mutations relative to the nucleic acid sequence of SEQ ID NO:8. In some such embodiments, the cytochrome P450 variant contains a nucleic acid sequence having at least 70% identity with the nucleic acid sequence shown in SEQ ID NO:9, such as having at least 75%, alternatively at least 80%, alternatively at least 85%, alternatively at least 90%, or alternatively at least 95% identity with the nucleic acid sequence shown in SEQ ID NO:9. In certain implementations of this type, the cytochrome P450 variant comprises a nucleic acid sequence having greater than 95%, alternatively greater than 96%, alternatively greater than 97%, alternatively greater than 98%, alternatively greater than 99%, and alternatively 100% identity with the nucleic acid sequence shown in SEQ ID NO:9.

[0048] In specific embodiments, the cytochrome P450 variant contains an R48 mutation relative to the nucleic acid sequence of SEQ ID NO:9. For example, in some such embodiments, the R48 mutation is an R48G mutation. In some such embodiments, the cytochrome P450 variant contains a nucleic acid sequence having at least 70% identity with the nucleic acid sequence shown in SEQ ID NO:10, such as having at least 75%, alternatively at least 80%, alternatively at least 85%, alternatively at least 90%, or alternatively at least 95% identity with the nucleic acid sequence shown in SEQ ID NO:10. In certain such embodiments, the cytochrome P450 variant contains a nucleic acid sequence having greater than 95%, alternatively greater than 96%, alternatively greater than 97%, alternatively greater than 98%, alternatively greater than 99%, or alternatively 100% identity with the nucleic acid sequence shown in SEQ ID NO:10.

[0049] Those skilled in the art will understand that, for a specific nucleic acid sequence of cytochrome P450, the conventional numbering used to identify / represent a specific amino acid residue ignores the initial methionine residue (e.g., encoded by the start codon), such that the first residue after the initial methionine is the first numbered residue in the sequence. Therefore, regarding the aforementioned mutations, it should also be understood that such residues can be assigned or otherwise designated based on the conventional numbering of cytochrome P450 variants rather than sequential numbering, such that, for example, mutations V79, A83, F88, P143, and T176 can be alternatively referred to as mutations V78, A82, F87, P142, and T175, respectively. Furthermore, those skilled in the art will readily understand that SEQ ID NO:1 to SEQ ID NO:10 are nucleic acid sequences encoding amino acid sequences, and that the nucleic acid sequences of SEQ ID NO:1 to SEQ ID NO:10 can be translated into unique amino acid sequences.

[0050] It should also be understood that cytochrome P450 variants may contain mutations (e.g., substitutions, etc.) at one or more residues in addition to those described above as alternative or additional mutations. Typically, the residues suitable for mutation to prepare cytochrome P450 variants suitable for this method will be determined by those skilled in the art (e.g., based on the specific wild-type enzyme to be modified, the potential initial organosilicon compound to be oxidized, the conditions to be utilized, etc.) and generally include conserved residues capable of affecting the enzyme's reactive properties (e.g., the reactivity, selectivity, solvent tolerance, and / or cofactor dependence of the enzyme, etc.). For example, in some embodiments, the cytochrome P450 variant contains mutations that allow the incorporation of non-natural cofactors, such as alternative heme cofactors (e.g., protoporphyrin IX or other porphyrin molecules containing metals other than iron (e.g., cobalt, rhodium, copper, ruthenium, iridium, and manganese, etc.)) and / or alternative reducing cofactors (e.g., NADH versus NADPH, etc.). Such residues can be identified using any technique known in the art, including crystallographic studies, phylogenetic studies, mutagenesis studies, etc., procedures of which are well known.

[0051] Mutations can be introduced into the sequence of cytochrome P450 variants using standard gene synthesis and / or cloning techniques (such as directed mutagenesis, random mutagenesis, etc.) and various combinations thereof. Examples of such techniques include error-prone polymerase chain reaction (PCR), cassette mutagenesis, oligonucleotide directed mutagenesis, parallel PCR, random mutagenesis with random fragmentation and reassembly via mutual initiation, chemical mutagenesis, irradiation, DNA shuffling, etc., and their modifications and / or combinations. In some embodiments, cytochrome P450 variants are prepared using site-directed mutagenesis (i.e., introducing specific nucleotide changes at predetermined locations), such as via PCR site-directed mutagenesis, cassette mutagenesis, whole plasmid mutagenesis, the Kunkel method, etc., or combinations thereof. Certain techniques will be selected based on the specific cytochrome P450 variant prepared. For example, in some embodiments, directed mutagenesis can be used to selectively replace one or more conserved residues among the conserved residues described above. In these or other embodiments, one or more of the above-described mutagenesis techniques can also be used under low-fidelity polymerization conditions to introduce random point mutations into long sequences, to mutagenesis of mixtures of fragments of unknown sequences, etc. Therefore, it will be understood that the above-mentioned techniques are not limiting and that other techniques may also be used.

[0052] In some implementations, cytochrome P450 variants are engineered using directed evolution. In such implementations, directed evolution is used to optimize cytochrome P450 variants by generating saturation mutagenesis libraries (e.g., via single-site saturation mutagenesis, two-site saturation mutagenesis, etc.) and selecting cytochrome P450 variants that exhibit improved activity at screening, as described in further detail below.

[0053] As those skilled in the art will understand, saturation mutagenesis is a technique used to introduce random mutations at predetermined locations in encoded proteins. More specifically, saturation mutagenesis typically utilizes artificial gene sequences synthesized using primers containing one or more degenerate codons to introduce variability into optimized locations. Each of the three positions within a degenerate codon encodes a base such as adenine (A), cytosine (C), thymine (T), or guanine (G), or degenerate positions such as K (representing G and T), M (representing A and C), R (representing A and G), S (representing C and G), W (representing A and T), Y (representing C and T), B (representing C, G, and T), D (representing A, G, and T), H (representing A, C, and T), V (representing A, C, G), or N (representing A, C, G, and T). For example, the degenerate codon “NDT” comprises 12 codons (i.e., N = [A, C, G, T]; D = [A, G, T]; T = [T]), which collectively encode 12 amino acids (Phe, Leu, Ile, Val, Tyr, His, Asn, Asp, Cys, Arg, Ser, and Gly). Similarly, the degenerate codon NNN is considered “completely randomized” because it comprises all 64 codons and encodes all 20 naturally occurring amino acids. It should be understood that some amino acids are encoded by more codons than others, such that the exact ratio of amino acids encoded in a given degenerate codon will not be equal. Furthermore, degenerate codons are generally chosen to minimize the presence of stop codons. For example, the restrictive degenerate codons “NNK” and “NNS” can be used to encode the same number of amino acids as “NNN” (i.e., all 20 naturally occurring amino acids), but with a significantly reduced number of stop codons. Therefore, in some embodiments, a mixture of degenerate primers can be used to achieve the desired parameters, including the content of redundancy and stop codons, and the representation of selective chemical and / or physical properties of the encoded amino acid, such as charge, size, electronics, polarity, hydrophilicity, and hydrophobicity. Such mixtures can contain any number of different degenerate primers in any ratio. Considerations and methods for selecting the optimal combination of degenerate primers will be known to those skilled in the art. For example, computational tools for selecting specific degenerate codons are known and can be used to control the corresponding encoded amino acid. Specific primers suitable for introducing the specific mutations described above are provided in the following examples.

[0054] It should be understood that the parental protein / enzyme to be evolved can be a wild-type protein or enzyme, or a variant, mutant, etc. Typically, the parental protein is selected from cytochrome P450 proteins, such as cytochrome P450 BM3. Therefore, the parental polynucleotides used to create the mutagenic library, as well as the entire vector containing the nucleic acid encoding the parental protein of interest, can be commercially available and thus can be prepared, purchased, or otherwise obtained from any suitable commercial or non-commercial source.

[0055] Once prepared (e.g., by introducing one or more mutations into a target gene encoding parental cytochrome P450, such as using one or more of the techniques described above), the evolved polynucleotide is cloned into a suitable vector and introduced into a suitable host cell (e.g., via transformation, transfection, infection, etc.) for expression, according to methods well known in the art. Those skilled in the art will readily select appropriate vectors, host cells, and techniques. Examples of suitable vectors typically include various plasmids and viruses known to be compatible with host cells expressing oxidases or oxygenases. Examples of suitable host cells typically include bacterial cells (e.g., from *E. coli*, *Bacillus*, *Pseudomonas*, etc.), yeast cells (e.g., from *Saccharomyces cerevisiae*, etc.), fungal cells (e.g., from *Aspergillus*), insect cells, etc. In some embodiments, plant and / or other animal cells (e.g., mammals, humans, etc.) may also be used. Such host cells can be appropriately transformed, transfected, or infected by any suitable method, including electroporation, chemically mediated DNA uptake, fungal infection, viral infection, microinjection, microparticle transformation, or other techniques known in the art.

[0056] Once expressed, evolved cytochrome P450 variants are tested / screened (e.g., via silane oxidation / silanol formation monitored via chromatographic and / or spectroscopic methods, in vivo or in vitro, in combination with organosilicon compounds, as described below) to identify specific variants exhibiting the desired activity or properties, and preferably, activities greater than (i.e., more beneficial) than the parental cytochrome P450 protein. Any such identified variants can then be isolated, purified, and / or characterized as needed, and optionally subjected to assays designed to further test functional activity, etc. It should be understood that identified variants can also be used for further rounds of directed evolution, i.e., as a parental protein from which subsequent generations of cytochrome P450 variants are prepared (e.g., via the procedures described above). The various aspects of directed evolution techniques suitable for engineering and / or optimizing cytochrome P450 variants will be better understood given the form of certain sets of procedures in the following examples.

[0057] As should be understood from the description of the directed evolution process above and the following additional description, this document also provides nucleic acids (i.e., nucleic acid molecules) encoding cytochrome P450 variants. Nucleic acid molecules can be DNA or RNA molecules and can be any form suitable for preparing cytochrome P450 variants (e.g., any of the forms described above). Thus, nucleotides can encode cytochrome P450 variants or their precursors, such as the proto or preproto-proto-form of a cytochrome P450 variant, optionally containing a signal sequence or other heterologous amino acid motif (e.g., a tag) for secretion and / or purification. For example, affinity tags (e.g., His6 tag (SEQ ID NO:17), glutathione S-transferase (GST), etc.) can be added to the N-terminus and / or C-terminus of a cytochrome P450 variant protein expressed from an expression vector utilizing nucleic acids to facilitate protein purification.

[0058] In some embodiments, nucleic acid molecules are generated via gene synthesis (i.e., synthetic nucleic acids). In some such embodiments, the synthetic nucleic acid is codon-optimized for expression. For example, in some embodiments, the synthetic nucleic acid may be engineered to lack certain internal restriction endonuclease sites. Similarly, in some embodiments, the nucleic acid molecule may contain or otherwise operably link to an expression control sequence, i.e., a sequence that allows the nucleic acid molecule to be expressed in a desired host cell. Examples of suitable expression control sequences and vectors are known in the art.

[0059] Therefore, non-human objects (i.e., transgenic organisms) transformed or transfected with nucleic acid molecules are also provided, and these non-human objects can be prepared by known homologous recombination methods or other techniques for genetic transfer (such as any of those techniques described herein).

[0060] For example, nucleic acid molecules can be located on a vector. Therefore, expression vectors containing nucleic acid sequences encoding cytochrome P450 variants are also provided. Generally, the expression vector is not limited and can be a viral vector, plasmid, bacteriophage, phage particle, sclerosing particle, Fors plasmid, bacterial phage (e.g., bacterial phage P1-derived vector (PAC)), baculovirus vector, yeast plasmid, artificial chromosome (e.g., bacterial artificial chromosome (BAC), yeast artificial chromosome (YAC), mammalian artificial chromosome (MAC), human artificial chromosome (HAC), etc.) or other such vectors capable of promoting the expression of cytochrome P450 variants, as will be apparent to those skilled in the art.

[0061] Expression vectors may include chromosomal, non-chromosomal, and / or synthetic DNA sequences. In some embodiments, the expression vector comprises a promoter operatively linked to a nucleic acid sequence encoding a cytochrome P450 variant. In such embodiments, the promoter is not particularly limited and may be selected from viral, bacterial, archaea, fungal, insect, plant, and / or mammalian promoters. In some embodiments, the promoter is a constitutive promoter. In some embodiments, the promoter is an inducible promoter. In other embodiments, the promoter is tissue-specific, environmentally regulated, and / or developmentally regulated.

[0062] Examples of expression vectors include pCWori vectors, pET vectors (e.g., pET22), pQE vectors, pBluescript vectors, pNH vectors, λ-ZAP vectors, pKLAC1 vectors, pKLAC2 vectors, pMT vectors, BacPak baculovirus vectors, pSyn_1 vectors, pCR-TOPO vectors, pChlamy_1 vectors, PGano-X adenovirus vectors, and pBABE retroviral vectors, which are available from various commercial vendors. Additional examples of expression vectors include ptrc99a, pKK223-3, pDR540, pRIT2T, pRSET, pGEM1, pMAL, pBR322 (i.e., ATCC37017), pXT1, pSG5, pSVK3, pBPV, pMSG, pSVLSV40, pcDNA3.3, pcDNA4 / TO, pcDNA6 / TR, pLenti6 / TR, and their derivatives and modifications. It should be understood that any other vector that can replicate and survive in the host cell may also be used.

[0063] Cytochrome P450 variants can be expressed in whole cells, such as bacterial cells, archaea cells, yeast cells, fungal cells, insect cells, plant cells, and mammalian cells. Examples of bacterial host cells include BL21 *Escherichia coli*, DE3 strain *Escherichia coli*, *Escherichia coli* M15, DH5α, DH10β, HB101, T7 competent *Escherichia coli* (NEB), *Bacillus subtilis* cells, *Pseudomonas fluorescens* cells, and cyanobacterial cells, such as *Chlamydomonas reinhardtii* cells and *Synechococcuselongates* cells. Examples of archaea host cells include *Pyrococcus furiosus*, *Metallosphera sedula*, *Thermococcus litoralis*, *Methanobacterium thermoautotrophicum*, *Methanococcus jannaschii*, *Pyrococcus abyssi*, *Sulfolobus solfataricus*, *Pyrococcus woesei*, and *Sulfolobus shibatae*. Examples of fungal host cells include yeast cells from the genera *Saccharomyces* (e.g., *Saccharomyces cerevisiae*), *Pichia* (e.g., *Pichia pastoris*), *Kluyveromyces* (e.g., *Kluyveromyces lactis*), *Hansenula*, and *Yarrowia*, as well as filamentous fungal cells from the genera *Aspergillus*, *Trichoderma*, and *Myceliophthora*. Examples of insect host cells include Sf9 cells from the fall armyworm (Spodoptera frugiperda), Sf21 cells from the fall armyworm, Hi-Five cells, BTI-TN-5B1-4 cells from the silver-striped armyworm (Trichophusia ni), and Schneider 2 (S2) and Schneider 3 (S3) cells from the Drosophila melanogaster.Examples of mammalian host cells include HEK293 cells, HeLa cells, CHO cells, COS cells, Jurkat cells, NSO hybridoma cells, young hamster kidney (BHK) cells, MDCK cells, and NIH-3T3 fibroblasts. Examples of plant host cells include those from tobacco, tomato, potato, corn, rice, lettuce, and spinach plants, as well as other plant cells with short generation times and / or that produce viable biomass using standard culture techniques. It should be understood that these host cells also exemplify non-human objects containing nucleic acid molecules according to certain embodiments, as described above.

[0064] In some embodiments, with respect to the silicon oxidation of the method, the cytochrome P450 variant exhibits enhanced activity compared to the corresponding wild-type cytochrome P450 protein. For example, in some embodiments, the cytochrome P450 variant exhibits at least 1.5 times higher activity than the corresponding wild-type protein, such as at least 2 times, or at least 5 times, or at least 10 times, or at least 20 times, or at least 25 times, or at least 50 times, or at least 100 times, or at least 250 times, or at least 500 times, or at least 1000 times, or at least 2000 times higher activity than the corresponding wild-type protein (i.e., when evaluated under the same conditions according to the method).

[0065] Cytochrome P450 variants can be used in this method in any form. For example, in some embodiments, cytochrome P450 variants are used as whole-cell catalysts, i.e., compositions comprising host cells expressing cytochrome P450 variants. Examples of such host cells and various techniques for preparing whole-cell catalysts comprising cytochrome P450 variants are described above. Thus, in some embodiments, the method includes preparing a whole-cell catalyst comprising (e.g., expressing) a cytochrome P450 variant, and subsequently combining the whole-cell catalyst with an organosilicon compound to prepare an organosilicon compound having at least one silicon-bonded methanol group and / or at least one silanol group. In a particular embodiment, cytochrome P450 variants are used as cell lysates, i.e., compositions comprising lysates of the whole-cell catalyst containing the aforementioned cytochrome P450 variants. In still other embodiments, cytochrome P450 variants are used as isolated enzymes. For example, in such embodiments, the method includes isolating and / or purifying the cytochrome P450 variant from host cells expressing the cytochrome P450 variant and / or the aforementioned cell lysates to obtain the isolated cytochrome P450 variant, and then combining it with an organosilicon compound to prepare an organosilicon compound having at least one silicon-bonded methanol group and / or at least one silanol group.

[0066] As described above, the method for preparing an organosilicon compound having at least one silicon-bonded methanol group and / or at least one silanol group comprises preparing a reaction mixture by combining a cytochrome P450 variant, an initial organosilicon compound, and a cofactor. More specifically, the initial organosilicon compound contains at least one silicon-bonded hydrocarbon group, which can be oxidized to a silicon-bonded methanol group or a silanol group (i.e., a silicon-bonded hydroxyl group) when the reaction mixture is exposed to an oxidizing agent. The silicon-bonded hydrocarbon group is unsubstituted and does not contain heteroatoms.

[0067] The initial organosilicon compound can vary widely relative to other substituents bonded to silicon. Each silicon-bonded hydrocarbon group present in the initial organosilicon compound is chosen independently. For clarity and consistency, the following references to "silicon-bonded hydrocarbon group" or "hydrocarbon group" refer to at least one hydrocarbon group in the initial organosilicon compound, but may also apply to other silicon-bonded hydrocarbon groups present in the initial organosilicon compound, whether or not oxidized by this method, and this should not be construed as implying that each hydrocarbon group is the same.

[0068] Hydrocarbon groups suitable for inclusion in the initial organosilicon compound and suitable for oxidation via this method include monovalent hydrocarbon moieties, as well as their derivatives and modifications, which may independently be straight-chain, branched, cyclic, or combinations thereof, and may be saturated or unsaturated. However, the hydrocarbon groups of the initial organosilicon compound oxidized via this method are unsubstituted. With respect to such hydrocarbon groups, the term "unsubstituted" describes a hydrocarbon moieties consisting of carbon and hydrogen atoms, i.e., free of heteroatom substituents. The term "substituted" describes hydrocarbon moieties in which at least one hydrogen atom is replaced by an atom or group other than hydrogen (e.g., a halogen atom, an alkoxy group, an amine group, etc.) (i.e., as a side-substituent or a terminal substituent), carbon atoms within the chain / main chain of the hydrocarbon are replaced by atoms other than carbon (e.g., heteroatoms, such as oxygen, sulfur, nitrogen, etc.) (i.e., as part of the chain / main chain), or both conditions are met simultaneously.

[0069] Straight-chain and branched hydrocarbon groups can be independently saturated or unsaturated, and when unsaturated, they can be conjugated or non-conjugated. Cyclic hydrocarbon groups can be independently monocyclic or polycyclic, and encompass cycloalkyl groups, aryl groups, and heterocycles, which can be aromatic, saturated, and non-aromatic and / or non-conjugated, etc. Examples of combinations of straight-chain and cyclic hydrocarbon groups include alkylaryl groups, aralkyl groups, etc. General examples suitable for use in or as the hydrocarbon moiety of hydrocarbon groups include alkyl groups, aryl groups, alkenyl groups, alkynyl groups, etc., and their derivatives, modifications, and combinations thereof. Examples of alkyl groups include methyl, ethyl, propyl (e.g., isopropyl and / or n-propyl), butyl (e.g., isobutyl, n-butyl, tert-butyl and / or sec-butyl), pentyl (e.g., isopentyl, neopentyl and / or tert-pentyl), hexyl, etc. (i.e., other straight-chain or branched saturated hydrocarbon groups, for example, having more than 6 carbon atoms). Examples of aryl groups include phenyl, tolyl, xylyl, naphthyl, benzyl, dimethylphenyl, etc., and their derivatives and modifications, which may overlap with alkylaryl groups (e.g., benzyl) and aralkyl groups (e.g., tolyl, dimethylphenyl, etc.). Examples of alkenyl groups include vinyl, allyl, propenyl, isopropenyl, butenyl, isobutenyl, pentenyl, heptenyl, hexenyl, cyclohexenyl groups, etc., and their derivatives and modifications.

[0070] In some embodiments, the silicon-bonded hydrocarbon group of the initial organosilicon compound is an unsubstituted hydrocarbon group having 1 to 12 carbon atoms. For example, in some such embodiments, the hydrocarbon group is an alkyl group, such as an alkyl group having 1 to 6, alternatively 1 to 5, or alternatively 1 to 4 carbon atoms. Specific examples of alkyl groups include methyl groups, ethyl groups, propyl groups (e.g., n-propyl and isopropyl groups), butyl groups (e.g., n-butyl, sec-butyl, isobutyl, and tert-butyl groups), pentyl groups, hexyl groups, heptyl groups, etc., and their derivatives and / or modifications. In other embodiments, the hydrocarbon group is an unsubstituted alkenyl group having 2 to 6 carbon atoms, such as 2 to 5, alternatively 2 to 4, or alternatively 2 to 3 carbon atoms.

[0071] In a particular embodiment, the hydrocarbon group is selected from substituted and unsubstituted aryl, alkylaryl, and aralkyl groups having 1 to 12 carbon atoms, such as 2 to 12, alternatively 2 to 10, alternatively 3 to 10, alternatively 3 to 8, or alternatively 4 to 8 carbon atoms. In a particular embodiment, at least one R is independently selected from unsubstituted aryl, alkylaryl, and aralkyl groups.

[0072] In some embodiments, the initial organosilicon compound may also contain substituted hydrocarbon groups that have not been oxidized by the method of the present invention. For example, the initial organosilicon compound may contain one or more halohydrocarbon groups.

[0073] General examples of haloalkyl groups include haloderivatized derivatives of the hydrocarbon moiety described above, such as haloalkyl groups (e.g., any of the alkyl groups described above, wherein one or more hydrogen atoms are replaced by halogen atoms (such as F or Cl), aryl groups (e.g., any of the aryl groups described above, wherein one or more hydrogen atoms are replaced by halogen atoms (such as F or Cl), and combinations thereof. Examples of halogenated alkyl groups include fluoromethyl, 2-fluoropropyl, 3,3,3-trifluoropropyl, 4,4,4-trifluorobutyl, 4,4,4,3,3-pentafluorobutyl, 5,5,5,4,4,3,3-heptafluoropentyl, 6,6,6,5,5,4,4,3,3-nonafluorohexyl, and 8,8,8,7,7-pentafluorooctyl, 2,2-difluorocyclopropyl, 2,3-difluorocyclobutyl, 3,4-difluorocyclohexyl, 3,4-difluoro-5-methylcycloheptyl, chloromethyl, chloropropyl, 2-dichlorocyclopropyl, 2,3-dichlorocyclopentyl, etc., as well as their derivatives and modifications. Examples of halogenated aryl groups include chlorobenzyl, pentafluorophenyl, fluorobenzyl groups, etc., as well as their derivatives and modifications.

[0074] In a specific embodiment, the initial organosilicon compound contains only unsubstituted hydrocarbon groups selected from those mentioned above and contains no substituted hydrocarbon groups with silicon bonds.

[0075] The initial organosilicon compound is unrestricted and may contain any combination of silanoxy groups. Furthermore, the initial organosilicon compound may be free of silanoxy groups, which are typically present only in organosilicon compounds containing one or more siloxane bonds, and may alternatively be referred to as organosiloxanes or polyorganosiloxanes.

[0076] Examples of suitable siloxy groups include [M], [D], [T], and [Q] units / siloxy groups, as understood in the art, each representing a structural unit of a functional group present in siloxanes (such as organosiloxanes and organopolysiloxanes). More specifically, [M] represents the general formula R”3SiO 1 / 2 The single functional unit; [D] represents the general formula R”2SiO 2 / 2 The bifunctional unit; [T] represents the general formula R”SiO 3 / 2 The three functional units; and [Q] represents the general formula SiO 4 / 2 The four functional units are shown in the following general structural part:

[0077]

[0078] In these general structural parts, each R" is independently a monovalent substituent, such as a silicon-bonded hydrocarbon group in the initial silicon compound described above.

[0079] In some embodiments, the initial organosilicon compound does not contain T and / or Q silanoxy units. In these or other embodiments, the initial organosilicon compound consists only of M and / or D silanoxy units. Alternatively, the initial organosilicon compound may be an organosilane or an organosiloxane. The organosilane may be silane, silane, propane, or polysilane. Similarly, the organosiloxane may be disiloxane, trisiloxane, or polysiloxane.

[0080] In various embodiments, the initial organosilicon compound has general formula (I) or (II):

[0081] (R 1 2SiO 2 / 2 ) n (I)

[0082] R 1 3Si(O-SiR 1 2) m R 1 (II)

[0083] R 1 3Si-(D-SiR 1 2) m R 1 (III)

[0084] Each R 1 It is an independently chosen unsubstituted hydrocarbon group or H, provided that there is at least one R. 1 It is a hydrocarbon group, with subscript n ranging from 3 to 8 and subscript m ranging from 0 to 15, and each D is an independently chosen divalent linker.

[0085] In a specific embodiment, the initial organosilicon compound has the above-described general formula (I). As understood in the art, when the initial organosilicon compound has general formula (I), the initial organosilicon compound is a cyclic siloxane. Because the subscript n is 3 to 8, the cyclic siloxane has 3 to 8 D-methoxy units.

[0086] Examples of cyclic siloxanes include hexamethylcyclotrisiloxane (D3), octamethylcyclotetrasiloxane (D4), decamethylcyclopentasiloxane (D5), dodecylcyclohexasiloxane (D6), 1,1-diethylhexamethylcyclotetrasiloxane, phenylheptamethylcyclotetrasiloxane, 1,1-diphenylhexamethylcyclotetrasiloxane, 1,3,5,7-tetravinyltetramethylcyclotetrasiloxane, 1,3,5,7-tetramethylcyclotetrasiloxane, 1,3,5,7-tetracyclohexyltetramethylcyclotetrasiloxane, tris(3,3,3-trifluoropropyl)trimethylcyclotrisiloxane, 1,3,5,7-tetra(p-vinylphenyl)tetramethylcyclotetrasiloxane, 1,3,5,7-tetra[3-(p-vinylphenyl)propyl]tetramethylcyclotetrasiloxane, etc. Furthermore, mixtures of different cyclic siloxanes can be used.

[0087] In another specific embodiment, the initial organosilicon compound has the above-described general formula (II). When the subscript m is 0, the initial organosilicon compound of general formula (II) is a silane compound. When the subscript m is 1, the initial organosilicon compound of general formula (II) is a disiloxane compound. When the subscript m is 2, the initial organosilicon compound of general formula (II) is a trisiloxane compound, and so on.

[0088] When the initial organosilicon compound has the above general formula (II) and the subscript m is 0, specific examples of organosilicon compounds include, but are not limited to, silanes having the following formula: Me4Si, Et4Si, Me3EtSi, Me2Ph2Si, Vi4Si, PhSiVi3, MeSiVi3, PhMeSiVi2, Ph2SiVi2 and PhSi(CH2CH=CH2)3, wherein Me is methyl, Eth is ethyl, Ph is phenyl and Vi is vinyl.

[0089] When the initial organosilicon compound has the above general formula (II) and the subscript m is 1, and each R 1 When methyl is present, the initial organosilicon compound is hexamethyldisiloxane. Those skilled in the art, based on each R... 1 The choice of the subscript m makes it easy to understand other types of siloxane compounds within the scope of the above general formula (II).

[0090] In another specific embodiment, the initial organosilicon compound has the above-described general formula (III). The initial organosilicon compound of general formula (III) differs from the initial organosilicon compound of general formula (II) based on the choice of the divalent linking group D. For example, if D is oxygen (-O-), then when the subscript m in general formula (II) is 1 and each R... 1When formulas (II) and (III) are identical, the initial organosilicon compound of formula (III) is the same as the initial organosilicon compound of formula (II). However, the divalent linking group D is typically a hydrocarbon group. In a specific embodiment, the divalent linking group D is a hydrocarbon group without heteroatoms. In a further specific embodiment, the divalent linking group D is unsubstituted.

[0091] Suitable hydrocarbon groups have been described above regarding the hydrocarbon groups of the initial organosilicon compound, except that the hydrocarbon group of the initial organosilicon compound is monovalent and the linking group D is divalent. Therefore, as is readily understood in the art, if used as a divalent linking group D, a hydrogen atom is removed from any of the hydrocarbon groups described above. For example, the hydrocarbon group of the initial organosilicon compound may be methyl (-CH3), while the divalent linking group D of the initial organosilicon compound is methylene (-CH2-). The divalent linking group may also be branched. As a specific example, when the divalent linking group is -C2H4-, it can be represented by a straight-chain -CH2CH2- or a branched CH(CH3). Other straight-chain and branched structures suitable for the divalent linking group D will be readily understood by those skilled in the art. Furthermore, the divalent linking group may include or consist of aryl groups, for example, replacing straight-chain hydrocarbon groups or saturated hydrocarbon groups. In some embodiments, the divalent linker D has 1 to 10, alternatively 1 to 9, alternatively 1 to 8, alternatively 1 to 7, alternatively 1 to 6, alternatively 1 to 5, alternatively 1 to 4, alternatively 1 to 3, or alternatively 1 or 2 carbon atoms.

[0092] In some embodiments, the initial organosilicon compound has the general formula (III), and the subscript m is 0. In these embodiments, the initial organosilicon compound has the general formula R. 1 3Si-D-SiR 1 3. For example, when D is methylene, the initial organosilicon compound has the general formula R. 1 3Si-CH2-SiR 1 3.

[0093] In specific implementations, the initial organosilicon compound may be a silicone fluid. Specific examples of suitable silicone fluids include hexamethylcyclotrisiloxane, octamethylcyclotetrasiloxane, decamethylcyclopentasiloxane, dodecylcyclohexasiloxane, octamethyltrisiloxane, decamethyltetrasiloxane, dodecylpentasiloxane, tetradecylmethylhexasiloxane, hexadecylmethylheptasiloxane, heptamethyl-3-{(trimethylsilyl)oxy)}trisiloxane, hexamethyl-3,3-bis{(trimethylsilyl)oxy}trisiloxane, pentamethyl{(trimethylsilyl)oxy}cyclotrisiloxane, as well as polydimethylsiloxane, polyethylsiloxane, polymethylethylsiloxane, polymethylphenylsiloxane, polydiphenylsiloxane, octylpolymethylsiloxane, hexamethyldisiloxane, heptamethyloctyltrisiloxane, hexylpolytrimethylsiloxane, etc., and their derivatives, their modifications, and combinations thereof.

[0094] The initial organosilicon compound can be prepared or otherwise obtained, i.e., as a compound to be prepared. Methods for preparing the initial organosilicon compound are known in the art, wherein such compounds and suitable starting materials are commercially available from various suppliers. When as part of this method, the preparation of the initial organosilicon compound is typically carried out before it is combined with a cytochrome P450 variant.

[0095] Similarly, the initial organosilicon compound can be used in any form, such as in its pure form (i.e., without solvent, carrier medium, diluent, etc.) or disposed in a carrier medium (such as a solvent or dispersant). For example, the initial organosilicon compound can be disposed in a carrier medium, such as one of those carrier media described herein. It should be understood that, if used, the acryloyloxy-functionalized organosilicon monomer can be combined with the carrier medium before, during, or after combination with the cytochrome P450 variant. In some embodiments, the initial organosilicon compound used is free of, or alternatively substantially free of, a carrier medium. For example, in some embodiments, the method may include stripping the volatiles and / or solvent of the initial organosilicon compound, or distilling the initial organosilicon compound from a solvent, volatiles, etc., to prepare the initial organosilicon compound used in the method.

[0096] The initial organosilicon compound may contain only one type of organosilicon compound, or alternatively may contain more than one type of organosilicon compound, such as two, three or more organosilicon compounds that differ from each other in terms of structure, viscosity, hydrocarbon groups, etc.

[0097] The initial organosilicon compound can be used in any amount, which will be selected by those skilled in the art, for example depending on the specific components selected for the reaction, the reaction parameters used, the scale of the reaction (e.g., the total amount of the initial organosilicon compound to be reacted and / or the organosilicon compound to be prepared having at least one silicon-bonded methanol group and / or at least one silanol group), etc.

[0098] A method for preparing an organosilicon compound having at least one silicon-bonded methanol group and / or at least one silanol group includes combining a cytochrome P450 variant with an initial organosilicon compound in the presence of an oxidant and a cofactor, and optionally any other components (collectively, "reaction components"). As those skilled in the art will understand, an active step of the cytochrome P450 variant-promoted reaction between the initial organosilicon compound and the oxidant is generally not required, except for combining the components together. As described above, this reaction of the method can generally be defined or otherwise characterized as an oxidation and / or oxidation reaction, and certain parameters and conditions of the reaction can be selected from those known in the field of such reactions to prepare an organosilicon compound having at least one silicon-bonded methanol group and / or at least one silanol group.

[0099] Typically, reactants are reacted in a container or reactor to prepare an organosilicon compound having at least one silicon-bonded methanol group and / or at least one silanol group. More specifically, reactants are typically combined in a container to prepare a reaction mixture such that an organosilicon compound having at least one silicon-bonded methanol group and / or at least one silanol group is prepared from the reaction mixture.

[0100] As described above, the reaction mixture may contain components other than the cytochrome P450 variant, the initial organosilicon compound, and the oxidant. Typically, the oxidant is atmospheric oxygen, which, due to its inherent availability under environmental conditions, does not require any active step of incorporation. Alternatively, the oxidant may be a peroxide, which can be any peroxide source. For example, the cytochrome P450 variant and the initial organosilicon compound are typically combined in the presence of a support medium (e.g., a solvent, diluent, fluid, or a combination thereof) such that the reaction mixture comprises a solution, emulsion, suspension, slurry, two-phase mixture, or a combination thereof. Those skilled in the art will independently select the specific solvent, support, and / or diluent used, and their corresponding amounts, for example, based on the specific reaction components utilized, the specific initial organosilicon compound prepared having at least one silicon-bonded methanol group and / or at least one silanol group, the scale of the reaction, etc. For example, those skilled in the art will understand that biocatalytic reactions can proceed heterogeneously, for example, with one or more components suspended but not dissolved in the support medium. However, typically, certain reactant components are employed as a homogeneous mixture (i.e., prior to the formation of the reaction mixture), and / or the reaction mixture itself is substantially homogeneous. Generally, the solvents, supports, and / or diluents used will be selected to aid in the fluidization and / or compatibilization of one or more reactant components without promoting undesirable reactions of the reactant components. Therefore, examples of specific support media include solvents, fluids, etc., suitable for adequately carrying, dissolving, and / or dispersing any component of the reaction mixture during the preparation of organosilicon compounds having at least one silicon-bonded methanol group and / or at least one silanol group.

[0101] Examples of suitable solvents include aqueous solvents (e.g., water and water-miscible organic solvents), organic solvents, fluids, oils (e.g., organic oils and / or silicone oils), and combinations thereof. Typically, the carrier medium comprises an aqueous solvent containing water, or alternatively, is substantially composed of water. However, in some embodiments, additional and / or alternative carrier fluids and / or diluents, any of those described herein, may also be used. For example, in some embodiments, the carrier medium comprises an organic solvent. Examples of organic solvents include solvents comprising: alcohols, such as methanol, ethanol, isopropanol, butanol, and n-propanol; ketones, such as acetone, methyl ethyl ketone, and methyl isobutyl ketone; aromatic hydrocarbons, such as benzene, toluene, and xylene; aliphatic hydrocarbons, such as heptane, hexane, and octane; glycol ethers, such as propylene glycol methyl ether, dipropylene glycol methyl ether, propylene glycol n-butyl ether, propylene glycol n-propyl ether, and ethylene glycol n-butyl ether; acetates, such as ethyl acetate, butyl acetate, ethylene glycol monoethyl ether acetate, and propylene glycol methyl ether acetate; halogenated hydrocarbons, such as dichloromethane, 1,1,1-trichloroethane, and chloroform; dimethyl sulfoxide; dimethylformamide, acetonitrile; tetrahydrofuran; petroleum solvents; solvent oils; naphtha; N-methylpyrrolidone; and so on, as well as their derivatives, modifications, and combinations. In some embodiments, the carrier medium includes polar organic solvents, such as solvents compatible with water. Specific examples of such polar organic solvents include methanol, ethanol, 1-propanol, 2-propanol, 2-methyl-2-propanol, 2-butanone, tetrahydrofuran, acetone, and combinations thereof.

[0102] In some embodiments, the carrier medium comprises an organic fluid, which typically includes organic oils containing volatile and / or semi-volatile hydrocarbons, esters, and / or ethers. General examples of such organic fluids include volatile hydrocarbon oils, such as C6-C... 16 Alkanes, C8-C 16 Isoalkanes (e.g., isodecane, isodecane, isohexadecane, etc.), C8-C 16 Branched esters (e.g., isohexyl neopentanoate, isodecanyl neopentanoate, etc.) and their derivatives, modifications, and combinations thereof. Other examples of suitable organic fluids include aromatic hydrocarbons, aliphatic hydrocarbons, alcohols, aldehydes, ketones, amines, esters, ethers, glycols, glycol ethers, acetates, alkyl halides, aromatic halides, and combinations thereof. Hydrocarbons include isododecane, isohexadecane, and Isopar L(C 11 -C 13 ), Isopar H(C 11 -C 12Hydrogenated polydecene. Ethers and esters include isodecyl neopentanoate, neopentyl glycol heptaate, distearate, dioctyl carbonate, diethylhexyl carbonate, propylene glycol n-butyl ether, ethyl-3 ethoxypropionate, propylene glycol methyl ether acetate, tridecyl neopentanoate, propylene glycol methyl ether acetate (PGMEA), propylene glycol methyl ether (PGME), octadecyl neopentanoate, diisobutyl adipate, diisopropyl adipate, propylene glycol dioctanoate / propylene glycol didecanoate, octyl ether, octyl palmitate, and combinations thereof.

[0103] In some embodiments, the carrier medium comprises a silicone fluid. The silicone fluid is typically a low-viscosity and / or volatile siloxane. If used as a carrier medium, the silicone fluid differs from the initial organosilicon compound utilized in the method, or the initial organosilicon compound itself may be used as the carrier fluid in the reaction mixture.

[0104] Other carrier media can also be used. For example, in some embodiments, the carrier media comprises an ionic liquid. Examples of ionic liquids include anion-cation combinations. Typically, the anion is selected from alkyl sulfate-based anions, toluenesulfonate anions, sulfonate-based anions, bis(trifluoromethanesulfonyl)imine anions, bis(fluorosulfonyl)imine anions, hexafluorophosphate anions, tetrafluoroborate anions, etc., and the cation is selected from imidazolium-based cations, pyrrolidine-based cations, pyridinium-based cations, lithium cations, etc. However, combinations of various cations and anions can also be used. Specific examples of ionic liquids typically include 1-butyl-1-methylpyrrolidine-onium bis(trifluoromethanesulfonyl)imine, 1-methyl-1-propylpyrrolidine-onium bis(trifluoromethanesulfonyl)imine, 3-methyl-1-propylpyridinium bis(trifluoromethanesulfonyl)imine, n-butyl-3-methylpyridinium bis(trifluoromethanesulfonyl)imine, 1-methyl-1-propylpyridinium bis(trifluoromethanesulfonyl)imine, diallyl dimethylammonium bis(trifluoromethanesulfonyl)imine, and methyltrioctylammonium bis(trifluoromethanesulfonyl)imine. Amines, 1-butyl-3-methylimidazolium bis(trifluoromethanesulfonyl)imine, 1,2-dimethyl-3-propylimidazolium bis(trifluoromethanesulfonyl)imine, 1-ethyl-3-methylimidazolium bis(trifluoromethanesulfonyl)imine, 1-vinylimidazolium bis(trifluoromethanesulfonyl)imine, 1-allylimidazolium bis(trifluoromethanesulfonyl)imine, 1-allyl-3-methylimidazolium bis(trifluoromethanesulfonyl)imine, lithium bis(trifluoromethanesulfonyl)imine, etc., as well as their derivatives, modifiers and combinations thereof.

[0105] The carrier medium may include a combination of different media / solvents / diluents that are miscible or immiscible with each other. For example, as described above, the reaction mixture may be homogeneous or heterogeneous (e.g., in emulsion form, such as water-in-oil emulsion, silicone-in-oil emulsion, oil-in-water emulsion, silicone-in-oil emulsion, etc.).

[0106] In some embodiments, the reaction mixture may contain one or more additional components, which will be selected by those skilled in the art based on the specific parameters employed in the method. Examples of such additional components include buffers (e.g., M9-N buffer, 2-(N-morpholino)ethanesulfonic acid (MES), 2-[4-(2-hydroxyethyl)piperazin-1-yl]ethanesulfonic acid (HEPES), 3-morpholinopropane-1-sulfonic acid (MOPS), 2-amino-2-hydroxymethyl-propane-1,3-diol (TRIS), potassium phosphate, sodium phosphate, phosphate buffer solutions, sodium citrate, sodium acetate, sodium borate, etc.), reducing agents and / or cofactors (e.g., NADPH, NADP+ (with a cofactor regeneration system), NADH, sodium dithionite, dithiothreitol (DTT), β-mercaptoethanol (BME), tris(2-carboxyethyl)phosphine (TCEP), etc.). Chelating agents (e.g., 2-({2-[bis(carboxymethyl)amino]ethyl}(carboxymethyl)amino)acetic acid (EDTA), ethylene glycol-bis(2-aminoethyl ether)-N,N,N′,N′-tetraacetic acid (EGTA), 1,2-bis(o-aminophenoxy)ethane-N,N,N′,N′-tetraacetic acid (BAPTA), etc.), salts (e.g., halide salts of sodium, calcium, potassium, magnesium, etc., such as NaCl, KCl, CaCl2, etc.), cosolvents and / or diluents (e.g., dimethyl sulfoxide, dimethylformamide, ethanol, methanol, isopropanol, glycerol, tetrahydrofuran, acetone, acetonitrile, acetic acid, etc.), denaturing agents (e.g., urea, guanidine hydrochloride, etc.), detergents (sodium dodecyl sulfate and Triton-X 100) and / or surfactants (e.g., cationic, anionic, nonionic and / or amphoteric surfactants), sugars (e.g., glucose, sucrose, etc.), and combinations thereof.

[0107] When used, such additional components can be used in any amount, loading, and / or suitable concentration, which can be readily determined by those skilled in the art. Generally, when used, these components are typically present in the reaction mixture at concentrations from 1 μM to 1 M, such as about 1 μM, 10 μM, or 100 μM, about 1 mM, 10 mM, 25 mM, 50 mM, 100 mM, 250 mM, or 500 mM, or about 1 M. In some embodiments, the reducing agent is used in a substoichiometric amount relative to the initial organosilicon compound. When used, the co-solvent can be injected into the reaction mixture in an amount from 1% (v / v) to 75% (v / v), such as 1% to 50%, alternatively 1% to 25%, alternatively 1% to 10%, alternatively 1% to 5%.

[0108] As described above, cytochrome P450 variants can be used in this method in any form, such as as a whole-cell catalyst, cell lysate, or protein isolate. Alternatively, cytochrome P450 variants can be used in the form of frozen stem cell lysates, which can be hydrated with deionized water to produce reconstituted lysates. Therefore, it should be understood that the reaction mixture may contain a suspension of such cells and / or cell components. For example, the reaction can be carried out in vivo with whole cells expressing cytochrome P450 variants, such that in some embodiments, the method includes preparing a suspension of the whole-cell catalyst in a suitable culture medium supplemented with nutrients (e.g., mineral micronutrients, glucose and other fuel sources, cofactors (if required by the reaction), etc.). As those skilled in the art will understand, the yield of organosilicon compounds having at least one silicon-bonded methanol group and / or at least one silanol group can be controlled in part by selecting the cell density in the reaction mixture. For example, in some embodiments, a reaction mixture containing a cell suspension exhibiting an optical density in the range of 0.1 to about 50 at 600 nm can be used. However, it should be understood that densities outside this range can also be utilized, for example, depending on the type of host cell used, the specific cytochrome P450 variant expressed, etc.

[0109] In some embodiments, the pH of the reaction mixture is adjusted and / or controlled. pH can be monitored, adjusted, controlled, etc., by any method known in the art, where pH adjustment typically involves adding an acid (e.g., HCl), a base (e.g., NaOH), a buffer, or a combination thereof to the reaction mixture itself (i.e., once formed) or to one or more of the reaction components. For example, in some embodiments, a cytochrome P450 variant is used in a pH-adjusted and / or controlled composition prior to combination with an initial organosilicon compound. Typically, the reaction is carried out at a pH of 7 to about 9, or about 8. For example, in some embodiments, the reaction mixture is formulated to contain a pH of 7.5 to 8.5, such as 7.6 to 8.4, alternatively 7.7 to 8.3, alternatively 7.8 to 8.2, alternatively 7.9 to 8.1 (e.g., during formation and / or during the reaction). In certain embodiments, the pH of the reaction mixture is adjusted to and / or maintained at about 8 during the reaction. It should be understood that values ​​outside these ranges may also be used, as those skilled in the art will understand in light of the description herein. For example, in certain embodiments, a specific pH of the reaction mixture is typically adjusted to optimize the activity of the specific cytochrome P450 variant utilized, and may also be changed during the process (e.g., in real time) to increase / decrease the rate of the oxidation reaction and / or stop the reaction entirely.

[0110] The reaction components can be utilized in different amounts and / or ratios selected by those skilled in the art.

[0111] Typically, cytochrome P450 variants are utilized in catalytic amounts, i.e., substoichiometric amounts relative to the initial organosilicon compound. For example, in some embodiments, cytochrome P450 variants are utilized in amounts from 0.001 mol% to 10 mol%, such as 0.001 mol% to 5 mol%, alternatively 0.001 mol% to 1 mol%, alternatively 0.001 mol% to 0.5 mol%, alternatively 0.001 mol% to 0.2 mol%, alternatively 0.01 mol% to 0.2 mol%. In these or other embodiments, cytochrome P450 variants may be utilized in amounts sufficient to provide at least 0.1 μM of cytochrome P450 variant concentration to the reaction mixture, such as 0.1 μM to 10 μM, alternatively 0.1 μM to 5 μM, alternatively 0.1 μM to 1 μM. In some embodiments, the cytochrome P450 variant is utilized in an amount sufficient to provide the reaction mixture with a concentration of 1 μM to 15 μM, such as 1 μM to 10 μM of the cytochrome P450 variant.

[0112] The amount of initial organosilicon compound used in this method is not limited and will be selected based on the size / scale of the reaction, the specific type, properties, and loading of the cytochrome P450 variant used, etc. Typically, the initial organosilicon compound is used in an amount sufficient to provide at least 1 mM to the reaction mixture, such as 1 mM to 50 mM, alternatively 1 mM to 25 mM, alternatively 1 mM to 15 mM, alternatively 5 mM to 15 mM, alternatively 5 mM to 10 mM. However, concentrations outside these ranges may also be used, and those skilled in the art will select the specific amount of initial organosilicon compound based on the reaction parameters employed. For example, in some embodiments, the initial organosilicon compound is used, for instance, based on the specific silicone-acrylate polymer prepared, the specific monomer used, etc.

[0113] This method can utilize any conditions suitable for promoting the catalytic oxidation of the initial organosilicon compound in the reaction mixture, and any techniques, equipment, or procedures known in the art for achieving such conditions. For example, when the reaction is carried out at the high temperature described below, the vessel or reactor can be heated or cooled in any suitable manner, such as via a jacket, shroud, exchanger, bath, coil, etc. Similarly, the method may include agitating the reaction mixture during and / or after formation. When combined, agitation can enhance the mixing and contact of the reactants, for example, within the reaction mixture. The method may also include independently employing other conditions tailored to enhance contact with or without agitation (e.g., simultaneously or sequentially) or without agitation (i.e., independently, alternatively). These or other conditions can be effective for increasing the reaction yield of organosilicon compounds having at least one silicon-bonded methanol group and / or at least one silanol group. Conditions can be independently environmental conditions (e.g., room temperature and / or atmospheric pressure) and / or non-environmental parameters (e.g., low or high temperature and / or low or high pressure). Furthermore, reaction parameters can be modified dynamically, in real time (i.e., during the reaction), or they can remain constant (e.g., throughout the reaction duration or at any point in time). For example, temperature, pH, agitation, oxygen content, and other parameters can be selected or modified independently during the reaction.

[0114] The reaction is typically carried out under aerobic conditions because an oxidant (such as oxygen) is an essential component of the oxidation reaction. However, the reaction can also be carried out under an inert atmosphere, such as a nitrogen atmosphere, an argon atmosphere, etc., provided that an oxidant is introduced or otherwise present in the reaction mixture. For example, the oxidant can be introduced or otherwise combined with the reaction mixture by exposing the reaction mixture to the ambient atmosphere, by using an oxygen bubbler, etc. Alternatively, the oxidant can be a peroxide, and / or a non-biological oxidant can be utilized. Therefore, it should be understood that the reaction mixture is typically prepared in the presence of oxygen, but can also be prepared under anaerobic conditions and subsequently combined and / or exposed to oxygen.

[0115] The reaction can be carried out at any temperature compatible with the cytochrome P450 variant. Typically, the reaction is carried out at temperatures from 4°C to 45°C. In some embodiments, the reaction is carried out at elevated temperatures. The elevated temperature is selected and controlled depending on the specific reaction components chosen, such as whether the cytochrome P450 variant is provided as an isolated enzyme or as a whole-cell catalyst. Therefore, those skilled in the art will readily select the elevated temperature given the chosen reaction conditions and parameters and the description herein. Elevated temperatures range from greater than 25°C (ambient temperature) to 45°C, such as 30°C to 45°C, alternatively 30°C to 40°C, or alternatively 35°C to 40°C.

[0116] The time taken for a reaction to prepare an organosilicon compound having at least one silicon-bonded methanol group and / or at least one silanol group is a function of scale, reaction parameters and conditions used, selected components, etc. In some embodiments, the reaction can proceed for a range of minutes to many hours, such as a duration of 5 minutes to 72 hours. However, the components and conditions of the hydrolysis reaction are typically chosen to facilitate hydrolysis for a duration of 30 minutes to 48 hours, such as 1 hour to 48 hours, alternatively 4 hours to 48 hours, alternatively 4 hours to 24 hours. It should be understood that durations outside these ranges / values ​​can also be utilized, as those skilled in the art will understand in light of the description herein. For example, on relatively large scales (e.g., greater than 1 kg, alternatively greater than 5 kg, alternatively greater than 10 kg, alternatively greater than 50 kg, alternatively greater than 100 kg), or in the case of using difficult substrates, the reaction can proceed for one day or more, such as at least 1 day, alternatively at least 2 days, alternatively at least 3 days, alternatively at least 5 days.

[0117] Typically, the reaction of components in a reaction mixture prepares a reaction product comprising an organosilicon compound having at least one silicon-bonded methanol group and / or at least one silanol group. Specifically, during the reaction, the reaction mixture comprises an increasing amount of the prepared organosilicon compound having at least one silicon-bonded methanol group and / or at least one silanol group and a decreasing amount of the initial organosilicon compound used for the reaction. Once the reaction is complete (e.g., the initial organosilicon compound is consumed, no additional amount of the organosilicon compound having at least one silicon-bonded methanol group and / or at least one silanol group is prepared, etc.), the reaction mixture may be referred to as a reaction product comprising an organosilicon compound having at least one silicon-bonded methanol group and / or at least one silanol group. In this way, the reaction product typically comprises any remaining amounts of the reaction components as well as their degradation and / or reaction products. For example, when the reaction is carried out in a support medium, the reaction product will comprise its solvent / fluid.

[0118] Therefore, in some embodiments, the method further includes separating an organosilicon compound having at least one silicon-bonded methanol group and / or at least one silanol group from the reaction product. As used herein with respect to an organosilicon compound having at least one silicon-bonded methanol group and / or at least one silanol group from the reaction product, the term "separation" refers to the process of increasing the relative concentration of the organosilicon compound having at least one silicon-bonded methanol group and / or at least one silanol group compared to other compounds in combination therewith (e.g., in the reaction product or its purified form). Therefore, as understood in the art, separation may include removing other compounds from such a combination (i.e., reducing the amount of impurities in combination with the organosilicon compound having at least one silicon-bonded methanol group and / or at least one silanol group, e.g., in the reaction product), and / or removing the organosilicon compound itself having at least one silicon-bonded methanol group and / or at least one silanol group from the combination. Any suitable separation technique and / or scheme may be employed. Examples of suitable separation techniques include centrifugation, distillation, concentration / stripping / evaporation, washing and / or extraction, filtration, partitioning / phase separation (e.g., based on solubility, freezing point, etc.), chromatographic methods (e.g., column chromatography, size exclusion chromatography, ion exchange chromatography, affinity chromatography, hydrophobic interaction chromatography, reversed-phase chromatography, etc.). As those skilled in the art will understand, any of these techniques can be used in combination with any other technique (i.e., sequentially) to separate organosilicon compounds having at least one silicon-bonded methanol group and / or at least one silanol group.

[0119] It should be understood that separation may include, and therefore may be referred to as, purification of organosilicon compounds having at least one silicon-bonded methanol group and / or at least one silanol group. However, purification of organosilicon compounds having at least one silicon-bonded methanol group and / or at least one silanol group may include alternative and / or additional techniques compared to those techniques used for separating organosilicon compounds having at least one silicon-bonded methanol group and / or at least one silanol group. For example, in some embodiments employing whole-cell catalysts or cell lysates, separation of organosilicon compounds having at least one silicon-bonded methanol group and / or at least one silanol group typically includes extracting the organosilicon compound having at least one silicon-bonded methanol group and / or at least one silanol group from the reaction product or removing other components (e.g., peptides, biomaterials, fats, fibers, oils, carriers, solvents, etc.) from the reaction product to obtain a crude reaction product containing an organosilicon compound having at least one silicon-bonded methanol group and / or at least one silanol group, which is then purified. Regardless of the specific technique chosen, the isolation and / or purification of organosilicon compounds having at least one silicon-bonded methanol group and / or at least one silanol group can be carried out sequentially (i.e., in order) with the reaction itself, and thus can be automated. In other cases, purification can be a separate procedure performed on the reaction product containing an organosilicon compound having at least one silicon-bonded methanol group and / or at least one silanol group.

[0120] In some embodiments, as described above, the organosilicon compound having at least one silicon-bonded methanol group and / or at least one silanol group prepared according to the method is provided as a component of the reaction product or in a purified / separated form thereof. Such compositions may also contain one or more components other than the organosilicon compound having at least one silicon-bonded methanol group and / or at least one silanol group.

[0121] It should be understood that the methods described herein are not limited to any particular application, but can instead be used in any application involving the oxidation of a suitable initial organosilicon compound into a corresponding organosilicon compound having at least one silicon-bonded methanol group and / or at least one silanol group. For example, in some embodiments, the method is used to prepare an organosilicon compound as a final compound for a desired end use (e.g., as a standalone compound or a component of a functional composition) or as a precursor for another reaction (e.g., condensation or other such reactions for functionalizing and / or derivatizing other organosilicon compounds).

[0122] The organosilicon compound formed by this method having at least one silicon-bonded methanol group and / or at least one silanol group is a function of the initial organosilicon compound used. In some embodiments, in the organosilicon compound prepared by this method, at least one silicon-bonded hydrocarbon group is oxidized and converted into a silanol group. In these or other embodiments, in the organosilicon compound prepared by this method, at least one silicon-bonded hydrocarbon group is oxidized and converted into a silicon-bonded methanol group. In still other embodiments, the method oxidizes and converts at least one silicon-bonded hydrocarbon group of the initial organosilicon compound into a silanol group, and oxidizes and converts at least one silicon-bonded hydrocarbon group of the initial organosilicon compound into a methanol group.

[0123] Typically, the silicon-bonded hydrocarbon groups of the initial organosilicon compound and the silicon-bonded methanol groups of the organosilicon compound formed via this method have the same number of carbon atoms. Generally, the oxidation and conversion of the silicon-bonded hydrocarbon groups to silicon-bonded methanol groups involves replacing carbon-hydrogen bonds with C-OH bonds. In this method, any carbon atom in the silicon-bonded hydrocarbon group can be oxidized, and the oxidation and conversion are not limited to the terminal carbon atoms in the silicon-bonded hydrocarbon groups of the initial organosilicon compound.

[0124] A method for preparing a reaction product is also provided. The method includes preparing a reaction mixture; exposing the reaction mixture to an oxidant and a silicon-bonded hydrocarbon group, converting the silicon-bonded hydrocarbon group into a functional group to obtain an organosilicon compound having the functional group; and reacting the functional group of the organosilicon compound with a group that reacts with the functional group of the organosilicon compound to prepare the reaction product.

[0125] The functional groups of the organosilicon compounds are at least one silanol group and / or a silicon-bonded methanol group. Those skilled in the art can readily determine the groups that react with the functional groups of the organosilicon compounds based on the desired reaction product and its end use. For example, the functional groups of the organosilicon compounds can condense with another functional group of another organosilicon compound, such that the reaction product prepared by this method is a condensation product of an organosilicon compound prepared using the catalyst of the present invention. For example, in one embodiment, the reaction product is formed between two organosilicon compounds via a condensation catalyst, or between an organosilicon compound and another organosilicon compound having a silicon-bonded hydrolyzable group or hydroxyl group. In these embodiments, the functional groups of the organosilicon compounds react in the presence of a condensation catalyst.

[0126] The condensation catalyst can be any condensation catalyst commonly used to promote the condensation of hydroxyl (silanol) groups to form Si-O-Si bonds. Examples of condensation catalysts include, but are not limited to, complexes of amines, metals (e.g., lead, tin, zinc, iron, titanium, zirconium) with organic ligands (e.g., carboxyl, hydrocarbon, alkoxy, etc.). In certain embodiments, the condensation catalyst may be selected from tin (II) and tin (IV) compounds, such as tin dilaurate, tin dioctanoate, dibutyltin dilaurate, dibutyltin diacetate, and tetrabutyltin; and titanium compounds, such as n-butyl titanate. In these or other embodiments, the condensation catalyst may be selected from zinc-based, iron-based, and zirconium-based catalysts.

[0127] Conventionally, organosilicon compounds having only silicon-bonded hydrocarbon groups are non-reactive and extremely stable, thus allowing for long lifetimes and stability. However, while long lifetimes and stability are desirable properties in many end-use applications, it is also desirable to degrade, remove, or otherwise convert certain organosilicon compounds. Therefore, the method of the present invention converts potentially non-reactive initial organosilicon compounds into organosilicon compounds having functional groups (i.e., silicon-bonded methanol or silanol groups), thereby allowing them to be further reacted and used. As just one example, the method of the present invention can be used to remove organosilicon compounds from waste streams or other byproduct streams that would otherwise have to be volatilized or filtered at significant cost.

[0128] The following embodiments illustrating implementations of this disclosure are intended to be illustrative and not limiting of the invention. All reactions were carried out under aerobic conditions unless otherwise stated. References to specific mutations in exemplary cytochrome P450 variants are made using conventional residue identification / numbering, without regard to the initial methionine residue (i.e., M1) shown in the sequences listed in the sequence listing (i.e., SEQ ID NO:1 to SEQ ID NO:5).

[0129] Materials

[0130] The following embodiments illustrating implementations of this disclosure are intended to be illustrative and not limiting of the invention. Unless otherwise stated, all reactions were carried out under aerobic conditions. References to specific mutations in exemplary cytochrome P450 variants are made using conventional residue identification / numbering, without regard to the initial methionine residue (i.e., M1) shown in the sequence listing.

[0131] Unless otherwise stated, all other solvents, substrates and reagents were purchased or otherwise obtained from various commercial suppliers (e.g., Sigma-Aldrich, VWR, Alfa Aesar) and used as is upon receipt (i.e., without further purification).

[0132] Phusion polymerase and DpnI were purchased from New England Biolabs (NEB, Ipswich, MA).

[0133] The trace metal mixture used in the protein expression protocol is the trace metal mixture described in FW Studier, Protein production by auto-induction in high density shaking cultures, Protein Expr. Purif. 2005, 41, 207-234, the relevant components of which are incorporated herein by reference.

[0134] Biocatalytic reactions were analyzed using an Agilent 7820A or Agilent 8890 gas chromatograph equipped with a 5977B mass spectrometer detector and a DB-5MS capillary column (30 m length, 0.250 mm diameter, 0.25 μm film thickness, using split-flow capillary injection and electron collision ionization). Calibration curves were generated using serially diluted solutions of appropriate materials and 5 mM 1,3,5-trimethoxybenzene or 5 mM D4 as internal standards. Yields were determined by adjusting the calculated concentration of the product relative to the internal standard to account for the dilution factor of the enzymatic extraction.

[0135] Glucose-6-phosphate dehydrogenase (196 U / mg) was dissolved in sodium citrate buffer at pH 7.4 to obtain a final concentration of 196 U / mL. The undiluted glucose-6-phosphate dehydrogenase solution was aliquoted into individual PCR tubes in 200 μL portions and rapidly frozen in liquid nitrogen (LN2) or dry ice powder before use. For the biocatalytic reaction, 14 mM NADP was combined with 100 mM pH 7 Tris buffer. + The stock solution of the NADPH cofactor regeneration system was prepared using 1.12M glucose-6-phosphate and 56U / mL glucose-6-phosphate dehydrogenase (stock solution concentration).

[0136] Cloning, mutagenesis, and plasmid transformation and isolation

[0137] Based on the "22-codon trick" known in the art (ACS Synth Biol. 2013, 2, 83–92) and using a modified QuikChange TMThe protocol was followed for site-saturated mutagenesis (SSM) experiments using primers with degenerate codons (NDT, VHG, TGG). PCR conditions were as follows: 1x Phusion GC buffer, 200 mM dNTPs each, 0.5 μM forward primer, 0.5 μM reverse primer, and 0.02 U / μL Phusion polymerase. Thermal cycling conditions are listed in Table 1. After PCR, the remaining template was digested with DpnI (1 μL). The DNA was then purified by gel electrophoresis (1% agarose gel containing SYBR Gold nucleic acid gel staining agent) and visualized on a blue transilluminator. DNA was then isolated using the Zymoclean DNA gel extraction kit. The purified PCR products were then assembled using the Gibson assembly protocol known in the art (Nature Methods 2009, 6, 343-345).

[0138] Table 1 : Thermal cycler conditions

[0139]

[0140] The break in the ampicillin / carbenicillin cassette was introduced into error-prone PCR, generating two backbone fragments (i.e., the pET22(b)+ vector) and a fragment encoding either a truncated or complete enzyme. Mutations within the full-length fragment were introduced by varying the concentration of MnCl2 during PCR amplification. Insertion PCR conditions were as follows: 1x standard Taq buffer, 200 mM dNTPs, 0.5 μM primer NSS005, 0.5 μM primer HR1-V2, and 0.08 U / μL Taq polymerase, and 200 μM-400 μM MnCl2. After PCR, the remaining template was digested with 1 μL DpnI. The thermal cycling conditions for insertion PCR are summarized in Table 3. Backbone PCR conditions were as follows: 1x Phusion GC buffer, 5% DMSO, 200 mM dNTPs, 0.5 μM forward primer, 0.5 μM reverse primer, and 0.02 U / μL Phusion polymerase. Backbone fragment 1 (BB1) was prepared using primers Amp_int_forward and NSS007. Backbone fragment 2 (BB2) was prepared using primers HF1-V2 and Amp_int_reverse. The primer sequences for NSS005, NSS007, HR1-V2, HF1-V2, Amp_int_forward, and Amp_int_reverse are disclosed in Table 2. The thermal cycling conditions for BB1 / BB2 are summarized in Table 4. After PCR, the remaining template was digested with DpnI (1 μL). Gel purification was performed using gel electrophoresis (1% agarose gel containing SYBR Gold nucleic acid gel staining agent), and the DNA was visualized on a blue transilluminator. DNA was isolated using the Zymoclean DNA gel recovery kit. The purified PCR products were then assembled using the Gibson assembly protocol known in the art (Nature Methods 2009, 6, 343-345).

[0141] Table 2: Primers for PCR mutagenesis and amplification

[0142]

[0143] Table 3: Thermal cycler conditions for insert PCR

[0144]

[0145] Table 4: Thermal cycler conditions for BB1 / BB2

[0146]

[0147] Recombination via staggered extension process

[0148] The plasmid of the variant to be recombined in an equimolar manner was used, and the mixture was used as template DNA for staggered extension process (StEP) PCR. StEP PCR was then performed according to standard protocols known in the art (Nature Biotechnology 1998, 16, 258–261 and Nature Protocols 2006, 1, 1865–1871), by varying the annealing temperature and using a shorter extension time. PCR conditions were as follows: 1x standard Taq buffer, 200 mM dNTPs, 0.5 μM primer NSS005, 0.5 μM primer HR1-V2, and 0.08 U / μL Taq polymerase. Thermal cycling conditions for recombination of the StEP insert sequence are disclosed in Table 5. Amplification of the recombinant fragment was performed using the Phusion PCR protocol. PCR conditions were as follows: 1x Phusion GC buffer, 200 mM dNTPs, 0.5 μM primer NSS005, 0.5 μM primer HR1-V2, and 0.02 U / μL Phusion polymerase. Thermal cycling conditions for amplifying the StEP insert sequence are disclosed in Table 6. After PCR, the remaining template was digested with 1 μL of DpnI. The recombinant insert sequence was purified by purified gel electrophoresis (1% agarose gel stained with SYBR Gold nucleic acid gel) and the DNA was visualized on a blue transilluminator. The recombinant insert sequence library was purified and inserted into the pET22(b)+ vector using Gibson assembly (Nature Methods 2009, 6, 343–345), using the BB1 / BB2 fragment as understood in the art.

[0149] Table 5: Thermal cycler conditions for recombination of StEP inserted sequences

[0150]

[0151] Table 6: Thermal cycler conditions for amplification of StEP inserted sequences

[0152]

[0153] Transformation and isolation of plasmids / Gibson products

[0154] All experiments used T7-expressing competent *E. coli* cells. The plasmid and competent cells were mixed in PCR tubes on ice. The mixture was incubated on ice for 30 min, followed by transformation by heat shock of the mixture for exactly 10 seconds in a 42°C water bath. After restoring on ice for 5 min, the cells were diluted with SOC medium and plated on Luria Bertani medium supplemented with carbenicillin (1 mg / mL).

[0155] Plasmids were isolated from stationary phase cultures using small-scale preparation (Qiagen) and sequenced by Laragen, Inc. (Culver City, CA) using primers with the T7 promoter and HR1-V2 terminator.

[0156] Small scale enzyme screening

[0157] For small-scale biocatalytic reactions using cell lysates, the reaction vessel is either an individual snap-cap 2.0 mL microtube or a 96-well plate constructed from individual 1.0 mL autosampler neckless vials. Individual vials are used to construct 96-well microtiter plates by inserting the 1.0 mL autosampler neckless vials into the 96-well microtiter plates using a USA Scientific 1000 μL pipette tip holder as an alignment guide. After adding all biocatalytic reaction components, the snap-cap vials are sealed with individual caps. The 96-well microtiter plates are then sealed with an additional 96-well microtiter plate and centrifuged (3000 g, 1 min, 25 °C).

[0158] After generating libraries using single-point saturation mutagenesis (SSM), error-prone PCR (epPCR), or staggered extension process (StEP), 84 single colonies were randomly selected and cultured in 400 mL of LB medium (LBcarb) containing 0.1 mg / mL carbenicillin in sterile 96-well plates. The plates typically contained eight wells inoculated with single colonies expressing the parental enzyme, two sterile wells, and two wells inoculated with single colonies expressing Tm9D8*. Cultures were covered with microporous membranes and incubated at 37°C, 220 rpm, and 80% relative humidity for 12–16 h. 930 mL of Terrific broth medium (TBcarb) containing 0.1 mg / mL carbenicillin was then added to separate sterile 96-well plates. Plates containing TBcarb were inoculated with LBcarb pre-culture (20 mL / well) and incubated at 37°C, 220 rpm, and 80% relative humidity for 3 h. The plates were then cooled on ice for 30 min and induced with a mixture of 0.5 mM IPTG, 1 mM ALA, and X FeCl3 / trace metal master solution (final concentration), and then expressed for 16 h to 22 h at 22 °C and 220 rpm. After expression, the cells were pelleted by centrifugation (4500 g, 15 min, 4 °C), and the supernatant was discarded. The pelleted cells were sealed with foil and stored in a -20 °C freezer for at least 16 h before lysis.

[0159] The 96-well plates containing frozen cell cultures were thawed at 25°C for 10 min, and the precipitated cells were then resuspended in lysis buffer (400 μL / well) containing 1 mg / mL lysozyme, 0.07 mg / mL DNase, and 2 mM MgCl2. The cells were then lysed at 37°C and 160 rpm for 1 h. Cell debris was then precipitated by centrifugation (4500 g, 15 min, 4°C). The biocatalytic reaction vessel was then loaded with either NADPH cofactor regeneration system (12.5 μL / vessel) or NADPH (12.5 μL / vessel) to obtain a final reaction concentration of 0.5 mM NADP+, 40 mM glucose-6-phosphate, and 2 U / mL glucose-6-phosphate dehydrogenase or 10 mM NADPH. A 280 mM substrate stock solution was prepared by dissolving the appropriate substrate in the specified cosolvent. Cell lysate (325 μL / reaction) was then added to the reaction vessel, followed by substrate (12.5 μL / reaction) to obtain a final substrate concentration of 10 mM. The reaction vessel was sealed immediately after substrate addition and incubated at 25 °C and 800 rpm for 4 h with shaking. After 4 h of reaction, the reaction vessel was opened, and a solution of 5 mM 1,3,5-trimethoxybenzene or 5 mM D4 in ethyl acetate was rapidly added (400 μL / well to 450 μL / well). The organic and aqueous phases were mixed using a vortex mixer (microtube) or by pipetting the mixture with a multichannel pipette. Phase separation in the microtubes was facilitated by centrifugation at 14,000 g and 4 °C for 15 min. 96-well shell-and-tube plates were sealed with sealing foil and centrifuged at 4000 g and 4 °C for 15 min. The organic phase aliquots (200 μL / reaction) were then transferred to individual 400 μL flat-bottomed glass inserts in 2 mL screw-cap vials sealed with a red Sil diaphragm screw cap. Analysis was performed using GC / MS, where product concentration and yield were determined by using the response of the calibration curve to a 1,3,5-trimethoxybenzene internal standard.

[0160] Determination of heme protein concentration

[0161] The concentration of heme protein in purified proteins and cell lysates was determined by CO binding assay. Heme protein solutions were added in 3 to 6 replicates per protein to 96-well clear plastic plates (180 μL / well). Then, 20 μL / well of 300 mM sodium dithionite in 1 M pH 8 potassium phosphate buffer was added to each well. Absorbance was measured at 450 nm and 490 nm using a multimode microplate reader. The plates were then placed in a CO2 chamber. The chamber was evacuated using a vacuum pump and then refilled with CO2 to atmospheric pressure. The plates were incubated in a CO2 atmosphere for 30 min, and measurements were taken again at 450 nm and 490 nm using a microplate reader. The heme protein concentration was determined using Beer's Law with ΔA450-490 between CO2-bound and CO2-reduced samples, an ε450-490 value of 0.091, a dilution factor of 1.1, and a path length of 0.74 cm.

[0162] Protein purification procedure

[0163] For purification, the cell pellet was frozen at -20°C for at least 24 hours. Cells were thawed and resuspended in binding buffer (20 mM Tris·HCl, 100 mM sodium chloride, 20 mM imidazole, pH 7.0, approximately 5 mL / g wet cells) and lysed by sonication (QSonica Q500 sonicator, 25% amplitude, 33% duty cycle, 2 min). The lysate was clarified by centrifugation (4500 g, 10 min) followed by filtration (0.20 μm syringe filter). The protein was purified using a purification system equipped with an HP column, eluting with a 20 mM to 500 mM imidazole gradient. Fractions containing the target protein were combined. Fractions containing the purified enzyme were combined and concentrated by repeated centrifugation and dilution in Tris buffer (0.1 M, pH 7) through an ultracentrifuge filter (10 kDa molecular weight cutoff). The protein was concentrated to a final concentration of 5 μM to 100 μM (as defined below). The concentrated protein was aliquoted into equal samples (50 μL to 100 μL), rapidly frozen on dry ice powder, and stored at -80 °C. Protein concentration was determined by CO binding assay.

[0164] Preparative Example X1 : Small scale enzymatic reactions for lineage verification

[0165] Enzyme activity was validated as follows. *E. coli* transformed with the pET22b(+) construct encoding P450 was grown in 5 mL LBcarb medium at 37°C and 220 rpm for 16–20 h. Subsequently, 0.5 mL of this pre-culture was inoculated into 50 mL TBcarb medium in a sterile 125 mL Erlenmeyer flask lined with sterile aluminum foil. The culture was incubated at 37°C with shaking at 220 rpm for approximately 2–4 h until the photocell density (OD600) at 600 nm reached 0.7–0.9. The expression culture was then cooled in an ice bath for 30 min and induced with 0.5 mM IPTG, 1 mM ALA, and 3.5 μM FeCl3 / trace metal master mixture (final concentration), and then expressed at 22°C and 220 rpm for 16–22 h. After expression, the culture was transferred to 50 mL Falcon tubes after thaw and centrifuged (4500 g, 15 min, 4 °C), and the supernatant was discarded. The pelleted cells were stored at -20 °C for at least 16 h and then lysed in sealed Falcon tubes.

[0166] Falcon tubes containing frozen cell cultures were thawed at 25°C for 10 min, and the precipitated cells were then resuspended in lysis buffer (4 mL / 1 g precipitate) containing 1 mg / mL lysozyme, 0.07 mg / mL DNase, and 2 mM MgCl2. Cells were then lysed at 37°C and 180 rpm for 1 h. The lysed culture was then transferred to 2.0 mL microtubes and centrifuged at 14000 g and 4°C for 15 min. The supernatant lysate was reconstituted in 15 mL Falcon tubes. Then, NADPH cofactor regeneration system (12.5 μL / vessel) or NADPH (12.5 μL / vessel) was added to the 2.0 mL microtubes to obtain a final reaction concentration of 0.5 mM NADP+, 40 mM glucose-6-phosphate, and 2 U / mL glucose-6-phosphate dehydrogenase or 10 mM NADPH. A 280 mM substrate stock solution was prepared by dissolving the appropriate substrate in the specified cosolvent. Cell lysate (325 μL / reaction) was then added to the reaction vessel, followed by substrate (12.5 μL / well) to obtain a final concentration of 10 mM substrate. The microtubes were sealed immediately after substrate addition and vortexed at 800 rpm for 4 h at 25 °C. After 4 h of reaction, the reaction vessel was opened, and a 5 mM solution of 1,3,5-trimethoxybenzene in ethyl acetate (400 μL / reaction to 450 μL / reaction) was rapidly added. The organic and aqueous phases were mixed using a vortex mixer. Phase separation was facilitated by centrifugation at 14,000 g and 4 °C for 15 min. Aliquots of the organic phase (200 μL / reaction) were then transferred to individual 400 μL flat-bottomed glass inserts in 2 mL screw-cap vials sealed with a red Sil diaphragm screw cap. Analysis was performed using GC / MS, where product concentration and yield were determined by the response of a calibration curve relative to a 1,3,5-trimethoxybenzene internal standard. Superior variants were selected for subsequent mutagenesis by comparing product yield with product yield relative to estimated protein concentration. Heme protein concentration was determined by CO binding assay of cell lysates.

[0167] Preparative Example X2: Verification of LSilOx4 to LSilOx5 evolutionary lineage

[0168] LBcarb culture (80 mL / well) of an unverified variant with improved activity identified from the LSilOx4 error-prone PCR library was seeded quadruplicately into 24-well plates containing 3.75 mL of TBcarb. In each plate, four wells served as a sterile control, two wells as a TM9D8* negative control, and four wells as the parent enzyme LSILOX4. The cultures were covered with microporous membranes and grown at 37 °C, 205 rpm, and 80% relative humidity for 3 h. The plates were then cooled on ice for 30 min and induced with a mixture of 0.5 mM IPTG, 1 mM ALA, and 3.5 μM FeCl3 / trace metal master, followed by expression at 22 °C and 205 rpm for 16 h to 22 h. After expression, the cells were pelleted by centrifugation (4500 g, 15 min, 4 °C), and the supernatant was discarded. The pelleted cells were sealed with foil and stored at -20 °C for at least 16 h before lysis.

[0169] 24-well plates containing frozen cell cultures were thawed at 25°C for 10 min, and the precipitated cells were resuspended in lysis buffer (1.1 mL / well) containing 1 mg / mL lysozyme, 0.07 mg / mL DNase, and 2 mM MgCl2. Cells were then lysed at 37°C and 135 rpm for 1 h. Cell debris was then precipitated by centrifugation (4500 g, 15 min, 4°C). NADPH cofactor regeneration system (25 mL / reaction) was then loaded into 2.0 mL microtubes to obtain a final reaction concentration of 0.5 mM NADP+, 40 mM glucose-6-phosphate, and 2 U / mL glucose-6-phosphate dehydrogenase or 10 mM NADPH. A 280 mM substrate stock solution was prepared by dissolving L3 in ethanol. Cell lysate (650 mL / reaction) was then added to the reaction vessel, followed by substrate (25 mL / reaction) to obtain a final substrate concentration of 10 mM. Immediately after adding the substrate, the reaction vessel was sealed and shaken at 800 rpm for 4 h at 25 °C. After 4 h of reaction, the reaction vessel was opened and a 5 mM solution of 1,3,5-trimethoxybenzene in ethyl acetate (800 mL / reaction) was rapidly added. The organic and aqueous phases were mixed using a vortex mixer. Phase separation in the microtubes was facilitated by centrifugation at 14,000 g and 4 °C for 15 min. Aliquots of the organic phase (200 mL / reaction) were then transferred to individual 400 mL flat-bottomed glass inserts in 2 mL screw-cap vials sealed with a red Sil diaphragm screw cap. Analyzing was performed using GC / MS, where product concentration and yield were determined by the response of the calibration curve relative to the 1,3,5-trimethoxybenzene internal standard.

[0170] Preparative Example X3: Small scale enzymatic reactions using purified protein

[0171] NADPH (12.5 μL / well) was added to a 2.0 mL microtube to obtain a final reaction concentration of 10 mM NADPH. A 320 mM substrate stock solution was prepared by dissolving an appropriate amount of substrate in 200% standard ethanol (proof ethanol). The purified protein and buffer were added to the reaction vessel to a total of 375 μL to obtain a final protein concentration of 5 μM, followed by the addition of substrate (12.5 μL / well) to obtain a final substrate concentration of 10 mM. The microtubes were sealed immediately after substrate addition and shaken at 800 rpm for 4 h at 25 °C. After 4 h of reaction, the reaction vessel was opened and a 5 mM D4 ethyl acetate solution (400 μL / reaction) was rapidly added. The organic and aqueous phases were mixed using a vortex mixer. Phase separation was promoted by centrifugation at 14,000 g and 4 °C for 15 min. The organic phase aliquots (200 μL / reaction) were then transferred to individual 400 μL flat-bottomed glass inserts in 2 mL screw-cap vials sealed with a red Sil diaphragm screw cap. Analysis was performed using GC / MS, where product concentration and yield were determined by using the response of the calibration curve relative to the D4 internal standard.

[0172] Table 7. Lineage reactions with hexamethyldisiloxane

[0173]

[0174] The reaction conditions were as described in Preparation Example X3: 10 mM L2, purified P450BM3 variant, 10 mM NADPH, 100 mM pH 7 Tris buffer, 3.6% EtOH, 25°C, 4 h, aerobic.

[0175] Hexamethyldisiloxane lineage reactions

[0176]

[0177] Table 8. Lineage verification reactions with octamethyltrisiloxane

[0178]

[0179]

[0180] The reaction conditions were as described in Preparation Example X2: 10 mM L3, P450BM3 variant in the lysate, 40 mM glucose-6-phosphate, 2 U / mL glucose-6-phosphate-dehydrogenase, 0.5 mM NADP+, 100 mM pH 7 Tris buffer, 3.6% EtOH, 25 °C, 4 h, aerobic.

[0181] Octamethyltrisiloxane lineage reactions

[0182]

[0183] Table 9. Lineage verification reactions with octamethylcyclotetrasiloxane

[0184]

[0185] The reaction conditions were as described in Preparation Example X1: 10 mM D4, P450BM3 variant in the lysate, 40 mM glucose-6-phosphate, 2 U / mL glucose-6-phosphate-dehydrogenase, 0.5 mM NADP+, 100 mM pH 7 Tris buffer, 3.6% EtOH, 25 °C, 4 h, aerobic.

[0186] Octamethylcyclotetrasiloxane lineage verification reactions

[0187]

[0188] Table 10. Brook rearrangement experiments using hexamethyldisiloxane

[0189]

[0190]

[0191] The reaction conditions were as described in Preparation Example X3: 10 mM L2, 5 μM purified P450BM3 variant or control, 10 mM NADPH, 100 mM pH 7 Tris buffer, 3.6% EtOH, 25 °C, 4 h, aerobic.

[0192] Hexamethyldisiloxane Brook rearrangement reactions

[0193]

[0194] Table 11. Brook rearrangement experiments using MM CH2OH of Table 11

[0195]

[0196] The reaction conditions were as described in Preparation Example X3: 10 mM L2, 5 μM purified P450BM3 variant or control, 10 mM NADPH, 100 mM pH 7 Tris buffer, 3.6% EtOH, 25 °C, 4 h, aerobic.

[0197] Using MM CH2OH Brook rearrangement reaction

[0198]

[0199] Table 12. Co-solvent facilitated enzymatic reactions .

[0200]

[0201] The reaction conditions were as described in Preparation Example X1: 10 mM L3, P450BM3 variant in the lysate, 40 mM glucose-6-phosphate, 2 U / mL glucose-6-phosphate-dehydrogenase, 0.5 mM NADP+, 100 mM pH 7 Tris buffer, 3.6% co-solvent or an equal volume of co-solvent-free buffer, 25°C, 4 h, aerobic.

[0202] Co-solvent facilitated enzymatic reactions

[0203]

[0204] Table 13. Mutation summary and sequences of enzyme variants

[0205]

[0206]

[0207]

[0208] The DNA sequence of LSilOx1 [SEQ ID NO:1]

[0209] ACAATTAAAGAAATGCCTCAGCCAAAAACGTTTGGAGAGCTTAAAA

[0210] ATTTACCGTTATTAAACACAGATAAACCGGTTCAAGCTTTGATGAA

[0211] AATTGCGGATGAATTAGGAGAAATCTTTAAATTCGAGGGCGCCTGGT

[0212] CGGTTAACCGCTACTTATCAAGTCAGCGTCTAATTAAAGAAGCAT

[0213] GCGATGAATCACGCTTTGATAAAAACTTAAGTCAAGCGCTTAAATT

[0214] TGCACGTGATTTTGTTGGAGACGGGTTAGGTACAAGCTGGACGCAT

[0215] GAAAAAAATTGGAAAAAAGCGCATAATATCTTACTTCCAAGCTTTA

[0216] GTCAGCAGGCAATGAAAGGCTATCATGCGATGATGGTCGATATCGC

[0217] CGTGCAGCTTGTCAAAAGTGGGAGCGTCTAAATGCAGATGAGCAT

[0218] ATTGAAGTATCGGAAGACATGACACGTTTAACGCTTGATACAATTG

[0219] GTCTTTGCGGCTTTAACTATCGCTTTAACAGCTTTTACCGAGATCAG

[0220] CCTCATCCATTTATTATAAGTATGGTCCGTGCACTGGATGAAGTAAT

[0221] GAACAAGCTGCAGCGAGCAAATCCAGACGACCCAGCTTATGATGA

[0222] AAACAAGCGCCAGTTTCAAGAAGATATCAAGGTGATGAACGACCT

[0223] AGTAGATAAAATTATTGCAGATCGCAAAGCAAGGGGTGAACAAAG

[0224] CGATGATTTTAACGCAGATGCTAAACGGAAAAGATCCAGAAACG

[0225] GGTGAGCCGCTTGATGACGGGAACATTCGCTATCAAATTATTACAT

[0226] TCTTAATTGCGGGACACGAAACAACAAGTGGTCTTTTATCATTTGCG

[0227] CTGTATTTCTTAGTGAAAAATCCACATGTTACAAAAAAGTAGCAG

[0228] AAGAAGCAGCACGAGTTCTAGTAGATCCTGTTCCAAGCTACAAACA

[0229] AGTCAAACAGCTTAAATATGTCGGCATGGTCTTAAACGAAGCGCTG

[0230] CGCTTATGGCCAACTGCTCCTGCGTTTTCCCTATATGCAAAAGAAGA

[0231] TACGGTGCTTGGAGGAGAATATCCTTTAGAAAAAGGCGACGAAGTA

[0232] ATGGTTCTGATTCCTCAGCTTCACCGTGATAAAACAGTTTGGGGAG

[0233] ACGATGTGGAGGAGTTCCGTCCAGAGCGTTTTGAAAATCCAAGTGC

[0234] GATTCCGCAGCATGCGTTTAAACCGTTTGGAAACGGTCAGCGTGCG

[0235] TGTATCGGTCAGCAGTTCGCTCTTCATGAAGCAACGCTGGTACTTGG

[0236] TATGATGCTAAAACACTTTGACTTTGAAGATCATACAAACTACGAG

[0237] CTCGATATTAAAGAAACTTTAACGTTAAAACCTAAAGGCTTT

[0238] DNA sequence of LSilOx2 [SEQ ID NO:2]

[0239] ACAATTAAAGAAATGCCTCAGCCAAAAACGTTTGGAGAGCTTAAAA<00​​​​​​​​​​​​​TGCACGTGATTTTGTTGGAGACGGGTTAGGTACAAGCTGGACGCAT

[0245] GAAAAAAAATTGGAAAAAAGCGCATAATATCTTACTTCCAAGCTTTA

[0246] GTCAGCAGGCAATGAAAGGCTATCATGCGATGATGGTCGATATCGC

[0247] CGTGCAGCTTGTTCAAAAGTGGGAGCGTCTAAATGCAGATGAGCAT

[0248] ATTGAAGTATCGGAAGACATGACACGTTTAACGCTTGATACAATTG

[0249] GTCTTTGCGGCTTTTAACTATCGCTTTAAACAGCTTTTACCGAGATCAG

[0250] CCTCATCCATTTATTATAAGTATGGTCCGTGCACTGGATGAAGTAAT

[0251] GAACAAGCTGCAGCGAGCAAATCCAGACGACCCAGCTTATGATGA

[0252] AAACAAGCGCCAGTTTCAAGAAGATATCAAGGTGATGAACGACCT

[0253] AGTAGATAAAATTATTGCAGATCGCAAAGCAAGGGGTGAACAAAG

[0254] CGATGATTTATTAACGCAGATGCTAAACGGAAAAGATCCAGAAACG

[0255] GGTGAGCCGCTTGATGACGGGAACATTCGCTATCAAATTATTACAT

[0256] TCTTAATTGCGGGACACGAAACAACAAGTGGTCTTTTATCATTTGCG

[0257] CTGTATTTCTTAGTGAAAATCCACATGTATTACAAAAAGTAGCAG

[0258] AAGAAGCAGCACGAGTTCTAGTAGATCCTGTTCCAAGCTACAAACA

[0259] AGTCAAACAGCTTAAATATGTCGGCATGGTCTTAAACGAAGCGCTG

[0260] CGCTTATGGCCAATGTTTCCTGCGTTTTCCCTATATGCAAAAGAAGA

[0261] TACGGTGCTTGGAGGAGAATATCCTTTAGAAAAAGGCGACGAAGTA

[0262] ATGGTTCTGATTCCTCAGCTTCACCGTGATAAAACAGTTTGGGGAG

[0263] ACGATGTGGAGGAGTTCCGTCCAGAGCGTTTTGAAAATCCAAGTGC

[0264] GATTCCGCAGCATGCGTTTAAACCGTTTGGAAACGGTCAGCGTGCG

[0265] TGTATCGGTCAGCAGTTCGCTCTTCATGAAGCAACGCTGGTACTTGG

[0266] TATGATGCTAAAACACTTTGACTTTGAAGATCATACAAACTACGAG

[0267] CTCGATATTAAAGAAACTTTAACGTTAAAACCTAAAGGCTTT

[0268] DNA sequence of LSilOx3 [SEQ ID NO:3]

[0269] ACAATTAAAGAAATGCCTCAGCCAAAAACGTTTGGAGAGCTTAAAA<0​​​​​​​CGTGTAACGCGCTACTTATCAAGTCAGCGTCTAATTAAAAGAAGCAT

[0273] GCGATGAATCACGCTTTGATAAAAAACTTAAGTCCAAGCGCTTAAATT

[0274] TGCACGTGATTTTGTTGGAGACGGGTTAGGTACAAGCTGGACGCAT

[0275] GAAAAAAAATTGGAAAAAAGCGCATAATATCTTACTTCCAAGCTTTA

[0276] GTCAGCAGGCAATGAAAGGCTATCATGCGATGATGGTCGATACCGC

[0277] CGTGCAGCTTGTTCAAAAGTGGGAGCGTCTAAATGCAGATGAGCAT

[0278] ATTGAAGTATCGGAAGACATGACACGTTTAACGCTTGATACAATTG

[0279] GTCTTTGCGGCTTTTAACTATCGCTTTAAACAGCTTTTACCGAGATCAG

[0280] CCTCATCCATTTATTATAAGTATGGTCCGTGCACTGGATGAAGTAAT

[0281] GAACAAGCTGCAGCGAGCAAATCCAGACGACCCAGCTTATGATGA

[0282] AAACAAGCGCCAGTTTCAAGAAGATATCAAGGTGATGAACGACCT

[0283] AGTAGATAAAATTATTGCAGATCGCAAAGCAAGGGGTGAACAAAG

[0284] CGATGATTTATTAACGCAGATGCTAAACGGAAAAGATCCAGAAACG

[0285] GGTGAGCCGCTCGATGACGGGAACATTCGCTATCAAATTATTACAT

[0286] TCTTAATTGCGGGACACGAAACAACAAGTGGTCTTTTATCATTTGCG

[0287] CTGTATTTCTTAGTGAAAAATCCACATGTATTACAAAAAGTAGCAG

[0288] AAGAAGCAGCACGAGTTCTAGTAGATCCTGTTCCAAGCTACAAACA

[0289] AGTCAAACAGCTTAAATATGTCGGCATGGTCTTAAACGAAGCGCTG

[0290] CGCTTATGGCCAATGTTTCCTGCGTTTTCCCTATATGCAAAAGAGGA

[0291] TACGGTGCTAGGAGGAGAATATCCTTTAGAAAAAGGCGACGAAGT

[0292] AATGGTTCTGATTCCTCAGCTTCACCGTGATAAAACAGTTTGGGGA

[0293] GACGATGTGGAGGAGTTCCGTCCAGAGCGTTTTGAGAATCCAAGTG

[0294] CGATTCCACAGCATGCGTTTAAACCGTTTGGAAACGGTCAGCGTGC

[0295] GTGTATCGGTCAGCAGTTCGCTCTTCATGAAGCAACGCTGGTACTTG

[0296] GTATGATGCTAAAACACTTTGACTTTGAAGATCATACAAACTACGA

[0297] GCTCGATATTAAAGAAACTTTAACGTTAAAACCTAAAGGCTTT

[0298] DNA sequence of LSilOx4 [SEQ ID NO:4]

[0299] ACAATTAAAGAAATGCCTCAGCCAAAAACGTTTGGAGAGCTTAAAA

[0300] ATTTACCGTTATTAAACACAGATAAACCGGTTCAAGCTTTGATGAA

[0301] AATTGCGGGTGAATTAGGAGAAATCTTTAAATTCGAGGCGCCTGGT

[0302] CGTGTAACGCGCTACTTATCAAGTCAGCGTCTAATTAAAAGAAGCAT

[0303] GCGATGAATCACGCTTTGATAAAAAACTTAAGTCCAAGCGCTTAAATT

[0304] TGCACGTGATTTTGTTGGAGACGGGTTAGGTACAAGCTGGACGCAT

[0305] GAAAAAAAATTGGAAAAAAGCGCATAATATCTTACTTCCAAGCTTTA

[0306] GTCAGCAGGCAATGAAAGGCTATCATGCGATGATGGTCGATACCGC

[0307] CGTGCAGCTTGTTCAAAAGTGGGAGCGTCTAAATGCAGATGAGCAT

[0308] ATTGAAGTATCGGAAGACATGACACGTTTAACGCTTGATACAATTG

[0309] GTCTTTGCGGCTTTTAACTATCGCTTTAAACAGCTTTTACCGAGATCAG

[0310] CCTCATCCATTTATTATAAGTATGGTCCGTGCACTGGATGAAGTAAT

[0311] GAACAAGCTGCAGCGAGCAAATCCAGACGACCCAGCTTATGATGA

[0312] AAACAAGCGCCAGTTTCAAGAAGATATCAAGGTGATGAACGACCT

[0313] AGTAGATAAAATTATTGCAGATCGCAAAGCAAGGGGTGAACAAAG

[0314] CGATGATTTATTAACGCAGATGCTAAACGGAAAAGATCCAGAAACG

[0315] GGTGAGCCGCTTGATGACGAGAACATTCGCTATCAAATTATTACAT

[0316] TCTTAATTGCGGGACACGAAACAACAAGTGGTCTTTTATCATTTGCG

[0317] CTGTATTTCTTAGTGAAAAATCCACATGTATTACAAAAAGTAGCAG

[0318] AAGAAGCAGCACGAGTTCTAGTAGATCCTGTTCCAAGCTACAAACA

[0319] AGTCAAACAGCTTAAATATGTCGGCATGGTCTTAAACGAAGCGCTG

[0320] CGCTTATGGCCAATGTTTCCTGCGTTTTCCCTATATGCAAAAGAAGA

[0321] TACGGTGCTTGGAGGAGAATATCCTTTAGAAAAAGGCGACGAAGTA

[0322] ATGGTTCTGATTCCTCAGCTTCACCGTGATAAAACAGTTTGGGGAG

[0323] ACGATGTGGAGGAGTTCCGTCCAGAGCGTTTTGAAAATCCAAGTGC

[0324] GATTCCGCAGCATGCGTTTAAACCGTTTGGAAACGGTCAGCGTGCG

[0325] TGTATCGGTCAGCAGTTCGCTCTTCATGAAGCAACGCTGGTACTTGG

[0326] TATGATGCTAAAACACTTTGACTTTGAAGATCATACAAACTACGAG

[0327] CTCGATATTAAAGAAACTTTAACGTTAAAACCTAAAGGCTTT

[0328] DNA sequence of LSilOx5 [SEQ ID NO:5]

[0329] ACAATTAAAGAAATGCCTCAGCCAAAAACGTTTGGAGAGCTTAAAA

[0330] ATTTACCGTTATTAAACACAGATAAACCGGTTCAAGCTTTGATGAA

[0331] AATTGCGGGTGAATTAGGAGAAATCTTTAAATTCGAGGCGCCTGGT

[0332] CGTGTAACGCGCTACTTATCAAGTCAGCGTCTAATTAAAGAAGCAT

[0333] GCGATGAATCACGCTTTGATAAAAACTTAAGTCAAGCGCTTAAATT

[0334] TGCACGTGATTTTGTTGGAGACGGGTTAGGTACAAGCTGGACGCAT

[0335] GAAAAAAATTGGAAAAAAGCGCATAATATCTTACTTCCAAGCTTTA

[0336] GTCAGCAGGCAATGAAAGGCTATCATGCGATGATGGTCGATACCGC

[0337] CGTGCAGCTTGTTCAAAAGTGGGAGCGTCTAAATGCAGATGAGCAT

[0338] ATTGAAGTATCGGAAGACATGACACGTTTAACGCTTGATACAATTG

[0339] GTCTTTGCGGCTTTAACTATCGCTTTAACAGCTTTTACCGAGATCAG

[0340] CCTCATCCATTTATTATAAGTATGGTCCGTGCACTGGATGAAGTAAT

[0341] GAACAAGCTGCAGCGAGCAAATCCAGACGACCCAGCTTATGATGA

[0342] AAACAAGCGCCAGTTTCAAGAAGATATCAAGGTGATGAACGACCT

[0343] AGTAGATAAAATTATTGCAGATCGCAAAGCAAGGGGTGAACAAAG

[0344] CGATGATTTTAACGCAGATGCTAAACGGAAAAGATCCAGAAACG

[0345] GGTGAGCCGCTTGATGACGAGAACATTCGCTATCAAATTATTACAT

[0346] TCTTAATTGCGGGACACGAAACAACAAGTGGTCTTTTATCATTTGCG

[0347] CTGTATTTCTTAGTGAAAAATCCACATGTTACAAAAAAGTAGCAG

[0348] AAGAAGCAGCACGAGTTCTAGTAGATCCTGTTCCAAGCTACAAACA

[0349] AGTCAAACAGCTTAAATATGTCGGCATGGTCTTAAACGAAGCGCTG

[0350] CGCTTATGGCCAATGTCTCCTGCGTTTTCCCTATGCAAAAGAAGA

[0351] TACGGTGCTTGGAGGAGAATATCCTTTAGAAAAAGGCGACGAAGTA

[0352] ATGGTTCTGATTCCTCAGCTTCACCGTGATAAAACAGTTTTGGGGAG

[0353] ACGATGTGGAGGAGTTCCGTCCAGAGCGTTTTGAAAATCCAAGTGC

[0354] GATTCCGCAGCATGCGTTTAAACCGTTTGGAAACGGTCAGCGTGCG

[0355] TGTATCGGTCAGCAGTTCGCTCTTCATGAAGCAACGCTGGTACTTGG

[0356] TATGATGCTAAAACACTTTGATTTTGAAGATCATACAAACTACGAG

[0357] CTCGATATTAAAGAAACTTTAACGTTAAAACCTAAAGGCTTT

[0358] DNA sequence of LSilOx6 [SEQ ID NO:6]

[0359] ACAATTAAAGAAATGCCTCAGCCAAAAACGTTTGGAGAGCTTAAAA

[0360] ATTTACCGTTATTAAACACAGATAAACCGGTTCAAGCTTTGATGAA

[0361] AATTGCGGGTGAATTAGGAGAAATCTTTAAATTCGAGGCGCCTGGT

[0362] CGTGTAACGCGCTACTTATCAAGTCAGCGTCTAATTAAAGAAGCAT

[0363] GCGATGAATCACGCTTTGATAAAAACTTAAGTCAAGCGCTTAAATT

[0364] TGCACGTGATTTTGTTGGAGACGGGTTAGGTACAAGCTGGACGCAT

[0365] GAAAAAAATTGGAAAAAAGCGCATAATATCTTACTTCCAAGCTTTA

[0366] GTCAGCAGGCAATGAAAGGCTATCATGCGATGATGGTCGATACCGC

[0367] CGTGCAGCTTGTTCAAAAGTGGGAGCGTCTAAATGCAGATGAGCAT

[0368] ATTGAAGTATCGGAAGACATGACACGTTTAACGCTTGATACAATTG

[0369] GTCTTTGCGGCTTTAACTATCGCTTTAACAGCCTTTACCGAGATCAG

[0370] CCTCATCCATTTATTATAAGTATGGTCCGTGCACTGGATGAAGTAAT

[0371] GAACAAGCTGCAGCGAGCAAATCCAGACGACCCAGCTTATGATGA

[0372] AAACAAGCGCCAGTTTCAAGAAGATATCAAGGTGATGAACGACCT

[0373] AGTAGATAAAATTATTGCAGATCGCAAAGCAAGGGGTGAACAAAG

[0374] CGATGATTTTAACGCAGATGCTAAACGGAAAAGATCCAGAAACG

[0375] GGTGAGCCGCTTGATGACGAGAACATTCGCTATCAAATTATTACAT

[0376] TCTTAATTGCGGGACACGAAACAACAAGTGGTCTTTTATCATTTGCG

[0377] CTGTATTTCTTAGTGAAAAATCCACATGTTACAAAAAAGTAGCAG

[0378] AAGAAGCAGCACGAGTTCTAGTAGATCCTGTTCCAAGCTACAAACA

[0379] AGTCAAACAGCTTAAATATGTCGGCATGGTCTTAAACGAAGCGCTG

[0380] CGCTTATGGCCAATGTCTCCTGCGTTTTCCCTATATGCAAAAGAAGA

[0381] TACGGTGCTTGGAGGAGAATATCCTTTAGAAAAAGGCGACGAAGTA

[0382] ATGGTTCTGATTCCTCAGCTTCACCGTGATAAAACAGTTTTGGGGAG

[0383] ACGATGTGGAGGAGTTCCGTCCAGAGCGTTTTGAAAATCCAAGTGC

[0384] GATTCCGCAGCATGCGTTTAAACCGTTTGGAAACGGTCAGCGTGCG

[0385] TGTATCGGTCAGCAGTTCGCTCTTCATGAAGCAACGCTGGTACTTGG

[0386] TATGATGCTAAAACACTTTGATTTTGAAGATCATACAAACTACGAG

[0387] CTCGATATTAAAGAAACTTTAACGTTAAAACCTAAAGGCTTT

[0388] DNA sequence of LSilOx7 [SEQ ID NO:7]

[0389] ACAATTAAAGAAATGCCTCAGCCAAAAACGTTTGGAGAGCTTAAAA

[0390] ATTTACCGTTATTAAACACAGATAAACCGGTTCAAGCTTTGATGAA

[0391] AATTGCGGGTGAATTAGGAGAAATCTTTAAATTCGAGGCGCCTGGT

[0392] CGTGTAACGCGCGTTTTATCAAGTCAGCGTCTAATTAAAGAAGCAT

[0393] GCGATGAATCACGCTTTGATAAAAACTTAAGTCAAGCGCTTAAATT

[0394] TGCACGTGATTTTGTTGGAGACGGGTTAGGTACAAGCTGGACGCAT

[0395] GAAAAAAATTGGAAAAAAGCGCATAATATCTTACTTCCAAGCTTTA

[0396] GTCAGCAGGCAATGAAAGGCTATCATGCGATGATGGTCGATACCGC

[0397] CGTGCAGCTTGTTCAAAAGTGGGAGCGTCTAAATGCAGATGAGCAT

[0398] ATTGAAGTATCGGAAGACATGACACGTTTAACGCTTGATACAATTG

[0399] GTCTTTGCGGCTTTAACTATCGCTTTAACAGCCTTTACCGAGATCAG

[0400] CCTCATCCATTTATTATAAGTATGGTCCGTGCACTGGATGAAATGAT

[0401] GAACAAGCTGCAGCGAGCAAATCCAGACGACCCAGCTTATGATGA

[0402] AAACAAGCGCCAGTTTCAAGAAGATATCAAGGTGATGAACGACCT

[0403] AGTAGATAAAATTATTGCAGATCGCAAAGCAAGGGGTGAACAAAG

[0404] CGATGATTTTAACGCAGATGCTAAACGGAAAAGATCCAGAAACG

[0405] GGTGAGCCGCTTGATGACGAGAACATTCGCTATCAAATTATTACAT

[0406] TCTTAATTGCGGGACACGAAACAACAAGTGGTCTTTTATCATTTGCG

[0407] CTGTATTTCTTAGTGAAAAATCCACATGTTACAAAAAAGTAGCAG

[0408] AAGAAGCAGCACGAGTTCTAGTAGATCCTGTTCCAAGCTACAAACA

[0409] AGTCAAACAGCTTAAATATGTCGGCATGGTCTTAAACGAAGCGCTG

[0410] CGCTTATGGCCAATGTCTCCTGCGTTTTCCCTATATGCAAAAGAAGA

[0411] TACGGTGCTTGGAGGAGAATATCCTTTAGAAAAAGGCGACGAAGTA

[0412] ATGGTTCTGATTCCTCAGCTTCACCGTGATAAAACAGTTTGGGGAG

[0413] ACGATGTGGAGGAGTTCCGTCCAGAGCGTTTTGAAAATCCAAGTGC

[0414] GATTCCGCAGCATGCGTTTAAACCGTTTGGAAACGGTCAGCGTGCG

[0415] TGTATCGGTCAGCAGTTCGCTCTTCATGAAGCAACGCTGGTACTTGG

[0416] TATGATGCTAAAACACTTTGATTTTGAAGATCATACAAACTACGAG

[0417] CTCGATATTAAAGAAACTTTAACGTTAAAACCTAAAGGCTTT

[0418] DNA sequence of CSilOx1 [SEQ ID NO:8]

[0419] ACAATTAAAGAAATGCCTCAGCCAAAAACGTTTGGAGAGCTTAAAA

[0420] ATTTACCGTTATTAAACACAGATAAACCGGTTCAAGCTTTGATGAA

[0421] AATTGCGGGTGAATTAGGAGAAATCTTTAAATTCGAGGCGCCTGGT

[0422] CGTGTAACGCGCTACTTATCAAGTCAGCGTCTAATTAAAGAAGCAT

[0423] GCGATGAATCACGCTTTGATAAAAACTTAAGTCAAGCGCTTAAATT

[0424] TGCACGTGATTTTGTTGGAGACGGGTTAGGTACAAGCTGGACGCAT

[0425] GAAAAAAGTTGGAAAAAAGCGCATAATATCTTACTTCCAAGCTTTA

[0426] GTCAGCAGGCAATGAAAGGCTATCATGCGATGATGGTCGATACCGC

[0427] CGTGCAGCTTGTCAAAAGTGGGAGCGTCTAAATGCAGATGAGCAT

[0428] ATTGAAGTATCGGAAGACATGACACGTTTAACGCTTGATACAATTG

[0429] GTCTTTGCGGCTTTAACTATCGCTTTAACAGCTTTTACCGAGATCAG

[0430] CCTCATCCATTTATTATAAGTATGGTCCGTGCACTGGATGAAGTAAT

[0431] GAACAAGCTGCAGCGAGCAAATCCAGACGACCCAGCTTATGATGA

[0432] AAACAAGCGCCAGTTTCAAGAAGATATCAAGGTGATGAACGGCCT

[0433] AGTAGATAAAATTATTGCAGATCGCAAAGCAAGGGGTGAACAAAG

[0434] CGATGATTTTAACGCAGATGCTAAACGGAAAAGATCCAGAAACG

[0435] GGTGAGCCGCTTGATGACGAGAACATTCGCTATCAAATTATTACAT

[0436] TCTTAATTGCGGGACACGAAACAACAAGTGGTCTTTTATCATTTGCG

[0437] CTGTATTTCTTAGTGAAAAATCCACACGTATTACAAAAAGTAGCAG

[0438] AAGAAGCAGCACGAGTTCTAGTAGATCCTGTTCCAAGCTACAAACA

[0439] AGTCAAACAGCTTAAATATGTCGGCATGGTCTTAAACGAAGCGCTG

[0440] CGCTTATGGCCAATGTCTCCTGCGTTTTCCCTATATGCAAAAGAAGA

[0441] TACGGTGCTTGGAGGAGAATATCCTTTAGAAAAAGGCGACGAAGTA

[0442] ATGGTTCTGATTCCTCAGCTTCACCGTGATAAAACAGTTTGGGGAG

[0443] ACGATGTGGAGGAGTTCCGTCCAGAGCGTTTTGAAAATCCAAGTGC

[0444] GATTCCGCAGCATGCGTTTAAACCGTTTGGAAACGGTCAGCGTGCG

[0445] TGTATCGGTCAGCAGTTCGCTCTTCATGAAGCAACGCTGGTACTTGG

[0446] TATGATGCTAAAACACTTTGATTTTGAAGATCATACAAACTACGAG

[0447] CTCGATATTAAAGAAACTTTATCGTTAAAACCTAAAGGCTTT

[0448] DNA sequence of CSilOx2 [SEQ ID NO:9]

[0449] ACAATTAAAGAAATGCCTCAGCCAAAAACGTTTGGAGAGCTTAAAA

[0450] ATTTACCGTTATTAAACACAGATAAACCGGTTCAAGCTTTGATGAA

[0451] AATTGCGGGTGAATTAGGAGAAATCTTTAAATTCGAGGCGCCTGGT

[0452] CGTGTAACGCGCTACTTATCAAGTCAGCGTCTAATTAAAGAAGCAT

[0453] GCGATGAATCACGCTTTGATAAAAACTTAGGTCAAGCGCTTAAATT

[0454] TGCACGTGATTTTGTTGGAGACGCGTTTAGGTACAAGCTGGACGCAT

[0455] GAAAAAAGTTGGAAAAAGCGCATAATATCTTACTTCCAAGCTTTA

[0456] GTCAGCAGGCAATGAAAGGCTATCATGCGATGATGGTCGATACCGC

[0457] CGTGCAGCTTGTTCAAAAGTGGGAGCGTCTAAATGCAGATGAGCAT

[0458] ATTGAAGTATCGGAAGACATGACACGTTTAACGCTTGATACAATTG

[0459] GTCTTTGCGGCTTTTAACTATCGCTTTAAACAGCTTTTACCGAGATCAG

[0460] CCTCATCCATTTATTATAAGTATGGTCCGTGCACTGGATGAAGTAAT

[0461] GAACAAGCTGCAGCGAGCAAATCCAGACGACCCAGCTTATGATGA

[0462] AAACAAGCGCCAGTTTCAAGAAGATATCAAGGTGATGAACGGCCT

[0463] AGTAGATAAAATTATTGCAGATCGCAAAGCAAGGGGTGAACAAAG

[0464] CGATGATTTATTAACGCAGATGCTAAACGGAAAAGATCCAGAAACG

[0465] GGTGAGCCGCTTGATGACGAGAACATTCGCTATCAAATTATTACAT

[0466] TCTTAATTGCGGGACACGAAACAACAAGTGGTCTTTTATCATTTGCG

[0467] CTGTATTTCTTAGTGAAAAATCCACACGTATTACAAAAAGTAGCAG

[0468] AAGAAGCAGCACGAGTTCTAGTAGATCCTGTTCCAAGCTACAAACA

[0469] AGTCAAACAGCTTAAATATGTCGGCATGGTCTTAAACGAAGCGCTG

[0470] CGCTTATGGCCAATGTCTCCTGCGTTTTCCCTATATGCAAAAGAAGA

[0471] TACGGTGCTTGGAGGAGAATATCCTTTAGAAAAAGGCGACGAAGTA

[0472] ATGGTTCTGATTCCTCAGCTTCACCGTGATAAAACAGTTTGGGGAG

[0473] ACGATGTGGAGGAGTTCCGTCCAGAGCGTTTTGAAAATCCAAGTGC

[0474] GATTCCGCAGCATGCGTTTAAACCGTTTGGAAACGGTCAGCGTGCG

[0475] TGTATCGGTCAGCAGTTCGCTCTTCATGAAGCAACGCTGGTACTTGG

[0476] TATGATGCTAAAACACTTTGATTTTGAAGATCATACAAACTACGAG

[0477] CTCGATATTAAAGAAACTTTATCGTTAAAACCTAAAGGCTTT

[0478] DNA sequence of CSilOx3 [SEQ ID NO:10]

[0479] ACAATTAAAGAAATGCCTCAGCCAAAAACGTTTGGAGAGCTTAAAA

[0480] ATTTACCGTTATTAAACACAGATAAACCGGTTCAAGCTTTGATGAA

[0481] AATTGCGGGTGAATTAGGAGAAATCTTTAAATTCGAGGCGCCTGGT

[0482] GGTGTAACGCGCTACTTATCAAGTCAGCGTCTAATTAAAAGAAGCAT

[0483] GCGATGAATCACGCTTTGATAAAAAACTTAGGTCAAGCGCTTAAATT

[0484] TGCACGTGATTTTGTTGGAGACGCGTTTAGGTACAAGCTGGACGCAT

[0485] GAAAAAAGTTGGAAAAAGCGCATAATATCTTACTTCCAAGCTTTA

[0486] GTCAGCAGGCAATGAAAGGCTATCATGCGATGATGGTCGATACCGC

[0487] CGTGCAGCTTGTTCAAAAGTGGGAGCGTCTAAATGCAGATGAGCAT

[0488] ATTGAAGTATCGGAAGACATGACACGTTTAACGCTTGATACAATTG

[0489] GTCTTTGCGGCTTTTAACTATCGCTTTAAACAGCTTTTACCGAGATCAG

[0490] CCTCATCCATTTATTATAAGTATGGTCCGTGCACTGGATGAAGTAAT

[0491] GAACAAGCTGCAGCGAGCAAATCCAGACGACCCAGCTTATGATGA

[0492] AAACAAGCGCCAGTTTCAAGAAGATATCAAGGTGATGAACGGCCT

[0493] AGTAGATAAAATTATTGCAGATCGCAAAGCAAGGGGTGAACAAAG

[0494] CGATGATTTATTAACGCAGATGCTAAACGGAAAAGATCCAGAAACG

[0495] GGTGAGCCGCTTGATGACGAGAACATTCGCTATCAAATTATTACAT

[0496] TCTTAATTGCGGGACACGAAACAACAAGTGGTCTTTTATCATTTGCG

[0497] CTGTATTTCTTAGTGAAAAATCCACACGTATTACAAAAAGTAGCAG

[0498] AAGAAGCAGCACGAGTTCTAGTAGATCCTGTTCCAAGCTACAAACA

[0499] AGTCAAACAGCTTAAATATGTCGGCATGGTCTTAAACGAAGCGCTG

[0500] CGCTTATGGCCAATGTCTCCTGCGTTTTCCCTATATGCAAAAGAAGA

[0501] TACGGTGCTTGGAGGAGAATATCCTTTAGAAAAAGGCGACGAAGTA

[0502] ATGGTTCTGATTCCTCAGCTTCACCGTGATAAAACAGTTTGGGGAG

[0503] ACGATGTGGAGGAGTTCCGTCCAGAGCGTTTTGAAAATCCAAGTGC

[0504] GATTCCGCAGCATGCGTTTAAACCGTTTGGAAACGGTCAGCGTGCG

[0505] TGTATCGGTCAGCAGTTCGCTCTTCATGAAGCAACGCTGGTACTTGG

[0506] TATGATGCTAAAACACTTTGATTTTGAAGATCATACAAACTACGAG

[0507] CTCGATATTAAAGAAACTTTATCGTTAAAACCTAAAGGCTTT

[0508] DNA sequence of NSS005 [SEQ ID NO:11]

[0509] AACTTTAAGAAGGAGATATACATATGACAATTAAAGAAATGCCTCAGCCA

[0510] DNA sequence of NSS007 [SEQ ID NO:12]

[0511] TGGCTGAGGCATTTCTTTAATTGTCATATGTATATCTCCTTCTTAAAGTT

[0512] DNA sequence of HR1-V2 [SEQ ID NO:13]

[0513] CTTTTTTAGCAGACTGTTCAGTGCTAGGTGAAGGAATACC

[0514] DNA sequence of HF1-V2 [SEQ ID NO:14]

[0515] GGTATTCCTTCACCTAGCACTGAACAGTCTGCTAAAAAAG

[0516] DNA sequence of Amp_int_forward [SEQ ID NO:15]

[0517] GCTAACCGCTTTTTTGCACAACATG

[0518] DNA sequence of Amp_int_reverse [SEQ ID NO:16]

[0519] TTGTGCAAAAAAGCGGTTAGCTCC

Claims

1. A method for preparing an organosilicon compound having at least one silicon-bonded methanol group and / or at least one silanol group, the method comprising: A reaction mixture is prepared by combining a cytochrome P450 variant, an initial organosilicon compound having at least one silicon-bonded hydrocarbon group, and a cofactor, wherein the cytochrome P450 variant promotes the oxidation of the silicon-bonded hydrocarbon group to a silicon-bonded methanol or silanol group in the presence of an oxidant; and The reaction mixture is exposed to an oxidant to oxidize the silicon-bonded hydrocarbon groups and convert the silicon-bonded hydrocarbon groups into silicon-bonded methanol groups or silicon-bonded silanol groups, thereby preparing the organosilicon compound having at least one silicon-bonded methanol group and / or at least one silanol group.

2. The method of claim 1, wherein the cytochrome P450 variant comprises the nucleic acid sequence of SEQ ID NO:1 or a conserved modified variant thereof.

3. The method of claim 1, wherein the cytochrome P450 variant comprises the nucleic acid sequence of SEQ ID NO:1 or a conserved variant thereof, the conserved variant having a mutation relative to the nucleic acid sequence of SEQ ID NO:1 of at least one of T328, A329, D35, I123, G253, F329, F166, Y52, V185, N96, D215, T439, S73, G86 or R48.

4. The method of claim 3, wherein the cytochrome P450 variant comprises, relative to the nucleic acid sequence of SEQ ID NO: 1, (i) T328M mutation; (ii) A329F mutation; (iii) D35G mutation; (iv) I123T mutation; (v) G253E mutation; (vi) F329S mutation; (v) F166L mutation; (vi) Y52V mutation; (vii) V185M mutation; (viii) N96S mutation; (ix) D215G mutation; (x) T439S mutation; (xi) S73G mutation; (xii) G86A mutation; (xiii) R48G mutation; or any combination of (xiv) (i)-(xiii).

5. The method according to claim 1, wherein: (i) the cytochrome P450 variant comprises the nucleic acid sequence of SEQ ID NO:2 or a conserved modified variant thereof; or (ii) the cytochrome P450 variant comprises the nucleic acid sequence of SEQ ID NO:3 or a conserved modified variant thereof; or (iii) the cytochrome P450 variant comprises the nucleic acid sequence of SEQ ID NO:4 or a conserved modified variant thereof; or (iv) the cytochrome P450 variant comprises the nucleic acid sequence of SEQ ID NO:5 or a conserved modified variant thereof; or (v) the cytochrome P450 variant comprises the nucleic acid sequence of SEQ ID NO:6 or a conserved modified variant thereof; or (vi) the cytochrome P450 variant comprises the nucleic acid sequence of SEQ ID NO:7 or a conserved modified variant thereof; or (vii) the cytochrome P450 variant comprises the nucleic acid sequence of SEQ ID NO:8 or a conserved modified variant thereof; or (viii) the cytochrome P450 variant comprises the nucleic acid sequence of SEQ ID NO:9 or a conserved modified variant thereof; or (ix) the cytochrome P450 variant comprises the nucleic acid sequence of SEQ ID NO:10 or a conserved modified variant thereof.

6. The method according to any of the preceding claims, wherein the cytochrome P450 variant comprises a non-natural heme cofactor.

7. The method according to any preceding claim, wherein preparing the reaction mixture comprises combining the initial organosilicon compound with a host cell or non-human body expressing the cytochrome P450 variant, its lysate, its purified protein, or its lyophilized form.

8. The method of claim 6, wherein the host cell or non-human object is further defined as an Escherichia coli cell.

9. The method according to any of the preceding claims, wherein the initial organosilicon compound does not contain silicon-bonded methanol groups.

10. The method according to any preceding claim, wherein the initial organosilicon compound has a general formula (I) or (II) or (III): (R 1 2SiO 2 / 2 ) n (I) R 1 3Si(O-SiR 1 2) m R 1 (II) R 1 3Si-(D-SiR 1 2) m R 1 (III) Each R 1 It is an independently chosen unsubstituted hydrocarbon group or H, provided that there is at least one R. 1 It is a hydrocarbon group, with subscript n ranging from 3 to 8 and subscript m ranging from 0 to 15, and each D is an independently chosen divalent linker.

11. The method of claim 9, wherein each R 1 Independently selected from alkyl groups, alkenyl groups, aryl groups, and hydrogen, provided that at least one R 1 It is an alkyl group, an alkenyl group, or an aryl group.

12. The method according to any of the preceding claims, wherein the reaction mixture further comprises: (i) a carrier medium; (ii) a buffer solution; or (iii) both a carrier medium and a buffer solution.

13. A method for preparing a reaction product, the method comprising: A reaction mixture was prepared by combining a cytochrome P450 variant with an initial organosilicon compound having at least one silicon-bonded hydrocarbon group, the cytochrome P450 variant promoting the oxidation of the silicon-bonded hydrocarbon group to a functional group selected from silicon-bonded methanol or silanol groups in the presence of an oxidant. The reaction mixture is exposed to an oxidizing agent to oxidize the silicon-bonded hydrocarbon groups and convert the silicon-bonded hydrocarbon groups into the functional groups to obtain an organosilicon compound having the functional groups. as well as The reaction product is prepared by reacting the functional group of the organosilicon compound with a group that reacts with the functional group of the organosilicon compound.

Images