Yarrowia lipolytica engineering bacterium and application thereof in preparation of sclareol
By modifying the engineered strain of Yeast lipolyticis, strengthening the MVA pathway and enhancing the supply of acetyl-CoA, the problems of complex process and high cost in the production of perillaldehyde were solved, and efficient synthesis of perillaldehyde was achieved, laying the foundation for biosynthesis.
Patent Information
- Application Number
- CN202511140006.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-14
- Publication Date
- 2025-11-21
AI Technical Summary
The existing production methods of perillaldehyde are greatly affected by seasonality, have complex processes and high costs, and the chemical synthesis process is complicated and produces many byproducts, which limits its large-scale production.
By modifying the engineered strain of *Yamylostella lipolytica*, overexpressing the lysine pyrophosphate diol synthase gene (SsLPPS) and the perillyl alcohol synthase gene (SsSCS), the mevalonate pathway (MVA) and the pentenyl pyrophosphate pathway are enhanced, thereby increasing the supply of acetyl-CoA and reducing the production of byproduct fats, thus achieving the efficient synthesis of perillyl alcohol.
High-yield ambergris alcohol was achieved in *Aristolochia lipophila*, with a shake flask yield of 1.5 g/L, providing a biosynthetic basis for high-value ambergris compounds.
Smart Images
Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of genetic engineering and bioengineering, in particular to an engineered Yarrowia lipolytica and application thereof in preparation of sclareol. BACKGROUND
[0002] Sclareol, also known as sclareol, is a halichondrill-type diterpene ditrepenoid compound, mainly existing in plants such as Salvia sclarea, and is often used as a perfume ingredient of cosmetics and perfumes and a food flavoring material. It is the only practical natural substitute for the chemical synthesis of ambergris, and therefore, sclareol has high economic value. The main way to obtain sclareol is to extract it from plants, but the plant extraction method is greatly affected by seasonality, and the process is complex, the production cost is high, and the yield is low. Although the yield of sclareol can be increased by chemical synthesis at present, the production process is complex, a large amount of organic solvent is used, and many by-products are produced, which limits its large-scale production. In contrast, the microbial fermentation method for synthesizing sclareol has the advantage of being more green and environmentally friendly.
[0003] Yarrowia lipolytica is a typical unconventional oleaginous yeast, which has a complete genetic manipulation tool, is salt-tolerant, low-temperature-tolerant, and can grow in a low-pH environment. In terms of metabolism, it has the advantages of being able to utilize glucose, waste edible oil, ethanol, glycerol and other substrates for growth, and is an excellent chassis cell for synthesizing natural products. Secondly, it has a high-throughput tricarboxylic acid (TCA) cycle, which provides abundant acetyl-CoA and other key precursors for the synthesis of terpenoids, and its endogenous MVA pathway can produce isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP), which is an ideal host for producing sclareol. SUMMARY
[0004] In view of the above-mentioned shortcomings of the prior art, the purpose of the present application is to provide an engineered Yarrowia lipolytica and application thereof in preparation of sclareol, to solve the problems in the prior art.
[0005] To achieve the above object and other related objects, the present application provides a Yarrowia lipolytica engineering strain, wherein SsLPPS, SsSCS and nucleotides encoding polypeptide interaction tags RIAD and RIDD are included, the Yarrowia lipolytica engineering strain overexpresses MVA pathway key genes and GGPP synthesis related genes, the MVA pathway key genes are selected from any one or more of erg8, erg10 and erg20, the GGPP synthesis related genes are selected from tPaGGPPS and / or SsGGPPS, and the promoter of the erg9 gene of the Yarrowia lipolytica engineering strain is a truncated promoter with a length of 40-110 bp.
[0006] The present application also provides a construction method of the Yarrowia lipolytica engineering strain, which comprises integrating SsLPPS, SsSCS and nucleotides encoding polypeptide interaction tags RIAD and RIDD into a starting strain, overexpressing MVA pathway key genes and GGPP synthesis related genes in the starting strain, the MVA pathway key genes are selected from any one or more of erg8, erg10 and erg20, the GGPP synthesis related genes are selected from tPaGGPPS and / or SsGGPPS, and the promoter of the erg9 gene in the starting strain is truncated to 40-110 bp.
[0007] The present application also provides the use of the Yarrowia lipolytica engineering strain in the preparation of sclareol or a derivative thereof.
[0008] The present application also provides a preparation method of sclareol, which comprises culturing the Yarrowia lipolytica engineering strain and extracting the fermentation broth to obtain the sclareol.
[0009] As described above, the Yarrowia lipolytica engineering strain and the use thereof in the preparation of sclareol have the following beneficial effects: taking Yarrowia lipolytica PO1f as a host, by expressing pyrophosphate lysadalenediol ester synthase gene (SsLPPS) and sclareol synthase gene (SsSCS), by strengthening and modifying the MVA pathway, high yield of sclareol is achieved. Then by strengthening the supply of acetyl coenzyme A, improving the level of intracellular reducing power, and weakening the generation of byproduct fat, high-efficiency synthesis of sclareol in Yarrowia lipolytica is achieved, and the final yield in a shake flask reaches 1.5 g / L. The present application integrates a plant heterologous metabolic pathway into Yarrowia lipolytica to achieve high yield of sclareol, and lays a foundation for subsequent biosynthesis of high-value ambergris compounds. BRIEF DESCRIPTION OF DRAWINGS
[0010] Figure 1 A metabolic schematic diagram showing heterologous synthesis of sclareol in the Yarrowia lipolytica engineering strain.
[0011] Figure 2Gas chromatogram of amorphadiene produced by the engineered strain of Example 5 in YPD culture.
[0012] Figure 3 Verification gel showing the final construction of engineered strain St238. DETAILED DESCRIPTION
[0013] The present application provides an engineered Yarrowia lipolytica, which comprises a pyrophosphate lythidene diphosphate synthase gene (SsLPPS), a sclareol synthase gene (SsSCS), and nucleotides encoding polypeptide interaction tags RIAD and RIDD, overexpresses key genes of the MVA pathway selected from any one or more of erg8, erg10, and erg20, and overexpresses GGPP synthesis related genes selected from tPaGGPPS and / or SsGGPPS, and wherein the promoter of the erg9 gene of the engineered Yarrowia lipolytica is a truncated promoter with a length of 40-110 bp.
[0014] In some embodiments of the present application, the engineered Yarrowia lipolytica is based on Yarrowia lipolytica PO1f.
[0015] In one embodiment, the SsLPPS and SsSCS are expressed via a plasmid, or are integrated on the genome.
[0016] In some embodiments of the present application, the SsLPPS, SsSCS, and / or nucleotides encoding polypeptide interaction tags RIAD and RIDD are integrated into the D17 site on the genome of Yarrowia lipolytica PO1f.
[0017] In some embodiments of the present application, the SsLPPS and SsSCS have independent reading frames. In some embodiments of the present application, the promoter in the reading frame is selected from Tefin, and / or the terminator is selected from XPR2.
[0018] In some embodiments of the present application, the engineered Yarrowia lipolytica comprises the following reading frames: TEFin -SsLPPS-T XPR2 -P TEFin -ScSCS-T XPR2 The engineered Yarrowia lipolytica is referred to as St200.
[0019] In some embodiments of the present application, the nucleotide encoding the polypeptide interaction tag RIDD is linked to SsLPPS, preferably, the N-terminus of SsLPPS. And / or, the nucleotide encoding the polypeptide interaction tag RADD is linked to ScSCS, preferably, the N-terminus of ScSCS.
[0020] Preferably, the nucleotide encoding the polypeptide interaction tag is linked to SsLPPS or ScSCS by a linker peptide selected from any one of GGGGSGGGGS, GSGSGSGS, GSGGSG.
[0021] In some embodiments of the present application, the engineered Yarrowia lipolytica strain comprises the following reading frames: TEFin -SsLPPS-GSGSGSGS-ridd-T XPR2 -P TEFin -ScSCS-GSGSGSGS-radd-T XPR2 The engineered Yarrowia lipolytica strain is named St205.
[0022] RIDD is a polypeptide of 44 amino acids derived from cAMP-dependent protein kinase A, and RIAD is a polypeptide of 18 amino acids derived from the kinase A anchoring protein. RIDD spontaneously forms a dimer stable under physiological conditions, and RIAD further binds to the RIDD dimer to form a stable trimer structure. By fusing and expressing this pair of polypeptide tags on the target protein, the in vitro and in vivo assembly of two enzymes can be achieved. This system has the following advantages: 1) the polypeptide tags are short, reducing the impact on the activity of the enzyme itself; 2) the affinity is high, which can ensure the integrity of the enzyme complex; 3) the enzyme assembly can be performed at a ratio of 2:1; 4) different expression intensities of enzymes can be spatially assembled without changing the structure of the enzyme; 5) specific and efficient binding, and stable under physiological conditions.
[0023] In some embodiments of the present application, the MVA pathway key genes tHMG1 and IDI1 are integrated into the E1 site of the Yarrowia lipolytica PO1f genome. The MVA pathway key genes erg8, erg10, and erg20 are integrated into the AXP site of the Yarrowia lipolytica PO1f genome.
[0024] Each of the MVA pathway key genes has an independent reading frame.
[0025] In some embodiments of the present application, the length of the promoter of the erg9 gene is 40-50 bp, 50-60 bp, 60-70 bp, 70-80 bp, 80-90 bp, 90-100 bp, 100-110 bp.
[0026] In some embodiments of the present application, the nucleotide sequence of the promoter of the erg9 gene is as shown in SEQ ID NO. 25 or 26.
[0027] In some embodiments of the present application, the engineered Yarrowia lipolytica further comprises the following reading frame: P TEFin -tHMG1-T XPR2 -P TEFin -IDI1-T XPR2 In some embodiments of the present application, the engineered Yarrowia lipolytica further comprises the following reading frame: P TEFin -erg20-T XPR2 -P TEFin -erg8-T XPR2 -P TEFin -erg10-T XPR2 In some embodiments of the present application, the engineered Yarrowia lipolytica is named St206.
[0028] In some embodiments of the present application, the GGPP synthesis related genes are integrated into the F1-3 site on the PO1f genome of Yarrowia lipolytica.
[0029] In some embodiments of the present application, the GGPP synthesis related genes tPaGGPPS and / or SsGGPPS have independent reading frames.
[0030] In some embodiments of the present application, the engineered Yarrowia lipolytica further comprises the following reading frame: P TEFin -tPaGGPPS-T XPR2 -P TEFin -SsGGPPS-T XPR2 In some embodiments of the present application, the engineered Yarrowia lipolytica is named St208.
[0031] In some embodiments of the present application, the promoter of the erg9 gene is truncated to 50 bp or 100 bp based on St208, and the engineered Yarrowia lipolytica is named St210.
[0032] In some embodiments of the present application, the Yarrowia lipolytica engineered strain overexpresses the key genes of acetyl-CoA pathway. The key genes of acetyl-CoA pathway are selected from any one or more of pyruvate dehydrogenase PDH, acetyl-CoA synthase acsl, CAT2.
[0033] Each of the key genes of acetyl-CoA pathway has an independent reading frame.
[0034] In some embodiments of the present application, the key genes of acetyl-CoA pathway are integrated into the E12 site.
[0035] In some embodiments of the present application, the Yarrowia lipolytica engineered strain further comprises the following reading frame: P TEFin - acsl-T XPR2 -P TEFin - PDH-T XPR2 -P TEFin - CAT2-T XPR2 at the E12 site based on St210, and the Yarrowia lipolytica engineered strain is referred to as St212.
[0036] In some embodiments of the present application, the Yarrowia lipolytica engineered strain overexpresses the genes for enhancing intracellular reducing power. The genes for enhancing intracellular reducing power are selected from any one or more of zwf, overexpression of malic enzyme mael, isocitrate dehydrogenase IDH, POT1. The genes for enhancing intracellular reducing power are also the key genes in the phosphogluconate pathway.
[0037] Each of the genes for enhancing intracellular reducing power has an independent reading frame.
[0038] In some embodiments of the present application, the genes for enhancing intracellular reducing power are integrated into the Al 1 site and / or the D8 site.
[0039] In some embodiments of the present application, the Yarrowia lipolytica engineered strain further comprises the following reading frame: P TEFin - zwf-T XPR2 -P TEFin - mael-T XPR2, the following reading frame: P TEFin - IDH-T XPR2 -P TEFin - POT1-T XPR2 at the Al 1 site based on St212, and the Yarrowia lipolytica engineered strain is referred to as St216.
[0040] In some embodiments of the present application, the engineered Yarrowia lipolytica strain has low expression of genes involved in lipid synthesis; preferably, low expression of genes involved in triacylglycerol synthesis. The genes involved in lipid synthesis are selected from any one or more of DGA1, DGA2, FAA1, or FAS1.
[0041] The low expression is relative to the starting strain.
[0042] In some embodiments of the present application, the engineered Yarrowia lipolytica strain has low expression of DGA1, DGA2, FAA1, and FAS1 genes based on St216, and the engineered Yarrowia lipolytica strain is referred to as St225.
[0043] In some embodiments of the present application, the engineered Yarrowia lipolytica strain has 2-5 copies of SsLPPS, SsSCS, and / or nucleotides encoding polypeptide interaction tags RIAD and RIDD.
[0044] In some embodiments of the present application, the engineered Yarrowia lipolytica strain has SsLPPS, SsSCS, and / or nucleotides encoding polypeptide interaction tags RIAD and RIDD at the C12 site, the C3 site, the D4 site, and / or the F1 site.
[0045] In some embodiments of the present application, the engineered Yarrowia lipolytica strain has the following expression cassettes at the C12 site, the C3 site, the D4 site, and / or the F1 site based on St225:
[0046] P TEFin -SsLPPS-GSGSGSGS-ridd-T XPR2 -P TEFin -ScSCS-GSGSGSGS-radd-T XPR2 .
[0047] The present application also provides a method for constructing the engineered Yarrowia lipolytica strain, which comprises integrating SsLPPS, SsSCS, and nucleotides encoding polypeptide interaction tags RIAD and RIDD into a starting strain, overexpressing key genes of the MVA pathway and GGPP synthesis-related genes in the starting strain, the key genes of the MVA pathway being selected from any one or more of erg8, erg10, and erg20, the GGPP synthesis-related genes being selected from tPaGGPPS and / or SsGGPPS, and truncating the promoter of the erg9 gene in the starting strain to 40-110 bp.
[0048] In some embodiments of the present application, the method for constructing further comprises any one or more of the following features:
[0049] 1) overexpressing key genes of the acetyl-CoA pathway, preferably, the key genes of the acetyl-CoA pathway are selected from any one or more of PDH, acsl, CAT2;
[0050] 2) overexpressing genes for enhancing intracellular reducing power, preferably, the genes for enhancing intracellular reducing power are selected from any one or more of zwf, mael, IDH or POT1.
[0051] 3) knocking down genes involved in oil synthesis; preferably, the genes involved in oil synthesis are selected from any one or more of DGA1, DGA2, FAA1 or FAS1.
[0052] The application also provides use of the engineered Yarrowia lipolytica in the preparation of sclerol or derivatives thereof.
[0053] The metabolic diagram of heterologous synthesis of sclerol in the engineered Yarrowia lipolytica is shown in Figure 1 The MVA pathway of the engineered Yarrowia lipolytica for synthesizing sclerol mainly includes the following steps and key enzymes:
[0054] 1) generation of acetyl-CoA: acetyl-CoA is the starting material of the MVA pathway, and the content of acetyl-CoA can be increased by enhancing the key genes of the acetyl-CoA pathway, such as PDH, ACS1, citrate synthase CIT1 and CAT2, thereby improving the synthesis efficiency of sclerol;
[0055] 2) synthesis of mevalonate: acetyl-CoA is catalyzed by acetyl-CoA acetyltransferase (ERG10) to form acetyl-CoA acetyltransferase, and then 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) is generated under the action of HMG-CoA synthase (ERG13). Subsequently, HMG-CoA is reduced to mevalonate under the catalysis of HMG-CoA reductase (tHMG1).
[0056] 3) generation of isopentenyl pyrophosphate and dimethylpropenyl pyrophosphate: mevalonate is phosphorylated to mevalonate phosphate under the catalysis of mevalonate kinase (ERG12), and is converted to isopentenyl pyrophosphate (IPP) by phosphopantetheinylase (ERG13), and IPP is isomerized to dimethylpropenyl pyrophosphate (DMAPP) under the action of isopentenyl pyrophosphate isomerase (IDI);
[0057] 4) geranylgeranyl pyrophosphate (GGPP) formation: IPP and DMAPP polymerize to form GGPP catalyzed by heterologous tPaGGPPS, or, IPP and DMAPP polymerize to form geranyl pyrophosphate (GPP) and farnesyl pyrophosphate (FPP) catalyzed by farnesyl pyrophosphate synthase (ERG20), FPP can further form geranylgeranyl pyrophosphate (GGPP) under the action of SsGGPPS, GGPP is a direct precursor of sclareol.
[0058] 5) sclareol synthesis: GGPP catalyzed by sclareol synthase (SCS) through a series of enzymatic reactions, including cyclization, rearrangement, reduction, etc., to finally form sclareol.
[0059] The present application also provides a preparation method of sclareol, comprising culturing the engineered Yarrowia lipolytica, and extracting the fermentation broth to obtain the sclareol.
[0060] In some embodiments of the present application, the culturing method comprises any one or more of the following:
[0061] 1) the culturing temperature is 28-30℃;
[0062] 2) the culturing time is 72-96h;
[0063] 3) the culture medium is YPD medium.
[0064] The YPD medium comprises 18-35g / L of proteose peptone, 8-25g / L of yeast extract, 18-60g / L of glucose, and water, based on the total volume of the medium.
[0065] Other advantages and effects of the present application can be easily understood by those skilled in the art from the disclosure of the present specification. The present application can also be implemented or applied by means of other different specific embodiments, and various modifications or changes can be made to the details in the present specification based on different viewpoints and applications, without departing from the spirit of the present application.
[0066] Before further describing the specific embodiments of the present application, it should be understood that the scope of protection of the present application is not limited to the following specific embodiments; it should also be understood that the terms used in the embodiments of the present application are used to describe the specific embodiments, rather than to limit the scope of protection of the present application; in the specification and claims of the present application, the singular forms "a", "an" and "the" include the plural forms, unless otherwise explicitly stated in the text.
[0067] When the embodiments give numerical ranges, it is understood that unless the embodiments expressly contradict, every numerical range's two endpoints, and any number that falls between the two endpoints, can be elected. Unless otherwise defined, all technical and scientific terms used in the present application have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Except in the Examples, or where otherwise explicitly indicated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Any method, device, material, or the like that is similar in principle to those described in the Examples and otherwise consistent with the present application can be employed in the practice of the present application, unless the context clearly indicates otherwise.
[0068] Materials and methods used in the embodiments are as follows:
[0069] (I) Culture medium
[0070] LB medium: Tryptone 10 g / L, Yeast extract 5 g / L, NaCl 10 g / L. Add 20 g / L agar powder to prepare LB solid medium.
[0071] YNB medium: Yeast Nutrition Base 67.4 g / L, Glucose 20 g / L, Amino acid (5 g / L Uracil, 10 g / L Leucine, appropriate amino acid is deleted as needed).
[0072] YPD medium: Tryptone 20 g / L, Yeast extract 10 g / L, Glucose 20 g / L, pH natural.
[0073] (II) Preparation of Yarrowia lipolytica competence: Yarrowia lipolytica competence was prepared using Frozen-EZ Yeast Transformation II transformation kit, 30°C, and 10 mL YPD medium was used to culture Yarrowia lipolytica bacteria to the middle order (OD 600 = 0.8-1.0). The following steps were carried out at room temperature.
[0074] 1. Centrifuge the cells at 3500 rpm for 5 min, and aspirate the supernatant;
[0075] 2. Add 10 mL of EZ1 solution to wash the precipitate, and centrifuge the precipitated cells again, and aspirate the supernatant;
[0076] 3. Add 1 mL of EZ2 solution to resuspend the precipitated cells.
[0077] (III) Transformation of Yarrowia lipolytica:
[0078] 1. Mix 50 μL of competent cells with 0.2-1 μg of DNA (volume less than 5 μl); add 500 μL of EZ3 solution and mix thoroughly;
[0079] 2. Incubate at 30°C for 45 min, and vortex 2-3 times to mix.
[0080] 3. Take 50-150 μL of the transformation mixture and place it on a suitable auxotrophic plate.
[0081] 4. Incubate the plate at 30°C for 3 days to obtain the transformants.
[0082] (Four) Extraction of Sclareol: Take 1 mL of the fermentation broth and mix it with an equal volume of dodecane solution. Shake well, centrifuge to collect the supernatant, and filter it for gas chromatography.
[0083] (Five) Gas Chromatography Determination of Sclareol: Use Agilent gas chromatography for determination. Use external standard method for detection, and purchase the standard product from Aldrin, which has a content of more than 99.5%. Detection conditions: chromatographic column: Agilent DB-5 30m*0.25mm, 0.25μm, column flow rate: 1.0 mL / min, injection port temperature: 250°C, FID temperature: 300°C, split ratio: 10:1, injection volume: 1 μL, temperature program: initial temperature 100°C, increase to 300°C at a rate of 20°C / min, maintain for 5 min. Configure standard curve concentrations: 50 mg / L, 100 mg / L, 300 mg / L, 800 mg / L, 1000 mg / L, 1500 mg / L, 2000 mg / L. Draw the standard curve, y=1.5728x, R 2 = 0.9998.
[0084] (Six) Strain information is shown in Table 1.
[0085] Table 1 Strains involved in the present application
[0086]
[0087] Example 1 Construction of a recombinant Yarrowia lipolytica strain with high yield of Sclareol
[0088] The neutral site D17 of the strain Po1f was selected as the integration site of the key genes of the initial pathway for integrating shizukolanol. The synthesized SsLPPS and ScSCS sequences (nucleotide sequences are shown as SEQ ID NO. 12 and SEQ ID NO. 13) were used as templates to construct an expression frame with the promoter Tefin promoter (nucleotide sequence is shown as SEQ ID NO. 14) and XPR2 terminator (nucleotide sequence is shown as SEQ ID NO. 15), respectively, and the 1000 bp of the upper and lower homologous arms of the D17 site (the nucleotide sequence of the D17 site is shown as SEQ ID NO. 1, and the upper and lower homologous arm sequences of all sites in the present application are 1000 bp upstream and downstream of the sequence of the corresponding N20 site, respectively) were recombined by the Gibson assembly method to obtain a recombinant vector (the vector was purchased from GenScript pET22b), and the recombinant vector was transformed into Escherichia coli JM109, and the plasmid was extracted and sequenced to verify that the correct recombinant vector pET22b-SsLPPS-ScSCS was obtained. The recombinant vector was transformed into Po1f by a yeast transformation method, and the correct homologous recombinant strain St200 was obtained by PCR and sequencing verification. The bacterial liquid cultured to the logarithmic growth phase was inoculated into YPD culture medium, and after inoculation, the OD reached 0.6-0.8, and the fermentation was carried out at 28-30°C, 200-220 rpm for 72 h (the fermentation method of the following examples is the same as that of this example). By gas phase detection, the shizukolanol reached 3.5 mg / L.
[0089] Whether ridd and radd can effectively improve the yield of diterpenoid compounds was verified. The ridd (nucleotide sequence is shown as SEQ ID NO. 16) was fused to the N-terminus of SsLPPS using different linker peptides (GGGGSGGGGS, GSGSGSGS, GSGGSG), and the radd (nucleotide sequence is shown as SEQ ID NO. 17) was fused to the N-terminus of ScSCS using different linker peptides (GGGGSGGGGS, GSGSGSGS, GSGGSG), and the upper and lower homologous arms of the D17 site were recombined by the Gibson assembly method to obtain a recombinant vector, which was transformed into Escherichia coli JM109, and the plasmid was extracted and sequenced to verify that the correct recombinant vector was obtained. The recombinant vector was transformed into Po1f by a yeast transformation method, and the correct homologous recombinant strain St203-205 was obtained by PCR and sequencing verification. YPD fermentation was carried out for 72 h, and by gas phase detection, the shizukolanol content of ST205 (GSGSGSGS linker peptide) was the highest, reaching 40 mg / L.
[0090] The precursor of sclareol is mainly GGPP, and the strengthening of MVA can effectively improve the yield of GGPP. The key genes tHMG1, IDI1, erg20, erg8, and erg10 of the MVA pathway (nucleotide sequences are shown as SEQ ID NO. 18-22) are PCR-ed from the genome of Po1f, and an expression frame is constructed with the Tefin promoter and XPR2 terminator. Further, the upstream and downstream homologous arms of E1 and AXP sites (nucleotide sequences of N20 of the E1 site and the AXP site are shown as SEQ ID NO. 2-3, respectively) are PCR-ed from the genome, wherein the upstream and downstream homologous arms of the E1 site are Gibson connected with the expression frames of tHMG1 and IDI1, the recombinant vector is transformed into E. coli JM109, the plasmid is extracted and verified by sequencing, and the correct recombinant vector is obtained; the upstream and downstream homologous arms of the AXP site are Gibson connected with the expression frames of erg20, erg8, and erg10, the recombinant vector is transformed into E. coli JM109, the plasmid is extracted and verified by sequencing, and the correct recombinant vector is obtained. The two site fragments constructed are transformed into St205 by a yeast transformation method, and the correct homologous recombinant strain St206 is obtained through PCR and sequencing verification. After 72 h of YPD fermentation, the content of sclareol reaches 380 mg / L as detected by gas chromatography.
[0091] In order to further improve the content of GGPP and thus the yield of sclareol, the synthesized gene sequences tPaGGPPS and SsGGPPS (nucleotide sequences are shown as SEQ ID NO. 23-24, respectively) are used as templates to construct expression frames with the Tefin promoter and the XPR2 terminator. The upstream and downstream homologous arms of the F1-3 site (nucleotide sequence of N20 of the F1-3 site is shown as SEQ ID NO. 4) are PCR-ed from the genome of Po1f, and Gibson connected with the expression frames of tPaGGPPS and SsGGPPS, the recombinant vector is transformed into E. coli JM109, the plasmid is extracted and verified by sequencing, and the correct recombinant vector is obtained. The site fragment constructed is transformed into St206 by a yeast transformation method, and the correct homologous recombinant strain St208 is obtained through PCR and sequencing verification. After 72 h of YPD fermentation, the content of sclareol reaches 720 mg / L as detected by gas chromatography.
[0092] Further, the promoters of erg9 are truncated to 100 bp and 50 bp (nucleotide sequences are shown as SEQ ID NO. 25-26, respectively) based on the St208 strain, and the strains St209 and St210 are obtained, and the content of sclareol reaches 760 mg / L and 800 mg / L, respectively, as detected by gas chromatography after 72 h of YPD fermentation.
[0093] Example 2: Increasing acetyl-CoA to improve sclareol production
[0094] Acetyl-CoA is the main source of upstream synthesis of MVA, increasing the content of acetyl-CoA can effectively improve the synthesis efficiency of sclareol. With Po1f genome as template, the key genes of acetyl-CoA pathway, PDH, acsl, CAT2 (nucleotide sequences are shown in SEQ ID NO. 27-29, respectively) were PCR-ed from the genome, and the expression frames were constructed with Tefin promoter and XPR2 terminator, respectively. The upstream and downstream homologous arms of E12 site (the N20 nucleotide sequence of E12 site is shown in SEQ ID NO. 5) were PCR-ed from the genome, and Gibson connection was performed with the expression frames of acsl, PDH and CAT2, the recombinant vector was transformed into E. coli JM109, the plasmid was extracted and sequenced to verify, and the correct recombinant vector was obtained. The constructed site fragment was transformed into St210 by yeast transformation method, and the correct homologous recombination strain St212 was obtained by PCR and sequencing verification, YPD was fermented for 72h, and gas phase detection showed that the sclareol reached 960mg / L.
[0095] Example 3: Increasing intracellular reducing power to improve sclareol production
[0096] Increasing intracellular reducing power can effectively improve the intracellular redox balance and tolerance, and thus improve the yield of sclareol. With Po1f genome as template, the genes for increasing intracellular reducing power, zwf, mael, IDH and POT1 (nucleotide sequences are shown in SEQ ID NO. 30-33, respectively) were PCR-ed from the genome, and the expression frames were constructed with Tefin promoter and XPR2 terminator, respectively. The upstream and downstream homologous arms of A11 and D8 sites (the N20 nucleotide sequences of A11 and D8 sites are shown in SEQ ID NO. 6-7, respectively) were PCR-ed from the genome, wherein Gibson connection was performed between A11 site and the expression frames of zwf and mael, and Gibson connection was performed between D8 site and the expression frames of IDH and POT1, the recombinant vector was transformed into E. coli JM109, the plasmid was extracted and sequenced to verify, and the correct recombinant vector was obtained. The constructed site fragment was transformed into St212 by yeast transformation method, and the correct homologous recombination strain St216 was obtained by PCR and sequencing verification, YPD was fermented for 72h, and gas phase detection showed that the sclareol reached 1020mg / L.
[0097] Example 4: Reducing intracellular lipid synthesis to improve sclareol production
[0098] Yarrowia lipolytica Po1f as oil yeast, which will consume a large amount of acetyl-CoA for the synthesis of malonyl-CoA and then for the synthesis of oil. With Po1f genome as template, the upstream and downstream homologous arms of the genes DGA1, DGA2, FAA1, FAS1 involved in oil synthesis were PCR-ed from the genome (nucleotide sequences are shown as SEQ ID NO. 34-37, respectively), and fused, and sequenced. The knockout fragments were transformed into St216 in turn by yeast transformation method, and the correct homologous recombination strains St225 were obtained by PCR and sequencing verification, and YPD was fermented for 72h, and the soralen reached 1125mg / L by gas phase detection.
[0099] Example 5: Site-specific integration and increasing the copy number of key genes to improve soralen production
[0100] The upstream metabolic flux GGPP is sufficient, so increasing the copy number of key genes can effectively improve the yield of target products. With Po1f genome as template, the upstream and downstream homologous arms of C12, C3, D4, F1 sites were PCR-ed from the genome (the N20 nucleotide sequences of the four sites are shown as SEQ ID NO. 8-11, respectively), and Gibson connected with the expression frame of SsLPPS-ScSCS soralen synthesis pathway containing ridd and radd and GSGSGSGS connecting peptide in Example 1, and the recombinant vector was transformed into E. coli JM109, and the plasmid was extracted and sequenced to obtain the correct recombinant vector. The constructed site fragments were transformed into St225 in turn by yeast transformation method, and the correct homologous recombination strains St236-239 were obtained by PCR and sequencing verification, and YPD was fermented for 72h.
[0101] By gas phase detection, the strain St236 containing an additional 1 copy at the C12 site reached 1235mg / L of soralen; the strain St237 containing an additional 2 copies at the C12 and C3 sites reached 1400mg / L of soralen; the strain St238 containing an additional 3 copies at the C12, C3 and D4 sites reached 1500mg / L of soralen; and the strain St239 containing an additional 4 copies at the C12, C3, D4 and F1 sites reached 1450mg / L of soralen.
[0102] The above examples are intended to illustrate the disclosed embodiments of the present application and are not understood to limit the present application. In addition, various modifications to the examples listed herein and variations of the methods of the present application will be apparent to those skilled in the art. Although the present application has been described in detail with reference to various preferred embodiments, it should be understood that the application is not limited to such embodiments. Indeed, various modifications of the application in addition to those described herein will be apparent to those skilled in the art from the foregoing description and accompanying drawings. It is intended that the scope of the application be defined by the following claims.
[0103] The nucleotide or amino acid sequences used in the present application are as follows:
[0104] The N20 sequences of each site used in the present application are as follows:
[0105] D17: tccgtaatataggtgacgac (SEQ ID NO. 1)
[0106] E1: gtcactaacccagccgaagt (SEQ ID NO. 2)
[0107] AXP: gaccaggtcgaagtagctgg (SEQ ID NO. 3)
[0108] F1-3: ggcgttgttataggcatcgt (SEQ ID NO. 4)
[0109] E12: acccctatagcccaaactgt (SEQ ID NO. 5)
[0110] A11: cgcaaacagaaccgatgcgg (SEQ ID NO. 6)
[0111] D8: cacagttagtctgcccacgt (SEQ ID NO. 7)
[0112] C12: tcaaaagtcagtgtgagggg (SEQ ID NO. 8)
[0113] C3: actaacgcaggatcaagaga (SEQ ID NO. 9)
[0114] D4: agtcgtggtggatcctcagg (SEQ ID NO. 10)
[0115] F1: actggcagacagataagaca (SEQ ID NO. 11)
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
[0126]
[0127]
[0128]
[0129]
[0130]
Claims
1. An engineered Yarrowia lipolytica strain, characterized in that, The SsLPPS, SsSCS, and nucleotide encoding polypeptide interaction tags RIAD and RIDD in the engineered Yarrowia lipolytica are overexpressed MVA pathway key genes and GGPP synthesis related genes, the MVA pathway key genes are selected from any one or more of erg8, erg10, and erg20; the GGPP synthesis related genes are selected from tPaGGPPS and / or SsGGPPS; the promoter of the erg9 gene of the engineered Yarrowia lipolytica is a truncated promoter with a length of 40-110 bp.
2. The engineered Yarrowia lipolytica yeast strain of claim 1, wherein, The engineered Yarrowia lipolytica uses Yarrowia lipolytica PO1f as the starting strain; and / or, the SsLPPS, SsSCS, MVA pathway key genes, and / or GGPP synthesis related genes in the engineered Yarrowia lipolytica have independent reading frames, respectively; preferably, the promoter in the reading frame is Tefin, and / or the terminator is XPR2.
3. The engineered Yarrowia lipolytica of claim 1, wherein, Any one or more of the following features is also included: 1) The SsLPPS, SsSCS, and / or nucleotide encoding polypeptide interaction tags RIAD and RIDD are integrated into the D17 site on the genome of Yarrowia lipolytica PO1f; 2) The MVA pathway key genes tHMG1 and IDI1 are integrated into the E1 site on the genome of Yarrowia lipolytica PO1f; 3) The MVA pathway key genes erg8, erg10, and erg20 are integrated into the AXP site on the genome of Yarrowia lipolytica PO1f; 4) The GGPP synthesis related genes are integrated into the F1-3 site on the genome of Yarrowia lipolytica PO1f.
4. The engineered Yarrowia lipolytica of claim 1, wherein, The nucleotide encoding the polypeptide interaction tag RIDD is connected to the SsLPPS, preferably connected to the N-terminus of the SsLPPS; and / or, The nucleotide encoding the polypeptide interaction tag RADD is connected to the ScSCS, preferably connected to the N-terminus of the ScSCS.
5. The engineered Yarrowia lipolytica of claim 1, wherein, The nucleotide encoding the polypeptide interaction tag is connected to the SsLPPS or ScSCS using a connecting peptide, preferably the connecting peptide is selected from any one of GGGGSGGGGS, GSGSGSGS, and GSGGSG.
6. The engineered Yarrowia lipolytica of claim 1, wherein, The engineered Yarrowia lipolytica includes any one or more of the following reading frames: 1) At the D17 site: P TEFin -SsLPPS-GSGSGSGS-RIDD-T XPR2 -P TEFin -ScSCS-GSGSGSGS-RADD-T XPR2 ; 2) at the El site comprising: P TEFin -tHMG1-T XPR2 -P TEFin -IDI1-T XPR2 ; 3) at AXP site includes: P TEFin -erg20-T XPR2 -P TEFin -erg8-T XPR2 -P TEFin -erg10-T XPR2 ; 4) at F1-3 positions include: P TEFin -tPaGGPPS-T XPR2 -P TEFin -SsGGPPS-T XPR2 .
7. The engineered Yarrowia lipolytica of claim 1, wherein, The nucleotide sequence of the promoter of the erg9 gene is shown in SEQ ID NO. 25 or 26.
8. The engineered Yarrowia lipolytica of claim 1, wherein, The engineered Yarrowia lipolytica overexpresses a key gene of the acetyl-CoA pathway; preferably, the key gene of the acetyl-CoA pathway is selected from any one or more of PDH, acs, CAT2; more preferably, each of the key genes of the acetyl-CoA pathway has an independent reading frame; more preferably, the key gene of the acetyl-CoA pathway is integrated into the E12 site; more preferably, the engineered Yarrowia lipolytica further comprises the following reading frames: TEFin - Acs1-T XPR2 - P TEFin - PDH-T XPR2 - P TEFin - CAT2-T XPR2 .
9. The engineered Yarrowia lipolytica of claim 1, wherein, The engineered Yarrowia lipolytica overexpresses genes for enhancing intracellular reducing power; preferably, the genes for enhancing intracellular reducing power are selected from any one or more of zwf, mae1, IDH, and POT1; preferably, each of the genes for enhancing intracellular reducing power has an independent reading frame; and / or, the genes for enhancing intracellular reducing power are integrated into the A11 site and / or the D8 site.
10. The engineered Yarrowia lipolytica of claim 1, wherein, The Y. lipolytica engineering strain further comprises the following reading frame at A11 site: P TEFin -zwf-T XPR2 -P TEFin -mae1-T XPR2 , and / or, further comprises the following reading frame at D8 site: P TEFin -IDH-T XPR2 -P TEFin -POT1-T XPR2 .
11. The engineered Yarrowia lipolytica yeast strain of claim 1, wherein, The Yarrowia lipolytica engineering strain has low expression of genes involved in oil synthesis; preferably, the genes involved in oil synthesis are selected from any one or more of DGA1, DGA2, FAA1 or FAS1.
12. The engineered Yarrowia lipolytica yeast strain of claim 1, wherein, The Yarrowia lipolytica engineering strain has 2-5 copies of SsLPPS, SsSCS and / or nucleotides encoding polypeptide interaction tags RIAD and RIDD; preferably, the Yarrowia lipolytica engineering strain contains SsLPPS, SsSCS and / or encoding polypeptide interaction tags RIAD and RIDD at C12 site, C3 site, D4 site and / or F1 site; preferably, the Yarrowia lipolytica engineering strain includes the following expression frame at C12 site, C3 site, D4 site and F1 site respectively: P TEFin -SsLPPS-GSGSGSGS-ridd-T XPR2 -P TEFin -ScSCS-GSGSGSGS-radd-T XPR2 .
13. The method for constructing the engineered Yarrowia lipolytica strain according to any one of claims 1 to 12, characterized in that, The construction method includes integrating SsLPPS, SsSCS and nucleotides encoding polypeptide interaction tags RIAD and RIDD into the starting strain, overexpressing key genes of the MVA pathway and GGPP synthesis related genes in the starting strain, the key genes of the MVA pathway are selected from any one or more of erg8, erg10, erg20; the GGPP synthesis related genes are selected from tPaGGPPS and / or SsGGPPS; the promoter of the erg9 gene in the starting strain is truncated to 40-110 bp.
14. The method of construction of claim 13, wherein, The construction method further includes any one or more of the following features: 1) overexpressing key genes of the acetyl-CoA pathway, preferably, the key genes of the acetyl-CoA pathway are selected from any one or more of PDH, ACS, CAT2; 2) overexpressing genes for enhancing intracellular reducing power, preferably, the genes for enhancing intracellular reducing power are selected from any one or more of zwf, mae1, IDH or POT1. 3) knockdown of genes involved in oil synthesis; preferably, the genes involved in oil synthesis are selected from any one or more of DGA1, DGA2, FAA1 or FAS1.
15. Use of the Yarrowia lipolytica engineering strain of any one of claims 1-12 in the preparation of sclareol or derivatives thereof.
16. A method of preparing a sclareol, characterized in that, The Yarrowia lipolytica engineering strain of any one of claims 1-12 is cultured, and the fermentation broth is extracted to obtain the sclareol.
17. The method of claim 16, wherein, Further including any one or more of the following: 1) the culture temperature is 28-30°C; 2) the culture time is 72-96h; 3) the culture medium is YPD medium.