Protein salt purification vector construction method and application of constructed vector in kit

By simultaneously constructing plasmids in a single reaction system using Golden Gate and homologous recombination technology, the problems of low efficiency, complex operation, and cumbersome purification processes in existing technologies are solved, achieving efficient and seamless plasmid construction and purification, which is suitable for the rapid construction and industrial production of large gene fragments.

CN120989113APending Publication Date: 2025-11-21NINGXIA MEDICAL UNIVERSITY GENERAL HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511160594.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-19
Publication Date
2025-11-21

AI Technical Summary

Technical Problem

Existing plasmid construction technologies have significant shortcomings in terms of efficiency, accuracy, high-throughput compatibility, and purification process simplification, especially in the case of large fragment insertion, where the mutation rate is high, the operation is complex, and the cost is high.

Method used

Using Golden Gate and homologous recombination technology, the insertion of the target gene and the construction of the vector are completed simultaneously in a single reaction system. By using IIS-type endonuclease and thermostable T4 DNA ligase, combined with icSAT tag, seamless splicing and salt concentration gradient purification are achieved, simplifying the operation steps.

Benefits of technology

It significantly improves plasmid construction efficiency, reduces the multiple rounds of enzyme digestion and gel purification steps in traditional methods, is suitable for seamless splicing of large gene fragments, is suitable for high-throughput vector assembly in laboratory and industrial production, and reduces the risk of contamination.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120989113A_ABST
    Figure CN120989113A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of gene engineering, and discloses a protein salt purification vector construction method and application of a constructed vector in a kit, the construction method comprises the following steps: designing primers according to upstream and downstream sequences of a target gene to be inserted; carrying out annealing treatment on the primer to form a DNA template to be inserted; the method comprises the following steps: mixing a double-stranded DNA template, a plasmid vector pET28a-icSAT, restriction enzyme, heat-resistant T4DNA ligase, a target gene and a buffer solution to construct a vector; and transforming the vector into a competent cell E.coli DH5alpha, and amplifying to obtain a protein salt purified vector capable of being inserted into a target DNA sequence. By adopting the construction method, the insertion of the target gene and the construction of the vector are synchronously completed in a single reaction system, the steps of multiple rounds of enzyme digestion, connection and gel purification in a traditional method are omitted, and the construction efficiency is remarkably improved; meanwhile, the target gene can be connected into a corresponding expression vector without PCR amplification.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic engineering, and in particular to a protein salt purification vector construction method and application of the constructed vector in a kit. BACKGROUND

[0002] There are various existing plasmid construction technologies:

[0003] 1. Restriction enzyme cloning technology: using restriction enzymes to cut the vector and the insert fragment, and recombining by ligase. This technology is simple to operate and has low cost. However, it has many disadvantages: ① multi-step time-consuming: multiple rounds of enzyme cutting, ligation and gel purification are required, and the positive clone rate is low (<70%); ② fragment size limitation: it is difficult to insert large fragments (>5 kb); ③ site dependence: it depends on specific enzyme cutting sites, and has poor flexibility and other disadvantages.

[0004] 2. Gibson Assembly and In-Fusion cloning are based on homologous recombination or single-strand overlap extension, and do not require restriction enzyme cutting sites. The advantages are that they support seamless cloning and are suitable for multi-fragment assembly. However, they also have many disadvantages: ① PCR dependence: target genes need to be amplified, ② low fidelity (Taq enzyme error rate is about 2 x 10 -4 / base), mutation rate of large fragments (>3 kb) is as high as 15%, ③ high cost, commercial kit is expensive, limiting large-scale application.

[0005] 3. Golden Gate cloning uses IIs type restriction enzymes (such as BsaI, SapI) to cut and connect fragments, achieving seamless assembly. This method is efficient and can be modularly assembled. However, it has design complexity, requires precise design of enzyme cutting sites, limited compatibility and fragment number, and the efficiency decreases when assembling multiple fragments.

[0006] 4. Homologous recombination technology relies on homologous arms to guide the insertion of target genes into vectors. It is suitable for large fragments or complex insertions. However, it has low efficiency, and the traditional method has low recombination efficiency (<50%), and needs to optimize the length of the homologous arm, which has a complicated procedure and often needs to be combined with other technologies (such as Red / ET recombination system), increasing the complexity of operation. Therefore, although the existing plasmid construction technologies have their own advantages, there are still significant deficiencies in efficiency, accuracy, high-throughput compatibility and simplification of purification process. To solve the above technical problems, the present application provides a protein salt purification vector construction method. SUMMARY

[0007] The application aims to provide a protein salt purification vector construction method and application of the constructed vector in a kit.

[0008] To achieve the above-mentioned purpose, the application provides a protein salt purification vector construction method, comprising the following steps:

[0009] Step 1, designing a double-stranded DNA sequence with sticky ends, designing an upstream primer and a downstream primer of the DNA sequence according to the upstream and downstream sequences of the target gene to be inserted;

[0010] Step 2, primer annealing, annealing the upstream primer and the downstream primer of the double-stranded DNA sequence containing the sticky ends to form a double-stranded DNA template to be inserted;

[0011] Step 3, one-step construction of the vector, mixing the double-stranded DNA template, the plasmid vector pET28a-icSAT, a restriction endonuclease, a thermostable T4 DNA ligase, the target gene and a buffer to perform enzyme cutting and enzyme ligation reaction to construct the vector;

[0012] Step 4, transforming the constructed vector into a competent cell E.coli DH5α to perform amplification to obtain a protein salt purification vector that can insert the target DNA sequence.

[0013] Further, in step 1, the upstream primer sequence is shown in SEQ ID NO. 1: 5'-aacNNNNNNNNNNNNNNNNNNNNGATTACAAGGATGATGATGATAAGGATTACAAGGATGATGATGATAAGNNNNNNNNNNNNNNNNNNNN-3', and the downstream primer sequence is shown in SEQ ID NO. 2: 5'-ccgNNNNNNNNNNNNNNNNNNNNCTTATCATCATCATCCTTGTAATCCTTATCATCATCATCCTTGTAATCNNNNNNNNNNNNNNNNNNNN-3'; wherein N in the upstream primer and the downstream primer represents any base among A, T, G or C, the 4th-23rd from the 5' end to the 3' end of the upstream primer sequence represents the upstream homologous sequence of the target gene, the 72nd-91st from the 5' end to the 3' end of the upstream primer sequence represents the downstream homologous sequence of the target gene; the 4th-23rd from the 5' end to the 3' end of the downstream primer sequence represents the downstream homologous sequence of the target gene, and the 72nd-91st from the 5' end to the 3' end of the downstream primer sequence represents the upstream homologous sequence of the target gene.

[0014] Further, the specific operation of step 2 is that 1 μL of the upstream primer and the downstream primer are taken respectively, supplemented to 100 μL by using ddH2O, mixed thoroughly, then 100℃ water bath for 5 min, and after the water bath, placed at room temperature, and naturally cooled to room temperature.

[0015] Further, the reaction procedure in step 3 is that 37℃, 10 min, 16℃, 10 min; cycle 3 times.

[0016] Further, the reaction system in step 3 is that:

[0017] pET28a-icSAT 0.3 μL (151 ng / μL) Gene of interest 0.5 μL (1 μmol / L) T4 DNA ligase buffer 0.2 μL Endonuclease Sap I 0.1 μL Hi-T4 DNA ligase 0.1 μL ddH2O 0.8 μL Upstream and downstream primers 1 μL each Total volume 4 μL .

[0018] Further, the restriction endonuclease in step 3 is endonuclease SapI and other IIs type endonucleases.

[0019] Further, the specific operation of step 4 is that:

[0020] 1, 2 μL of the carrier mixture is transferred into 50 μL of E. coli DH5α, mixed gently, and then the mixture is incubated on ice for 30 min, and then 42℃ heat shock for 90 s;

[0021] 2, transferred to ice for 5 min, and then 100 μL of LB liquid medium is added, and then the E. coli DH5α is inoculated into a 24-well plate, 0.5 mL of LB solid medium containing 50 μg / mL of kanamycin is contained in each well, and then placed in a 37℃ incubator for culture overnight;

[0022] 3, the plate is observed the next day whether there are colonies, and then a positive single colony is selected and shaken, and then the positive strain is identified.

[0023] Further, the application further provides a protein salt purification carrier constructed by the method.

[0024] Further, the application further provides application of the protein salt purification carrier in a kit, and the kit is a salt purification carrier kit, and the kit comprises the empty carrier pET28a-icSAT containing the IIs type endonuclease, the upstream and downstream primers for clone identification, and 2x clone reaction mixture (mainly comprising a recombinase, a heat-resistant ligase, a corresponding IIs type endonuclease and a buffer).

[0025] The kit related components of 20 reaction systems are as follows:

[0026]

[0027] The protein salt purification vector construction method and the application of the constructed vector in the kit have the following advantages and positive effects:

[0028] 1. The present application is based on Golden Gate and homologous recombination technology, which simultaneously completes the insertion of target genes and the construction of vectors in a single reaction system, saving the multiple rounds of enzyme digestion, ligation and gel purification steps in traditional methods, and significantly improving the construction efficiency.

[0029] 2. The present application uses a one-step method to construct a vector, without the need for PCR amplification of target genes, avoiding mutations introduced due to the lack of polymerase fidelity, especially suitable for seamless splicing of large fragment genes, and the insertion of target genes is suitable for preliminary identification using blue-white spot.

[0030] 3. The present application inserts icSAT tags in the vector, which makes the vector built-in temperature-sensitive self-assembling peptide, which can realize specific elution of target proteins through salt concentration gradient, without metal chelate chromatography or protease cleavage, reducing the risk of contamination and simplifying the purification steps.

[0031] 4. The construction method of the protein salt purification vector of the present application is suitable for rapid construction of recombinant protein expression vectors on a laboratory scale; at the same time, it supports high-throughput vector assembly in industrial production, meeting the large-scale preparation needs in the fields of biopharmaceuticals, enzyme engineering, etc.

[0032] 5. The icSAT tag salt ion protein purification technology of the present application allows the separation of target proteins from cell supernatant, thereby reducing the contamination of membrane proteins and phospholipids in cell lysate insoluble substances.

[0033] The technical solutions of the present application will be further described in detail below with the help of the accompanying drawings and examples. BRIEF DESCRIPTION OF DRAWINGS

[0034] Figure 1 The vector construction flowchart in the embodiments of the present application;

[0035] Figure 2 The pET28a-icSAT plasmid map in the embodiments of the present application;

[0036] Figure 3 The base optimization sequence diagram of lacZα gene in the embodiments of the present application;

[0037] Figure 4 The positive strain identification results in the embodiments of the present application, wherein A is a recombinant plasmid transformation plate, and B is a negative control transformation plate;

[0038] Figure 5 The blue-white spot screening results in the embodiments of the present application;

[0039] Figure 6 Screening results of target gene Rv0674 in the embodiment of the present application, wherein M is marker; 1-5 lanes are randomly selected Figure 5 Identification results of blue spots in the above table, 6-12 lanes are randomly selected Figure 5 Identification results of white spots in the above table.

[0040] Figure 7 SDS-PAGE analysis results of protein purification in the embodiment of the present application, wherein M: protein marker; 1: whole bacteria; 2: precipitate; 3: supernatant; 4: CEPB1; 5: CEPB2; 6: CEPB3; 7: CEPB4. DETAILED DESCRIPTION

[0041] The technical solutions of the present application are further described below by means of the accompanying drawings and examples.

[0042] Unless otherwise defined, the technical terms or scientific terms used in the present application shall have the usual meanings understood by those skilled in the art to which the present application belongs.

[0043] Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without making creative efforts fall within the scope of protection of the present application. The experimental methods not specified in the following examples are generally determined according to national standards. The experimental instruments, equipment and reagents not specified in the following examples are all commercially available raw materials.

[0044] Unless otherwise defined or explained, all professional and scientific terms used in the present application have the same meanings as those familiar to those skilled in the art. In addition, any method and material similar or equivalent to those described can be applied in the method of the present application. It should be noted that the embodiments in the present application and the features in the examples can be combined with each other without conflict.

[0045] The present application discloses a method for constructing a protein salt purification vector, comprising the following steps Figure 1 as shown in the figure:

[0046] Step 1, design DNA: the sticky end DNA sequence of the target gene, including the upstream primer sequence and the downstream primer sequence.

[0047] The upstream primer sequence is shown in SEQ ID NO.1: 5'-aacNNNNNNNNNNNNNNNNNNNNNNGATTACAAGGATGATGATGATAAGGATTACAAGGATGATGATGATAAGNNNNNNNNNNNNNNNNNNNN-3', and the downstream primer sequence is shown in SEQ ID NO. As shown in NO.2: 5'-ccgNNNNNNNNNNNNNNNNNNNNCTTATCATCATCATCCTTGTAATCCTTATCATCATCATCCTTGTAATCNNNNNNNNNNNNNNNNNNNN-3'; where N in the upstream and downstream primers represents any base from A, T, G, or C; the upstream primer sequence from position 4 to position 23 from the 5' end to the 3' end represents the upstream homologous sequence of the target gene; the upstream primer sequence from position 72 to position 91 from the 5' end to the 3' end represents the downstream homologous sequence of the target gene; the downstream primer sequence from position 4 to position 23 from the 5' end to the 3' end represents the downstream homologous sequence of the target gene; the downstream primer sequence from position 72 to position 91 from the 5' end to the 3' end represents the upstream homologous sequence of the target gene.

[0048] Step 2, Vector Construction: Primer annealing, using IIS restriction endonuclease and SapI restriction endonuclease, after digesting the vector, add thermostable T4 ligase, insert the annealed primers into the vector to transform competent cells, and prepare a vector containing the inserted DNA fragment of the target gene homologous region.

[0049] The vector was obtained by modifying the pET28α plasmid, such as... Figure 2 As shown. Figure 2 Four areas were improved, labeled as Area 1, Area 2, Area 3, and Area 4.

[0050] ① The plasmid is 6284 bp in total. Region 1, located at 2255-2280 bp, has a mutation from base A to G, eliminating the original SapI restriction site; ② Region 2, located at 5070-5213 bp, has two PT linkers added between mpa and intein; ③ Region 3, located at 5765-6104 bp, has an optimized LacZα gene added to the target protein region of the insertion site, facilitating blue-white screening for positive bacteria during vector construction; the optimized LacZα gene sequence is shown below. Figure 3The sequence is shown as follows (SEQ ID NO. 5): ATGACCATGATTACGAACTCTAGCAGCGTACCTGGGGACCCTTTGGAGTCGACCTGTAGGCATGCAAGTTTGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAG; the 4th region is located at 5818-5834 bp and is sequence-optimized, and the excess enzyme digestion site is removed.

[0051] The reaction system is shown in Table 1, and the reaction procedure is: 37°C, 10 min, 16°C, 10 min; cycle 3 times.

[0052] Table 1 reaction system

[0053] pET28a-icSAT 0.3 μL (151 ng / μL) Gene of interest 0.5 μL (1 μmol / L) T4 DNA ligase buffer 0.2 μL Endonuclease Sap I 0.1 μL Hi-T4 DNA ligase 0.1 μL ddH2O 0.8 μL Upstream and downstream primers 1 μL each Total volume 4 μL

[0054] Step 3, transformation of competent cells: the constructed vector is directly transformed, and hundreds of single colonies are formed on the plate for later positive screening.

[0055] Step 4, colony PCR screening: PCR reaction is performed using sequencing primers, and the size and band clarity of the PCR product are detected by gel electrophoresis.

[0056] Step 5, protein expression and extraction: the constructed positive plasmid is transformed into host cells for expression, and the cell lysate or supernatant containing the target protein is extracted by centrifugation or ultrasonic wave crushing method.

[0057] Step 6, salt ion induction purification: a specific concentration of salt ion solution is added to the lysate to induce the self-assembly of icSAT tag and target protein to form a polymer, and the polymer is separated by centrifugation or filtration.

[0058] Step 7, tag cleavage and purification: the icSAT tag is cleaved using a protease, and the target protein is further purified by two-step column chromatography of ion exchange chromatography (IEC) and size exclusion chromatography (SEC).

[0059] Step 8, concentration and preservation: the purified protein is concentrated and stored in a buffer.

[0060] The following is an example of Rv0674 gene, introduce specific experimental operation steps.

[0061] Examples

[0062] 1. Materials and methods:

[0063] DH5α competent cells, pet28a-icSAT, Rv0674 gene from Beijing Bomeide Biotechnology Co., Ltd.

[0064] 2. Main reagents:

[0065] Kanamycin (Kana), yeast extract, tryptone, sodium chloride, agar were purchased from Yinchuan Weibo Xin Biological Technology Co., Ltd.; Gel recovery kit was purchased from Beijing Quanshijin Biotechnology Co., Ltd.; Restriction endonuclease SapI, HI-T4 ligase (NEB company).

[0066] 2.1 LB liquid medium:

[0067] 5g / L yeast extract, 10g / L tryptone, 10g / L sodium chloride, and then adjust pH to 7.5.

[0068] 2.2 LB solid medium:

[0069] 5g / L yeast extract, 10g / L tryptone, 15g / L agar, 10g / L sodium chloride, and then adjust pH to 7.5.

[0070] 3. Design primers, primer annealing:

[0071] Based on the target gene Rv0674 gene design primer, upstream primer sequence (SEQ ID NO. 6): 5'-aacATGGCCCCTGCTATGACTGCGATTACAAGGATGATGATGATAAGGATTACAAGGATGATGATGATAAGGATTACAAGGATGATGATGATAAGGCTACACAACTCCTGGAGGTGACA-3', downstream primer sequence (SEQ ID NO. 7): 5'-ccgTGTCACCTCCAGGAGTTGTGTAGCCTTATCATCATCATCCTTGTAATCCTTATCATCATCATCCTTGTAATCGCAGTCATAGCAGGGGCCAT-3'.

[0072] Take 1 μL of upstream primer and downstream primer, then use ddH2O to make up to 100 μL, mix thoroughly, then 100℃ water bath for 5 min, after water bath, room temperature natural cooling to room temperature.

[0073] 4. Construction of one-step ligation plasmid:

[0074] The reaction system is shown in Table 2.

[0075] Table 2 Reaction system

[0076] pET28a-icSAT 0.3 μL (151 ng / μL) Rv0674 gene 0.5 μL (1 μmol / L) T4 DNA ligase buffer 0.2 μL Endonuclease Sap I 0.1 μL Hi-T4 DNA ligase 0.1 μL ddH2O 0.8 μL Upstream and downstream primers 1 μL each Total volume 4 μL

[0077] The reaction procedure is: 37°C, 10 min, 16°C, 10 min; cycle three times.

[0078] 4.1 High-throughput transformation:

[0079] Transfer 96 portions of 2 μL of the mixture produced by each ligation into 96 portions of 50 μL of DH5α and mix gently. Incubate the mixture on ice for 30 min, and after heat shock at 42°C for 90 s, place the 1.5 mL centrifuge tube on ice for 5 min. Add 700 μL of LB liquid medium (dilution ratio of 15 times) to each of the 96 portions of the transformation solution, and after incubation in a 37°C incubator for 20 min, inoculate the DH5α into solid medium containing kanamycin in a 24-well plate and incubate in a 37°C incubator overnight.

[0080] 4.2 Observe the plates for the presence or absence of colonies the next day, and use blue-white spot screening results (see Figure 5 ) to pick single colonies or white spots, shake the bacteria, and send them to a sequencing company for identification. The results are shown in Figure 4 , Figure 5 .

[0081] The steps of blue-white spot screening are as follows:

[0082] ① Medium preparation: prepare LB solid medium with a final concentration of 50 μg / mL of Amp antibiotic, 40 μg / mL of X-gal, and 0.1 mM of IPTG. Pour the prepared medium into sterile culture dishes while hot, and allow it to cool and solidify naturally.

[0083] ② Key operations in the transformation experiment: take the heat shock method as an example. First, carefully add the ligation product (i.e., the combination of the plasmid and the foreign DNA) to the competent cells, and then place them in an ice bath for 30 min to allow the cells to "contact" the foreign DNA fully; then, quickly transfer the sample to a 42°C environment for heat shock for 45 s to promote the uptake of the foreign DNA, and after heat shock, immediately return it to the ice bath for cooling for 5 min to stabilize the cell state; finally, add LB liquid medium and place it in a 37°C constant-temperature incubator for recovery for 45-60 min.

[0084] ③Coating culture: Use a pipette to take an appropriate amount of resuscitated bacterial solution and evenly coat it on the surface of the previously prepared culture medium containing Amp, X-gal and IPTG, ensuring uniform distribution of the bacterial solution. After coating is complete, wait for a period of time until the bacterial solution is completely absorbed by the culture medium, avoiding uneven distribution of colonies caused by liquid flow. Then place the plate upside down in a 37°C incubator and incubate for 12-16h.

[0085] ④Result observation: After a period of incubation, two distinct colonies will appear on the plate. Blue colonies indicate empty vectors, i.e. plasmids without inserted foreign DNA, and their internal β-galactosidase activity is intact, allowing normal decomposition of X-gal for color development; white colonies represent recombinant plasmids, as the insertion of foreign DNA disrupts lacZα, rendering β-galactosidase inactive and unable to catalyze the color development reaction, hence the white color of the colonies.

[0086] 4.3 Inserting the target gene:

[0087] According to the formula, calculate the amount of DNA required for the recombination reaction.

[0088] Optimal amount of cloning vector used (A in Table 3) = [0.02 x number of base pairs of cloning vector] ng (0.03 pmol);

[0089] Optimal amount of insert used (B in Table 3) = [0.04 x number of base pairs of insert] ng (0.06 pmol).

[0090] To ensure accuracy of pipetting, dilute the vector and insert appropriately before preparing the recombination reaction system. The amount of each component added should not be less than 1 μl. Prepare the following reaction system on ice:

[0091] Table 3 Reaction system

[0092] Components Recombination reaction Negative control-1 Negative control-2 Positive control Vector A μL A μL 0 μL 1 μL Gene of interest insert B μL 0 μL B μL 1 μL 2X Cloning reaction mix 5 μL 0 μL 0 μL 5 μL ddH2O to 10 μL to 10 μL to 10 μL to 10 μL

[0093] Gently pipette the mixture (do not vortex) and centrifuge briefly to collect the reaction solution at the bottom of the tube.

[0094] Thaw the chemically competent cells DH5α on ice.

[0095] Take 5-10 μL of the recombination product and add it to 100 μL of competent cells. Gently mix by flicking the tube wall (do not vortex) and incubate on ice for 30 min (the volume of the recombination product should not exceed 1 / 10 of the volume of the competent cells used).

[0096] After 45s of 42°C water bath heat shock, immediately cool on ice for 5 min.

[0097] Add 900 μL of SOC or LB liquid medium (without antibiotics) and incubate at 37°C for 1 hour (200 rpm).

[0098] Preheat LB solid medium plates with the corresponding resistance in an incubator at 37°C.

[0099] Centrifuge at 5,000 rpm (2,500 × g) for 5 min and discard 900 μL of supernatant. Resuspend the bacteria in the remaining culture medium and gently spread it evenly on a plate containing the correct antibiotic using a sterile spreader.

[0100] Incubate upside down in a 37℃ incubator for 12–16 hours.

[0101] 5. Identification of the target gene:

[0102] The results are as follows Figure 6 As shown, Figure 6 M stands for marker; 1-7 represent the markers from... Figure 5 Seven different white colonies were randomly selected from the sample. The genomes of the colonies were boiled for 5 minutes and used as templates. Electrophoretic bands of the PCR amplification were obtained by using the upstream primer (SEQ ID NO.8): 5'-GGCAGCGAGGACAACTTGAG-3' and the downstream primer (SEQ ID NO.9): 5'-cgcGAATTCGTGGTGGTGGTGGTGGTGTGTCACCTCCAGGAGT-3'. The target gene size was 603 bp.

[0103] 6. Plasmid transfer:

[0104] Using a plasmid extraction kit, plasmids were extracted and transformed into 96 50 μL portions of DE3.

[0105] 7. Protein purification:

[0106] 7.1 Bacterial Culture:

[0107] LB medium containing kanamycin was dispensed into 96-well plates, and DE3 was inoculated into the corresponding wells. The plates were incubated overnight at 37°C and 250 rpm. The following day, randomly selected bacterial cultures were analyzed for OD using a UV spectrophotometer. 600 And press OD. 600 =0.1 redissolved into a new 96-well plate containing 1.5 mL LB medium, incubated at 25°C for 4 days, then induced with IPTG (final concentration 1 mM / L) for 4 days. The bacteria were collected by centrifugation at 4000 rpm, the supernatant was discarded, and 200 mL of deionized water was added to each well for washing.

[0108] 7.2 Bacterial lysis:

[0109] The harvested cell pellet was resuspended in buffer B1 (CEPB1) (20 mM Tris-HCl, 1 mM EDTA, pH 8.0) and lysed with a bacterial lysis solution.

[0110] 7.3 Supernatant separation: The soluble fraction was separated from the cell lysate by centrifugation at 15,000 g for 20 min at 4 °C.

[0111] 7.4 The soluble fraction was mixed with an equal volume of buffer B2 (CEPB2) (20 mM Tris-HCl, 1.4 M Na2SO4 or 1.4 M (NH4)2SO4, 1 mM EDTA, pH 8.0) solution or NaCl powder to a final concentration of 3 M. The resulting mixture was incubated at 4 °C for 1 h to induce the self-assembly of icSAT tags with target proteins to form insoluble polymers by increasing the salt concentration, thereby separating them from the soluble host cell proteins, followed by centrifugation at the same temperature for 20 min to separate the polymers.

[0112] 7.5 The supernatant was carefully removed, and the pellet was resuspended in buffer B3 (CEPB3) (20 mM Tris-HCl, 0.7 M Na2SO4 or 3 M NaCl or 0.7 M (NH4)2SO4, 1 mM EDTA, pH 8.0) to maintain a high salt environment, ensuring the stability of the fusion protein polymers for subsequent operations. One sample was reserved for SDS-PAGE analysis.

[0113] 7.6 The sample was centrifuged again to form a pellet of insoluble fusion proteins, which was resuspended in buffer B4 (CEPB4) (20 mM Bis-Tris, 10 mM Na2HPO4, 1.8 mM KH2PO4, 0.7 M Na2SO4 or 3 M NaCl or 0.7 M (NH4)2SO4, 2.7 mM KCl, 2 mM EDTA, pH 6.2) to provide conditions suitable for intein-mediated cleavage reactions, and incubated at 25 °C for 24 h to allow the cleavage reaction to occur. Finally, the soluble fraction was collected by centrifugation.

[0114] 7.7 Protein purification detection:

[0115] SDS-PAGE analysis: To detect the molecular weight and concentration of the purified protein. The results are shown in Figure 7 From Figure 7 lanes 4-7: the bands are relatively single, and the molecular weight of the target protein is between 25-30 kDa, indicating that after a certain purification step, the target protein is enriched, and the protein purification is successful.

[0116] Therefore, the application adopts the above-mentioned protein salt purification vector construction method and application of the constructed vector in a kit, combines with the type IIS endonuclease and the homologous recombination technology, simultaneously completes the insertion of the target gene and the construction of the vector in a single reaction system, avoids the multiple enzyme digestion, connection and gel purification steps in the traditional method, realizes the non-PCR amplification, and significantly improves the construction efficiency of the vector.

[0117] Finally, it should be noted that: the above examples are only used to illustrate the technical solutions of the present application, but not to limit them, although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that: it can still modify or equivalently replace the technical solutions of the present application, and these modifications or equivalent replacements also cannot make the modified technical solutions deviate from the spirit and scope of the technical solutions of the present application.

Claims

1. A method for constructing a protein salt purification vehicle, characterized by, Comprising the following steps: Step 1, designing a double-stranded DNA sequence with sticky ends, designing an upstream primer and a downstream primer of the DNA sequence according to the upstream and downstream sequences of the target gene to be inserted; Step 2, primer annealing, annealing the designed upstream primer and downstream primer of the double-stranded DNA sequence with sticky ends to form a double-stranded DNA template to be inserted; Step 3, one-step construction of a vector, mixing the double-stranded DNA template, plasmid vector pET28a-icSAT, restriction endonuclease, heat-resistant T4 DNA ligase, target gene and buffer to perform enzyme cutting and enzyme ligation reaction to construct a vector; Step 4, transforming the constructed vector into competent cells E. coli DH5α for amplification to obtain a protein salt purification vector of the target DNA sequence to be inserted.

2. The method of constructing a protein salt purification vehicle according to claim 1, wherein, In step 1, the sequence of the upstream primer is shown in SEQ ID NO. 1: 5'-aacNNNNNNNNNNNNNNNNNNNNN GATTACAAGGATGATGATGATAAGGATTACAAGGATGATGATGATAAGNNNNNNNNNNNNNNNNNNNN-3', and the sequence of the downstream primer is shown in SEQ ID NO. 2: 5'-ccgNNNNNNNNNNNNNNNNNNNNCTTATCATCATCATCCTTGTAATCCTTATCATCATCATCCTTGTAATCNNNNNNNNNNNNNNNNNNNN-3'; wherein N in the upstream primer and the downstream primer represents any base among A, T, G or C, the 4th-23rd from the 5' end to the 3' end of the upstream primer sequence represents the upstream homologous sequence of the target gene, the 72nd-91st from the 5' end to the 3' end of the upstream primer sequence represents the downstream homologous sequence of the target gene; the 4th-23rd from the 5' end to the 3' end of the downstream primer sequence represents the downstream homologous sequence of the target gene, and the 72nd-91st from the 5' end to the 3' end of the downstream primer sequence represents the upstream homologous sequence of the target gene.

3. The method of constructing a protein salt purification carrier according to claim 1, wherein, The specific operation of step 2 is as follows: 1 μL of the upstream primer and the downstream primer are taken respectively, ddH2O is added to make up to 100 μL, and then after fully mixing, 100 ℃ water bath for 5 min, and after water bath, room temperature is placed, and naturally cooled to room temperature.

4. The method of constructing a protein salt purification carrier according to claim 1, wherein, The reaction procedure in step 3 is as follows: 37 ℃, 10 min, 16 ℃, 10 min; cycle 3 times.

5. The method of constructing a protein salt purification carrier according to claim 1, wherein The reaction system in step 3 is as follows: 。 6. The method of constructing a protein salt purification carrier according to claim 1, wherein The restriction endonuclease in step 3 is endonuclease SapI.

7. The method of constructing a protein salt purification carrier according to claim 1, wherein The specific operation of step 4 is as follows: ① 2 μL of the vector mixture is transferred to 50 μL of E. coli DH5α, mixed gently, and the mixture is incubated on ice for 30 min, and then 42 ℃ heat shock for 90 s; ② transferred to ice for 5 min, 100 μL of LB liquid medium is added, and then the E. coli DH5α is directly inoculated into a 24-well plate, each well containing 0.5 mL of LB solid medium containing 50 μg / mL of kanamycin, and placed in a 37 ℃ incubator for overnight culture; ③The next day, observe the plate for any colonies, pick positive single colonies, shake the bacteria, and then identify the positive strains.

8. The method for constructing a protein salt purification carrier according to any one of claims 1-7, wherein the protein salt purification carrier is constructed.

9. Use of the protein salt purification carrier according to claim 8 in a construction kit.