Method for detecting tRNA structure stability based on ribozyme

Abstract

The invention belongs to the technical field of RNA stability detection, and particularly relates to a method for detecting tRNA structure stability based on ribozyme. The invention discovers that when a non-modified site of the tRNA is taken as a cutting target, the tRNA with a more compact space structure can hinder pairing of VMC10A20p to the tRNA and hinder cutting of the VMC10A20p to the tRNA target. By comparing cleavage product levels of tRNA targets of different biological samples, the relative stability of the space structure of the tRNA target is detected. Therefore, the invention provides a method for detecting the tRNA structure, upstream and downstream arms of VMC10A20p are complementarily paired with upstream and downstream of a non-modified site of to-be-detected tRNA, a cleavage sequence is designed for the to-be-detected tRNA site, the to-be-detected tRNA is cleaved, and the structural stability of the tRNA is judged based on a cleavage result.

Description

Technical Field

[0001] This invention belongs to the field of RNA stability detection technology, specifically relating to a method for detecting tRNA structural stability based on ribozymes. Background Technology

[0002] tRNA possesses a complex and relatively stable spatial structure, which plays a crucial role in maintaining its stability and function. The spatial structure of tRNA is regulated by various factors (such as tRNA modification). Currently, the stability of tRNA structure can be assessed using methods such as RNase cleavage of in vitro synthesized / transcribed tRNA oligonucleotides and electrophoretic analysis to infer local structural stability; UV melting curve analysis of in vitro synthesized / transcribed tRNA oligonucleotides to directly measure thermal absorption and resolve enthalpy and entropy changes during folding; X-ray diffraction or nuclear magnetic resonance techniques to resolve tRNA structure and analyze its spatial conformation; or computer simulations to analyze the potential impact of certain mutations / chemical modifications on tRNA folding.

[0003] However, there is currently a lack of analytical techniques for the spatial structural stability of tRNAs, and even less means to directly detect the spatial structural stability of specific tRNAs, especially endogenous tRNAs in biological samples.

[0004] VMC10 is a functional ribozyme with cleavage activity (DNAzyme). Previous studies have shown that the presence of N6-methyladenine (m6A) modification at the VMC10 cleavage site of the target RNA inhibits VMC10 cleavage. Therefore, VMC10 can be used to detect RNA m 6 A modification. However, no literature indicates that VMC10 or other ribozymes have the ability to detect the steric stability of tRNA. Summary of the Invention

[0005] This invention previously demonstrated that VMC10's cleavage activity against tRNA is activated only when the A20 site of the enzymatic active site of VMC10 achieves base complementarity with the -2 site of the unmodified cleavage site in the T loop of tRNA. Therefore, this type of VMC10 ribozyme is named VMC10. A20p (p refers to Pairing).

[0006] The purpose of this invention is to provide a method utilizing VMC10 A20p A method for detecting tRNA structural stability using ribozymes.

[0007] To achieve the above-mentioned objectives of this invention, the technical solution adopted by this invention is as follows:

[0008] In a first aspect, the present invention provides a VMC10.A20p Application of ribozymes in the preparation of products for detecting the structural stability of tRNA.

[0009] In some embodiments of the present invention, A20p represents the complementary pairing of the 20th position of the VMC10 enzyme active site with the -2 position of the cleavage site of the target tRNA.

[0010] In some embodiments of the present invention, the VMC A20p The ribozyme's active sequence is 5'-GGGTCTCCAGCTGGACGTT A -3' (SEQ ID NO: 21).

[0011] In some embodiments of the present invention, the VMC10 A20p A schematic diagram of ribozyme pairing and cleavage is shown below. Figure 1 As shown.

[0012] In some embodiments of the present invention, the product includes reagents and reagent kits.

[0013] A second aspect of the present invention provides a method for detecting tRNA stability, comprising the following steps:

[0014] 1) Synthesize VMC10 targeting the unmodified sites of tRNA A20p Ribozyme cleaves the sequence (cleaves the unmodified site);

[0015] 2) VMC10 A20p The ribozyme sequence is mixed with the tRNA to be tested, and then digested.

[0016] 3) Detect the content of tRNA fragments after enzyme digestion.

[0017] In some embodiments of the present invention, the unmodified site includes tRNA. Met A52 and A64 sites, tRNA His The A63 site, tRNA Ala The A63 site.

[0018] In some embodiments of the present invention, for other tRNAs (non-Met, His, Ala), the unmodified site is: with tRNA Met Highly conserved sites that are the same as or similar to the A52 or A64 sites.

[0019] in:

[0020] tRNA Met The sequence is:

[0021] GCCUCGUUAGCGCAGUAGGUAGCGCGUCAGUCUCAUAAUCUGA AGGUCGUG A GUUCGAUCCUC A CACGGGGCACCA (SEQ ID NO: 22, the underlined and bolded parts represent sites A43, A52 and A64 respectively).

[0022] tRNA His The sequence is:

[0023] GCCGUGAUCGUAUAGUGGUUAGUACUCUGCGUUGUGGCCGCAGCAACCUCGGUUCGAAUCCG A GUCACGGCA (SEQ ID NO: 23, the underlined and bolded parts represent the A63 site).

[0024] tRNA Ala The sequence is:

[0025] GGGGGUAUAGCUCAGUGGUAGAGCGCGUGCUUAGCAUGCACGAGGUCCUGGGUUCGAUCCCC A GUACCUCCA (SEQ ID NO: 24, the underlined and bolded parts represent the A63 site).

[0026] In some embodiments of the present invention, the VMC10 A20p The ribozyme cleavage sequence includes the active enzyme sequence and complementary sequences located at both ends of the active enzyme sequence.

[0027] In some embodiments of the present invention, the enzyme activity sequence is 5'-GGGTCTCCAGCTGGACGTT A -3'.

[0028] In some embodiments of the present invention, the complementary sequence is complementary to the upstream and downstream sequences of the unmodified site of the tRNA, respectively.

[0029] In some embodiments of the present invention, the VMC10 A20p The 20th position of the ribozyme active sequence is complementary to the -2 position of the cleavage site (the two positions before the 5' direction of the cleavage site).

[0030] In some embodiments of the present invention, the lengths of the upstream and downstream sequences are 4 to 16 bp.

[0031] In some embodiments of the present invention, the lengths of the upstream and downstream sequences are 8 to 12 bp.

[0032] In some embodiments of the present invention, the VMC10A20p The molar ratio of the ribozyme cleavage sequence to the tRNA to be tested is 1:(0.01~1000); preferably, it is 1:(0.1~100).

[0033] In some embodiments of the present invention, the reaction conditions for the enzymatic digestion reaction are as follows:

[0034] 1) Treat at 90~95℃ for 1~30 min;

[0035] 2) Cooling treatment;

[0036] 3) Incubate at 16~42℃ for 2~24h.

[0037] In some embodiments of the present invention, the enzymatic digestion reaction is carried out in a buffer solution.

[0038] In some embodiments of the present invention, the buffer solution includes conventional buffer solutions in the art such as PBS, TBS, HBSS, and DMEM.

[0039] In some embodiments of the present invention, the buffer solution comprises Mg 2+ .

[0040] In some embodiments of the present invention, the lower the content of tRNA fragments after enzyme digestion, the higher the stability of the tRNA structure.

[0041] In some embodiments of the present invention, the method for detecting the content of tRNA fragments after enzyme digestion in step 3) includes, but is not limited to, conventional detection methods in the art such as gel electrophoresis, PCR, and absorbance detection.

[0042] In some embodiments of the present invention, the method for detecting the content of tRNA fragments after enzyme digestion is quantitative real-time PCR.

[0043] In some embodiments of the present invention, methionine-tRNA, histidine-tRNA, and alanine-tRNA were used as examples for relevant experimental tests. Those skilled in the art will understand that when the detection target is changed to other tRNAs, a corresponding VMC10 can be designed based on the target sequence. A20p The ribozyme cleaved the sequence and then performed stability testing.

[0044] In some embodiments of the present invention, the tRNA is derived from humans.

[0045] A third aspect of the present invention provides a set of methods for detecting tRNA. Met tRNA His tRNA Ala Stable reagents:

[0046] When detecting tRNA Met The ribozyme with sequences as shown in SEQ ID NO: 3 and 5, and primers and probes with sequences as shown in SEQ ID NO: 6, 7, 8 and 11.

[0047] When detecting tRNA His The ribozyme with the sequence shown in SEQ ID NO: 12, and the primers and probes with the sequences shown in SEQ ID NO: 13, 14, 8, and 15.

[0048] When detecting tRNA Ala The ribozyme with the sequence shown in SEQ ID NO: 16, and the primers and probes with the sequences shown in SEQ ID NO: 17, 18, 8, and 19.

[0049] The beneficial effects of this invention are:

[0050] This invention discovers that when using tRNA unmodified sites (such as tRNA) Met A52 site, tRNA His When the A63 site is used as the cleavage target, the more compact the spatial structure of the tRNA, the more it will hinder VMC10. A20p It pairs with tRNA and inhibits its cleavage of the tRNA target. By comparing the cleavage product levels of the tRNA target in different biological samples, the relative stability of the spatial structure of the tRNA target can be detected. Therefore, this invention provides a method for detecting tRNA structure, using VMC10 A20p The upstream and downstream arms of the device are complementary to the upstream and downstream unmodified sites of the tRNA to be tested. A cleavage sequence is designed for the unmodified sites of the tRNA to be tested, and the tRNA to be tested is cleaved. The stability of the tRNA is judged based on the cleavage results. Attached Figure Description

[0051] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0052] Figure 1 VMC10 of the present invention A20p Diagram showing the pairing and cutting process.

[0053] Figure 2 This is an example diagram illustrating the detection principle of the present invention.

[0054] Figure 3 VMC10 A20p Targeting tRNA Met The cleavage results at different sites are shown, where A represents the cleavage result at the A52 site, B represents the cleavage result at the 43 site, and C represents the tRNA fragment level at the A52 site detected by RT-qPCR after ribozyme cleavage.

[0055] Figure 4 VMC10 A20p The A52 bits of Oligo-Met contain (Oligo-Met-m) 1 A) or does not contain (Oligo-Met-A)m 1 The cleavage result of tRNA when modified by A.

[0056] Figure 5 For cells to overexpress m 1 Before and after demethylase ALKBH3, VMC10 A20p Targeting endogenous tRNA Met The A52-bit cutting result.

[0057] Figure 6 For cells to overexpress m 1 Before and after demethylase ALKBH3, VMC10 A20p Detection results for different endogenous tRNAs. Where A represents tRNA. Met The result of the cleavage at position A64, B is tRNA. His The cleavage result at position A63, where C represents tRNA. Ala The cutting result of bit A63 on the screen.

[0058] Figure 7 VMC10 A20p Endogenous tRNA in different cells Met The detection results (Y-axis represents the Ct difference of RT-qPCR (ΔCt = Ct) 未切割 - Ct 核酶切割 ), where A is transmitted via tRNA Met Probe enrichment of endogenous tRNA Met The detection results, B represents the detection of endogenous tRNA in total RNA. Met The direct test results, A and B are VMC10 A20p Targeting tRNA Met The detection results after A52 site cleavage, C represents tRNA from different cells. Met m 1 A. Statistical results of modification rate. Detailed Implementation

[0059] The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.

[0060] The principle of this invention is: when using tRNA unmodified sites (such as tRNA) Met A52, tRNA His When A63 is the cleavage target, loosely structured tRNAs are more likely to bind to VMC10. A20p Complementary pairing, thus being VMC10 A20p Cleavage; and the compact tRNA hinders VMC10. A20p Incorporation of tRNA thereby inhibits VMC10 A20p The cleavage of tRNA, therefore, can be based on VMC10. A20p The structural stability of tRNA is determined by its cleavage efficiency. The detection principle is as follows: Figure 2 As shown. Since tRNAs are highly conserved in length, theoretically, positions 52 or 63 of other tRNAs should be A and unmodified, serving as cleavage sites (except for a few tRNAs where position 64 is A, but this is still different from the tRNA). Met The A63 sequence is conserved.

[0061] Taking SEQ ID NO:3 as an example, its enzyme activity sequence targets tRNA. Met The enzyme is cleaved at position A52, while positions A1-A19 of the active enzyme center remain unchanged, and position A20 is cleaved by the tRNA. Met A50 site (the -2 position of the cleavage site) complementary pairing.

[0062] For other tRNAs and cleavage sites, positions A1-A19 of the enzyme active center remain unchanged, while position A20 is complementary to position -2 of the cleavage site (the two positions preceding it in the 5' direction). This is because VMC10... A20p tRNA cleavage activity requires the correct tRNA spatial structure for activation, but variable loop structures are complex and may affect VMC10. A20p To ensure effective cleavage, the cleavage site needs to be designed in the non-variable region of the tRNA and should ideally be free of natural modifications that might affect cleavage.

[0063] The sequence information involved in this invention is as follows:

[0064] Name Sequence (5’ → 3’) Oligo-Met-A GCCUCGUUAGCGCAGUAGGUAGCGCGUCAGUCUCAUAAUCUGAAGGUCGUGAGUUCGAUCCUCACACGGGGCACCA (SEQ ID NO: 1) <![CDATA[Oligo Met-m 1 A]]> <![CDATA[GCCUCGUU A(m 1 A) GCGCAGUAGGUAGCGCGUCAGUCUCAUAAUCUGAAGGUCGUGAGUUCG A(m 1 A) UCCUCACACGGGGCACCA(SEQ ID NO:2)]]> <![CDATA[VMC10 A20p (tRNA Met A52)]]> <![CDATA[GGATCGAAC GGGTCTCCAGCTGGACGTTA CGACCTTCA(SEQ ID NO:3)]]> <![CDATA[VMC10 A20p (tRNA Met A43)]]> <![CDATA[TCACGACCT GGGTCTCCAGCTGGACGTTA GATTATGAG(SEQ ID NO:4)]]> <![CDATA[VMC10 A20p (tRNA Met A64)]]> <![CDATA[TGCCCCGT GGGGTCTCCAGCTGGACGTTG GGATCGAAC(SEQ ID NO:5)]]> SL-Met-A52 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCACGAC (SEQ ID NO: 6) RT-Met-A52_F CGCGTCAGTCTCATAATCTGAAG (SEQ ID NO: 7) RT_R AGTGCAGGGTCCGAGGTATT (SEQ ID NO: 8) SL-Met-A64 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGATCG (SEQ ID NO: 9) RT-Met-A64_F CTCATAATCTGAAGGTCGTGAGTT (SEQ ID NO: 10) <![CDATA[tRNA eMetCAT ]]> biotin- TGCCCCGTGTGAGGATCGAACTCACGACCT (SEQ ID NO: 11) <![CDATA[VMC10 A20p (tRNA His A63)]]> <![CDATA[TGCCGTGAC GGGTCTCCAGCTGGACGTTG GATTCGAAC(SEQ ID NO:12)]]> SL-His-A63 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCGGATT (SEQ ID NO: 13) RT-His-A63_F GCAGCAACCTCGGTTCG (SEQ ID NO: 14) <![CDATA[tRNA HisGTG ]]> 5′biotin-TGCCGTGACTCGGATTCGAACCGAGGTTGCTG (SEQ ID NO: 15) <![CDATA[VMC10 A20p (tRNA Ala A63)]]> TGGAGGTACGGGTCTCCAGCTGGACGTTGGGATCGAAC (SEQ ID NO: 16) SL-Ala-A63 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCGGGATC (SEQ ID NO: 17) RT-Ala-A63_F GCACGAGGTCCTGGGTTC (SEQ ID NO: 18) <![CDATA[tRNA AlaAGC ]]> 5′biotin-AGGTACTGGGGATCGAACCCAGGACCTCGT (SEQ ID NO: 19)

[0065] Example 1 VMC10 A20p It can cleave tRNA Met A52 position of oligonucleotide

[0066] The inventors' preliminary experimental data revealed that VMC10 A20pIt can cleave tRNA and produce tRNA fragments. When the cleavage target is the unmodified tRNA site A52, the more compact the spatial structure of the tRNA, the more it will hinder VMC10. A20p It pairs with tRNA and prevents it from cleaving the tRNA target.

[0067] Literature indicates that natural tRNA contains m at positions A9 and A58. 1 A modifier, especially A58-bit m 1 A modification has been reported to stabilize tRNA folding and structural stability. The 58th position of the tRNA m... 1 A is crucial for the structure, stability, and translation initiation of tRNA; if this position is missing, m 1 A may promote the production of tRNA-derived small RNAs (tDRs), enhance ribosome assembly, and lead to a malignant phenotype in tumor cells. Furthermore, the 9th m of tRNA... 1 A also has a significant impact on the structure and stability of tRNA.

[0068] Therefore, this embodiment designs a m with the 9th and 58th bits. 1 Oligo tRNA, a substrate modified with A eMet -m 1 A. Verify structural stability by mimicking endogenous tRNA as much as possible.

[0069] In this embodiment, sites A52 and A43 were selected for the following reasons:

[0070] 1) These two sites do not have any natural modifications and will not have any potential impact on ribozyme cleavage.

[0071] 2) The A52 and A43 sites are located on or near the T loop structure of tRNA. Previous experiments have shown that VMC10’s cleavage activity for tRNA is activated only when the A20 site of the enzyme active center of VMC10 achieves base complementarity with the -2 site of the cleavage site (unmodified) of the T loop of tRNA. Otherwise, tRNA stability cannot be detected by ribozyme cleavage.

[0072] The specific experimental method is as follows:

[0073] 10 pmol deoxyribonuclease VMC10 A20p (tRNA Met A52 is the cleavage target (SEQ ID NO: 3), and the deoxyribonuclease VMC10. A20p (tRNA Met A43 is the cleavage target (SEQ ID NO: 4), and 1 pmol of substrate Oligo-Met-m 1A and water were mixed to a final volume of 7 μL. The mixture was incubated at 95 °C for 5 min, followed by 25 °C for 15 min. To initiate the enzymatic digestion reaction, buffer Tris-HCl (50 mM, pH 7.5), NaCl (150 mM), and MgCl2 (50 mM) were added, and the reaction mixture was incubated at 37 °C for 10 h.

[0074] After enzyme digestion, denaturing PAGE analysis was performed using 7M urea. After SYBR Gold staining, the PAGE gel was imaged using an ultra-high sensitivity chemiluminescence imaging system.

[0075] Take 1 μL of the enzyme digestion product and add the specific reverse transcription primer SL-Met-A52 (SEQ ID NO: 6) for stem-loop reverse transcription. After generating cDNA, add primers RT-Met-A52_F and RT_R (SEQ ID NO: 7, 8) for real-time quantitative PCR to determine the content of the generated enzyme digestion fragments.

[0076] Experimental results:

[0077] PAGE gel results are as follows Figure 3 As shown in Figures A and B, VMC10 A20p Processing Oligo-Met-m 1 The A52 site of enzyme A produced a corresponding cleavage fragment band, while treatment of the A43 site failed to cleave the substrate, indicating that VMC10... A20p It can cleave tRNA Met The A52 position (not A43) of the oligonucleotide. RT-qPCR results showed that VMC10 A20p (tRNA Met A52) Processed Oligo-Met-m 1 A has a lower Ct value ( Figure 3 (C), indicating VMC10 A20p (tRNA) Met A52) can target tRNA Met The enzyme cleavage occurs at position A52, producing a fragment.

[0078] The A43 site cannot be cleaved, possibly because ribozymes require spatial proximity between the ribozyme and the cleavage site on the tRNA. However, the ribozyme's cleavage activity is only effectively activated when it is close to the T-loop structure of the tRNA. The A43 site is located near the variable loop of the tRNA, which may alter the spatial position of the ribozyme and tRNA, thus failing to provide the correct spatial structure for activation of the ribozyme cleavage center, and therefore cannot be cleaved by the ribozyme.

[0079] Example 2 VMC10A20p (A52) Reduced cleavage of structurally more stable tRNAs

[0080] This embodiment designs Oligo-Met-m 1 Two substrates, A and Oligo-Met-A, wherein Oligo-Met-m 1 The 9th and 58th bits of A contain m. 1 With the addition of A, its structure becomes more stable.

[0081] Experimental methods:

[0082] 10 pmol deoxyribonuclease VMC10 A20p (tRNA Met A52 is the cleavage target (SEQ ID NO: 3), and 1 pmol of substrate Oligo-Met-m 1 Mix A (SEQ ID NO: 2) or Oligo-Met-A (SEQ ID NO: 1) with water to a final volume of 7 μL. Incubate the mixture at 95 °C for 5 min, followed by 25 °C for 15 min. To initiate the digestion reaction, add buffer Tris-HCl (50 mM, pH 7.5), NaCl (150 mM), and MgCl2 (50 mM), and incubate the reaction mixture at 37 °C for 10 h. After digestion, take 1 μL of the digestion product and add the specific reverse transcription primer SL-Met-A52 (SEQ ID NO: 6) for stem-loop reverse transcription. After generating cDNA, add primers RT-Met-A52_F and RT_R (SEQ ID NO: 7, 8) for real-time quantitative PCR to determine the content of the generated digested fragments.

[0083] Experimental results:

[0084] RT-qPCR results are as follows Figure 4 As shown.

[0085] Consistent with the PAGE gel results in Example 1, and with VMC10 A20p Oligo-Met-m after (Met A52) processing 1 Compared to A, VMC10 A20p (tRNA) Met The A52-processed Oligo-Met-A has a lower Ct value, indicating that VMC10 A20p (tRNA) Met A52 is more easily incorporated into tRNA and forms complementary pairs, subsequently cleaving the tRNA and generating more cleaved fragments, indicating that tRNA... Met The oligonucleotide contains m 1During A-methylation modification, the cleavage of VMC10 at the A52 position decreases, i.e., it contains m 1 A-methylated tRNAs have a more stable structure, which is consistent with previous literature reports on m 1 A modification plays a role in stabilizing tRNA structure. This further demonstrates that VMC10 (tRNA) Met The A52 position can be used as a cleavage site for tRNA. Met The stability of the sample can be detected and quantified by RT-qPCR.

[0086] Example 3 VMC10 A20p (Met A52) can detect the degree of structural looseness of endogenous tRNA.

[0087] 1. Experimental materials:

[0088] VMC10 A20p (tRNA Met A52.SEQ ID NO: 3), HEK-293T, Dynabeads™ M-280 streptavidin, Qubit™ RNA HS Quantitative Kit, biotinylated probe tRNA eMetCAT (SEQ ID NO: 11), reverse transcription primer SL-Met-A52 (SEQ ID NO: 6); PCR primers RT-Met-A52_F and RT_R (SEQ ID NO: 7, 8).

[0089] 2. Experimental Methods

[0090] 2.1 Pretreatment of HEK293T cells: HEK-293T WT control group and cells overexpressing m... 1 Group A demethylase ALKBH3.

[0091] ALKBH3 expression sequence:

[0092] ATGGAGGAAAAAAGACGGCGAGCCCGAGTTCAGGGAGCCTGGGCTGCCCCTGTTAAAAGCCAGGCCATTGCTCAGCCAGCTACCACTGCTAAGAGCCATCTCCACCAGAAGCCTGGCCAGACCTGGAAGAACAAAGAGCATCATCTCTCTGACAGAGAGTTTGTGTTCAAAGAACCTCAGCAGGTAGTACGTAGAGCTCCTGAGCCACGAGTGATTGACAGAGAGGGTGTGTATGAAATCAGCCTGTCACCCACAGGTGTATCTAGGGTCTGTTTGTATCCTGGCTTTGTTGACGTGAAAGAAGCTGACTGGATATTGGAACAGCTTTGTCAAGATGTTCCCTGGAAACAGAGGACCGGCATCAGAGAGGATATAACTTATCAGCAACCAAGACTTACAGCATGGTATGGAGAACTTCCTTACACTTATTCAAGAATCACTATGGAACCAAATCCTCACTGGCACCCTGTGCTGCGCACACTAAAGAACCGCATTGAAGAGAACACTGGCCACACCTTCAACTCCTTACTCTGCAATCTTTATCGCAATGAGAAGGACAGCGTGGACTGGCACAGTGATGATGAACCCTCACTAGGGAGGTGCCCCATTATTGCTTCACTAAGTTTTGGTGCCACACGCACATTTGAGATGAGAAAGAAGCCACCACCAGAAGAGAATGGAGACTACACATATGTGGAAAGAGTGAAGATACCCTTGGATCATGGGACCTTGTTAATCATGGAAGGAGCGACACAAGCTGACTGGCAGCATCGAGTGCCCAAAGAATACCACTCTAGAGAACCGAGAGTGAACCTGACCTTTCGGACAGTCTATCCAGACCCTCGAGGGGCACCCTGGTGA (5'-3', SEQ ID NO: 20).

[0093] This sequence was inserted into the PPB vector to construct an overexpression vector.

[0094] 2.2 Isolation and purification of specific tRNA:

[0095] Total RNA was extracted from HEK-293T cells in the control group and the ALKBH3 overexpression group using Trizol reagent. 30 μL of M-280 streptavidin magnetic beads were washed three times with binding / washing buffer (5 mM Tris-HCl, pH 7.5, 0.5 mM EDTA, 1 M NaCl) to remove any potential impurities. The washed magnetic beads were then mixed with biotinylated probe tRNA. eMetCAT (SEQ ID NO: 11) was mixed and incubated at 4°C for 2 h. After incubation, the magnetic beads were washed four times with binding / washing buffer to remove unbound biotinylated probes. The magnetic beads were then equilibrated in 6×SSC solution (0.9 M NaCl, 0.09 M sodium citrate, pH 7.0). The magnetic beads and the SSC solution containing total RNA were incubated separately at 75°C for 10 min, then mixed and incubated at 75°C for another 10 min to allow tRNA to bind to the biotinylated probes on the magnetic beads. The tRNA-bound magnetic beads were incubated at room temperature for 4 h to ensure sufficient binding. After room temperature incubation, the magnetic beads were washed three times with 3×SSC solution to remove unbound RNA and other impurities. Then, they were washed twice with 1×SSC solution and once with 0.1×SSC solution. Finally, the tRNA on the magnetic beads was eluted with 10 μL of RNase-free water at 70°C for 5 min. tRNA was measured on a Qubit® 3.0 fluorometer using the Qubit™ RNA HS Quantitative Kit. eMetCAT The concentration.

[0096] 2.3 Deoxyribonuclease VMC10 A20p (tRNA Met A52 (50 pmol) and 100 ng tRNA obtained by isolation and purification Met Mix with water to a final volume of 14 μL. Incubate the mixture at 95 °C for 5 min, followed by 25 °C for 15 min. To initiate the digestion reaction, add buffer Tris-HCl (50 mM, pH 7.5), NaCl (150 mM), and MgCl2 (50 mM), and incubate the reaction mixture at 37 °C for 12 hours. After digestion, quantify the resulting digested fragments using RT-qPCR. Take 2 μL of the digestion product, add reverse transcription primer SL-Met-A52 (SEQ ID NO: 6) for stem-loop reverse transcription, generate cDNA, and then add primers RT-Met-A52_F and RT_R (SEQ ID NO: 7, 8) for real-time quantitative PCR to determine the content of the generated digested fragments.

[0097] 3. Experimental Results

[0098] The results are as follows Figure 5 As shown.

[0099] Cellular overexpression of m 1 After the demethylase ALKBH3, endogenous tRNA... Met m 1 A modification is reduced, VMC10 A20p (tRNA) Met Increased cleavage at the A52 position (mock control group vs. overexpression group) indicates that removal of m 1 A-methylation modification can loosen the structure of tRNA, VMC10 A20p (tRNA) Met A52 is more easily incorporated into tRNA and forms a complementary pair, subsequently affecting the tRNA. Met It performs cutting and produces more enzyme fragments.

[0100] Example 4: Removal of m 1 A-methylation modification can loosen the structure of endogenous tRNA.

[0101] 1. Experimental materials:

[0102] VMC10 A20p (tRNA Met A64, SEQ ID NO: 5), VMC10 A20p (tRNA His A63, SEQ ID NO: 12), VMC10 A20p (tRNA Ala A63 (SEQ ID NO: 16), HEK-293T, Dynabeads™ M-280 streptavidin, Qubit™ RNA HS Quantitative Kit, biotinylated probe tRNA eMetCAT (SEQ ID NO: 11), tRNA HisGTG (SEQ ID NO: 15), tRNA AlaAGC(SEQ ID NO: 19), reverse transcription primers SL-Met-A64 (SEQ ID NO: 9), SL-His-A63 (SEQ ID NO: 13), SL-Ala-A63 (SEQ ID NO: 17); PCR primers RT-Met-A64_F (SEQ ID NO: 10), RT-His-A63_F (SEQ ID NO: 14), RT-Ala-A63_F (SEQ ID NO: 18) and RT_R (SEQ ID NO: 8).

[0103] 2. Experimental Methods

[0104] 2.1 Pretreatment of HEK293T cells: HEK-293T WT control group and cells overexpressing m... 1 Group A demethylase ALKBH3.

[0105] 2.2 Isolation and purification of specific tRNAs:

[0106] Total RNA was extracted from HEK-293T cells in the control group and the ALKBH3 overexpression group using Trizol reagent. 30 μL of M-280 streptavidin magnetic beads were washed three times with binding / washing buffer (5 mM Tris-HCl, pH 7.5, 0.5 mM EDTA, 1 M NaCl) to remove any potential impurities. The washed magnetic beads were then mixed with biotinylated probe tRNA. eMetCAT (SEQ ID NO: 11) or tRNA HisGTG (SEQ ID NO: 15) or tRNA AlaAGC(SEQ ID NO: 19) was mixed and incubated at 4°C for 2 h. After incubation, the magnetic beads were washed four times with binding / washing buffer to remove unbound biotinylated probes. The magnetic beads were then equilibrated in 6×SSC solution (0.9 M NaCl, 0.09 M sodium citrate, pH 7.0). The magnetic beads and the SSC solution containing total RNA were incubated separately at 75°C for 10 min, then mixed and incubated at 75°C for another 10 min to allow tRNA to bind to the biotinylated probes on the magnetic beads. The tRNA-bound magnetic beads were incubated at room temperature for 4 h to ensure sufficient binding. After room temperature incubation, the magnetic beads were washed three times with 3×SSC solution to remove unbound RNA and other impurities. Then, they were washed twice with 1×SSC solution and once with 0.1×SSC solution. Finally, the tRNA on the magnetic beads was eluted with 10 μL of RNase-free water at 70°C for 5 min. tRNA was measured on a Qubit® 3.0 fluorometer using the Qubit™ RNA HS Quantitative Kit. eMetCAT tRNA HisGTG or tRNA AlaAGC The concentration.

[0107] 2.3 Deoxyribonuclease VMC10 A20p (Met A64) (50 pmol) and 100 ng tRNA obtained by isolation and purification eMet Mix with water, or VMC10 A20p (His A63) (50 pmol) and 100 ng tRNA obtained by isolation and purification His Mix with water, or VMC10 A20p (Ala A63) (50 pmol) and 100 ng tRNA obtained by isolation and purification AlaMix with water to a final volume of 14 μL. Incubate the mixture at 95 °C for 5 min, followed by 25 °C for 15 min. To initiate the digestion reaction, add buffer Tris-HCl (50 mM, pH 7.5), NaCl (150 mM), and MgCl2 (50 mM), and incubate the reaction mixture at 37 °C for 12 h. After digestion, quantify the resulting digested fragments using RT-qPCR. Take 2 μL of the enzyme digestion product, add reverse transcription primers SL-Met-A64 (SEQ ID NO: 9) or SL-His-A63 (SEQ ID NO: 13) or SL-Ala-A63 (SEQ ID NO: 17) for stem-loop reverse transcription to generate cDNA. Then add primers RT-Met-A64_F or RT-His-A63_F or RT-Ala-A63_F and RT_R (SEQ ID NO: 10, 14, 18, 8) for real-time quantitative PCR to determine the content of the generated enzyme digestion fragments.

[0108] 3. Experimental Results

[0109] The results are as follows Figure 6 As shown.

[0110] Figure 6 A shows that cells overexpress m 1 After the demethylase ALKBH3, endogenous tRNA... eMet m 1 A modification is reduced, VMC10 A20p (tRNA) Met Increased cleavage at the A64 site (control group mock vs overexpression group). Figure 6 B represents cells overexpressing m 1 After A demethylase ALKBH3, VMC10 A20p (His A63) affects endogenous tRNA His Increased A63 cleavage (mock control group vs overexpression group). Figure 6 C represents the cell overexpression of m 1 After A demethylase ALKBH3, VMC10 A20p (Ala A63) on endogenous tRNA Ala Increased A63 cleavage (mock control group vs. overexpression group). This indicates that removal of m... 1 A-methylation modification can loosen the structure of tRNA, VMC10 A20p (tRNA) Met A64) or VMC10 A20p (tRNA)His A63) or VMC10 A20p (tRNA) Ala A63 is more likely to be incorporated into the corresponding tRNA and pair with it, subsequently cleaving the tRNA and generating more enzyme fragments.

[0111] Example 5

[0112] This embodiment detects tRNA in normal colonic epithelial cells (NCM460), moderately malignant metastatic colon cancer cells (SW480), and highly malignant metastatic colon cancer cells (SW620). Met Structural stability.

[0113] 1. Experimental Materials and Methods

[0114] VMC10 A20p (Met A52, SEQ ID NO: 3), SL-Met-A52 (SEQ ID NO: 6), primers RT-Met-A52_F (SEQ ID NO: 7) and RT_R (SEQ ID NO: 8). Other materials included normal colonic epithelial cells (NCM460), moderately malignant metastatic colon cancer cells (SW480), and highly malignant metastatic colon cancer cells (SW620).

[0115] Total RNA was extracted from NCM460, SW480, and SW620 cells using Trizol reagent. RNA could be extracted via tRNA assay. Met Probe enrichment and direct detection of tRNA from total RNA Met tRNA Met Detection of structural stability. Among them, tRNA... Met The probe enrichment and fishing experiment steps are the same as those in 2.2 and 2.3 of Example 3.

[0116] Direct detection of tRNA from total RNA Met Structural stability:

[0117] 10 pmol deoxyribonuclease VMC10 A20p(Met A52, SEQ ID NO: 3), 2-5 μg total RNA, and water were mixed to a final volume of 7 μL. The mixture was incubated at 95 °C for 5 min, followed by 25 °C for 15 min. To initiate the digestion reaction, Tris-HCl (50 mM, pH 7.5), NaCl (150 mM), and MgCl2 (50 mM) buffer were added, and the reaction mixture was incubated at 37 °C for 10 h. After digestion, 1 μL of the digestion product was taken and stem-loop reverse transcription was performed using the specific reverse transcription primer SL-Met-A52 (SEQ ID NO: 6). After cDNA generation, real-time quantitative PCR was performed using primers RT-Met-A52_F (SEQ ID NO: 7) and RT_R (SEQ ID NO: 8) to determine the content of the generated digested fragments.

[0118] Experimental results:

[0119] VMC10 A20p Treatment of endogenous tRNA eMet Following the A52 site, the results showed that the higher the malignancy of the tumor, the higher the VMC10 A20p The fewer the A52 bits are cut ( Figure 7 (A and B) indicate that the more malignant the tumor, the more compact the tRNA structure. This may be due to the fact that tRNAs in cells with higher malignancy have more compact structures. Met The A58 site has a higher degree of m 1 A is caused by the level of modification ( Figure 7 (C)

[0120] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments, and various changes can be made within the scope of knowledge possessed by those skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.

Claims

1. VMC10 A20p Application of ribozymes in the preparation of products for detecting the structural stability of tRNA.

2. The application according to claim 1, characterized in that: The products include reagents and kits.

3. A method for detecting tRNA structural stability, comprising the following steps: 1) Synthesize VMC10 targeting the unmodified sites of tRNA A20p Ribozyme cleavage sequence; 2) VMC10 A20p The ribozyme sequence is mixed with the tRNA to be tested, and then digested. 3) Detect the content of tRNA fragments after enzyme digestion.

4. The method according to claim 3, characterized in that: The unmodified sites include unmodified sites on tRNA; The unmodified site includes tRNA. Met A52 and A64 sites, tRNA His The A63 site, tRNA Ala The A63 site.

5. The method according to claim 3, characterized in that: The VMC10 A20p Nuclease cleavage sequences include the active enzyme sequence and complementary sequences located at both ends of the active enzyme sequence; The enzyme activity sequence is 5'-GGGTCTCCAGCTGGACGTTA-3'; The enzyme activity sequence from the 5' to the 20th position of the 3' end is complementary to the -2 position of the cleavage site; The complementary sequences are complementary to the upstream and downstream sequences of the unmodified sites of tRNA, respectively.

6. The method according to claim 5, characterized in that: The lengths of the upstream and downstream sequences are 4 to 16 bp.

7. The method according to claim 3, characterized in that: The VMC10 A20p The molar ratio of ribozyme cleavage sequence to tRNA to be tested is 1:(0.01~1000).

8. The method according to claim 3, characterized in that: The reaction conditions for the enzyme digestion reaction are as follows: 1) Treat at 90~98℃ for 1~30 min; 2) Cooling treatment; 3) Incubate at 16~42℃ for 2~24h.

9. The method according to claim 3, characterized in that: The enzyme digestion reaction was carried out in a buffer solution.

10. The method according to claim 3, characterized in that: The lower the content of tRNA fragments after enzyme digestion, the higher the structural stability of tRNA.

Images