Recombinant humanized three-type collagen with triple-helix structure as well as production method and application of recombinant humanized three-type collagen

Abstract

The invention belongs to the technical field of bioengineering, particularly relates to a triple-helix structure recombinant humanized three-type collagen as well as a production method and application thereof, particularly discloses the triple-helix structure recombinant humanized three-type collagen, and also discloses a gene for coding the recombinant humanized three-type collagen, and a preparation method of the triple-helix structure recombinant humanized three-type collagen. The invention also discloses an engineering bacterium for producing the recombinant humanized three-type collagen. The invention further discloses a preparation method of the recombinant humanized three-type collagen with the triple-helix structure and application of the recombinant humanized three-type collagen in the fields of biomedical materials, beauty cosmetics, skin care products, medical apparatuses and instruments and the like. Results of the embodiment show that the triple-helix recombinant humanized III-type collagen provided by the invention has the capability of promoting cell proliferation, is free of cytotoxicity and high in cell adhesion activity, and experiments prove that the triple-helix recombinant humanized III-type collagen has a triple-helix structure characterized by collagen.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of bioengineering, and particularly relates to a triple helix structure recombinant humanized type III collagen and a production method and application thereof. BACKGROUND

[0002] Collagen is the most abundant and widely distributed functional protein in mammals, accounting for about 30% of the total amount of proteins in the animal body; has good biocompatibility and functions of wound hemostasis, healing, filling, repair, etc., and is an ideal medical biomaterial.

[0003] In the prior art, collagen obtained by extraction methods is often accompanied by immunogenicity, and with the development of synthetic biology, recombinant expression by genetic engineering means has gradually become the mainstream. However, only single-chain collagen is synthesized, and such recombinant collagen lacks key collagen characteristics, such as triple helix structure, modification of proline and lysine residues, and resistance to enzyme degradation, resulting in easy degradation of collagen and low stability, which is difficult to meet the market demand for high-quality collagen.

[0004] Therefore, there is an urgent need for a recombinant humanized collagen with collagen characteristics. SUMMARY

[0005] The application aims to provide a triple helix structure recombinant humanized type III collagen, and the method provided by the application not only has key collagen characteristics, but also can be prepared on a large scale, simply and at a low cost.

[0006] In order to achieve the above-mentioned purpose, the application provides the following technical scheme:

[0007] The application provides a recombinant humanized type III collagen, and the amino acid sequence of the recombinant humanized type III collagen is shown as SEQ No. 1.

[0008] Preferably, the recombinant humanized type III collagen has a triple helix structure.

[0009] On the other hand, the application provides a gene fragment encoding a triple helix structure recombinant humanized type III collagen, and the nucleotide sequence of the gene fragment is shown as SEQ ID NO. 2.

[0010] On the other hand, the application provides an engineering bacterium, and the engineering bacterium comprises the above-mentioned gene fragment.

[0011] Preferably, the engineering bacterium is a Pichia pastoris expression engineering bacterium.

[0012] On the other hand, the application provides a construction method of the above-mentioned engineering bacterium, and the method comprises the following steps:

[0013] S1, cloning the gene fragment shown in SEQ ID NO. 2 into a eukaryotic expression vector to obtain a recombinant plasmid;

[0014] S2, transfecting the recombinant plasmid obtained in S1 into Pichia pastoris cells to obtain Pichia pastoris expression engineering bacteria.

[0015] Preferably, the method further comprises S3, obtaining a high-efficiency secretory expression triple-helix recombinant humanized type III collagen expression strain by culturing and high-copy screening of the Pichia pastoris expression engineering bacteria obtained in S2. The strain is named COLIII-24.

[0016] Preferably, the eukaryotic expression vector in S1 is pPiC9K.

[0017] In another aspect, the present application also provides a preparation method of a triple-helix recombinant humanized type III collagen, which comprises the following steps:

[0018] The triple-helix recombinant humanized type III collagen is expressed by the engineering bacteria or the engineering bacteria obtained by the method, and then is separated and purified to obtain.

[0019] In another aspect, the present application also provides the use of the recombinant humanized type III collagen in the preparation of drugs, cosmetics and medical devices.

[0020] Advantages

[0021] The triple-helix recombinant humanized type III collagen has good hydrophilicity and high activity.

[0022] The triple-helix recombinant humanized type III collagen is prepared by the method of engineering bacteria fermentation, and has the advantages of large scale, simplicity and low cost.

[0023] The triple-helix recombinant humanized type III collagen can be applied to the fields of biomedical materials, cosmetics, skin care products and medical devices. BRIEF DESCRIPTION OF DRAWINGS

[0024] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.

[0025] Figure 1 The figure shows the construction of a triple-helix recombinant humanized type III collagen expression plasmid.

[0026] Figure 2 Figure 1 is a genomic sequencing map of the expression strain COL III-24.

[0027] Figure 3 Figure 2 is a schematic diagram of SDS-PAGE running gel of fermentation products of the expression strain COL III-24.

[0028] Figure 4 Figure 3 is a graph of the results of the cell relative adhesion rate experiment in Example 4.

[0029] Figure 5 Figure 4 is a graph of the results of the cell relative proliferation rate experiment in Example 5.

[0030] Figure 6 Figure 5 is a graph of the results of the circular dichroism identification in Example 6.

[0031] Figure 7 Figure 6 is a graph of the thermal denaturation curve in Example 6.

[0032] Figures 4-7 Figure 7 is a graph of the circular dichroism identification of the recombinant humanized type III collagen protein prepared in the present application DETAILED DESCRIPTION

[0033] The present application provides a recombinant humanized type III collagen protein having a triple helix structure.

[0034] The present application also provides a gene encoding the recombinant humanized type III collagen protein, and an engineering bacterium for producing the recombinant humanized type III collagen protein, which can be any bacterium capable of expressing the recombinant humanized type III collagen protein, preferably a eukaryotic expression bacterium, and more preferably a Pichia pastoris expression bacterium.

[0035] The present application also provides a preparation method of the recombinant humanized type III collagen protein, which comprises expressing the engineering bacterium containing the gene encoding the recombinant humanized type III collagen protein to obtain the recombinant humanized type III collagen protein. Preferably, the engineering bacterium is a Pichia pastoris expression engineering bacterium, and more preferably, the method further comprises a separation and purification step.

[0036] In order to further illustrate the present application, the technical solutions provided by the present application are described in detail below in conjunction with the drawings and examples, but they should not be understood as limiting the scope of protection of the present application.

[0037] The production process, experimental method or detection method involved in the embodiments of the present application are all conventional methods in the prior art if not otherwise specified, and their names and / or abbreviations are all conventional names in the field, which are very clear and explicit in the related application field, and the skilled in the art can understand the conventional process steps and apply the corresponding equipment according to the conventional conditions or the conditions recommended by the manufacturer.

[0038] The various instruments, equipment, raw materials or reagents used in the embodiments of the present application are not particularly limited in origin, and are conventional products that can be purchased through normal commercial channels, or can be prepared according to conventional methods well known to those skilled in the art. For example, the BMGY and BMMY culture media are prepared according to well-known formulations in the art.

[0039] Example 1

[0040] Construction of Pichia pastoris expression engineering bacteria

[0041] A pPIC9K (purchased from Invitrogen Corporation) was used as a backbone, and an optimized gene sequence was introduced into a multiple cloning site to obtain pPIC9K-COL III-24, which was then transformed into Pichia pastoris GS115, and the detailed steps are as follows:

[0042] S1, according to the mature peptide sequence of human collagen type III published by the protein resource database UniProt (website https: / / www.uniprot.org / ), after screening and optimization, the amino acid sequence shown in SEQ ID NO: 1 was obtained.

[0043] SEQ ID NO: 1

[0044] KRGPPGPPGPPGPPGPPGPPGPPGPPGPPGPPGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGEKGAPGERGERGAPGEKGE

[0045] The last "*" of the sequence represents the translation termination.

[0046] S2, the gene sequence was reversely designed by using online design tool Jcat (http: / / www.jcat.de / ), and the Xhol and NotI enzyme cutting sites were removed in the design process for the preferred codons required for the expression of the host Pichia pastoris. The optimized COL III-24 gene was synthesized by Jinsuirui Biotechnology Co., Ltd., and the optimized gene sequence is shown in SEQ ID NO: 2.

[0047] SEQ ID NO: 2

[0048]

[0049] S3, the target gene shown in SEQ ID NO. 2 is introduced into Xhol and NotI double enzyme digestion sites, inserted into the expression vector pPIC9K to obtain a recombinant plasmid (schematic diagram see Figure 1 ), linearize the recombinant plasmid and respectively electrotransform into Pichia pastoris GS115, identify by colony PCR and send to Beijing Qikexing Biotechnology Co., Ltd. for sequencing (schematic diagram see Figure 2 ) The identified primer F and R base sequence are shown in SEQ ID NO: 3 and SEQ ID NO: 4.

[0050] SEQ ID NO: 3 tgttgctgttttgccattttccaac

[0051] SEQ ID NO: 4 tcacgggggccccggtgggcccggc

[0052] Finally, the recombinants with correct sequencing are screened.

[0053] The recombinants are respectively coated on YPD solid plates containing G418 concentrations of 0.5 mg / ml, 1 mg / ml, 2 mg / ml and 4 mg / ml, and placed in a 30°C incubator for 2-3 days. The growth state of the recombinants is observed, and the G418 concentration of 2 mg / ml grows best, and the positive strain is screened.

[0054] Example 2

[0055] Preparation of triple helix structure of recombinant humanized type III collagen

[0056] Take the positive strains identified in Example 1 (named 1#, 2#, 3# and 4#), 50 μl is inoculated into a conical flask containing 10 ml BMGY, and cultured at 30°C, 220 r / min overnight. Shake to OD600=2-6 (logarithmic growth, about 16-18 h). Centrifuge at room temperature at 5000 r / min for 5 min, collect the cells, remove the supernatant, and resuspend the cells with 10 ml BMMY for induction expression. Take 1 ml sample from the culture medium every 24 h, and add methanol to a final concentration of 1.0% for continuous induction. Centrifuge the samples at 10000 r / min for 2 min at the following time points 0, 24, 48, 72 and 96 h to collect the supernatant, and perform 96 h SDS-PAGE gel verification (schematic diagram see Figure 3 , Figure 3 Lane 1 is Marker, lanes 2-4 are positive clones 1, 2, 3 and 4, and lane 5 is wild type GS115).

[0057] Example 3

[0058] Purification of triple helix structure recombinant humanized type III collagen product

[0059] The fermentation broth of the 2# strain in Example 2 was centrifuged to collect the supernatant. The supernatant was filtered through a filter membrane and then purified by gel column chromatography. The product was obtained by freeze-drying. The specific purification steps of the human recombinant collagen are as follows: centrifuge the fermentation broth at 4200 rpm for 30 min to collect the supernatant. The supernatant was concentrated and washed by ultrafiltration membrane to remove salt and pigment. An appropriate amount of the collagen solution was separated and purified by SP resin column chromatography. The collagen-containing eluate was collected, washed, desalted and concentrated by ultrafiltration membrane. The target protein was collected by freeze-drying.

[0060] Example 4

[0061] Triple helix structure recombinant humanized type III collagen adhesion experiment

[0062] Logarithmic growth phase HSF cells (human skin fibroblasts) were inoculated in a 96-well plate at a density of 1×10 5 / mL, 100 μL per well, and divided into a control group and an experimental group. They were placed in a carbon dioxide cell culture incubator at 37°C and 5% CO2 for conventional culture for 24 h. The triple helix structure recombinant humanized type III collagen sample obtained in Example 3 was prepared with serum-free culture medium, and the solution concentration was 0.5 mg / ml. The solution was filtered through a 0.22 μm filter membrane to remove bacteria. Commercial collagen competitors were also prepared to a concentration of 0.5 mg / ml, and the solution was filtered through a 0.22 μm filter membrane to remove bacteria.

[0063] After the HSF cells were conventionally cultured for 24 h, the old culture medium was discarded, 100 μL of serum-free culture medium was added to the blank group, which did not contain serum or collagen and served as a negative control. The control group was added with 100 μL of commercial collagen competitor solution. The experimental group was added with 100 μL of triple helix structure recombinant humanized type III collagen sample solution, and each group had 3 parallel samples. After continuing to culture for 24 h, the culture medium was discarded, 100 μL of CCK-8 (purchased from Shengong Bioengineering (Shanghai) Co., Ltd.) diluted 10 times with serum-free culture medium was added to each well, and it was placed in a cell culture incubator for continued incubation for 2 h. The absorbance was measured at 450 nm wavelength by an enzyme marker. Thus, the relative cell adhesion rate (see Figure 4 , where DMEM represents the blank group negative control, and 24 represents the experimental group) can be calculated. The adhesion rate of the cells can reflect the activity of the collagen. The higher the activity of the protein, the better the external environment it can provide for the cells in a short time, and the better it can help the cells to adhere. The adhesion rate of the cells can reflect the activity of the collagen. Taking the adhesion rate of the blank group as 1, the relative cell adhesion activity of the triple helix structure recombinant humanized type III collagen was calculated, which was 178% in the experimental group and only 121.3% in the control group.

[0064] Example 5

[0065] Cell relative growth rate of triple-helical structure recombinant humanized type III collagen

[0066] Logarithmic growth phase HSF cells (human skin fibroblasts) were inoculated at a density of 1 x 10 5 μL in a 96-well plate, and divided into a control group and an experimental group. They were placed in a carbon dioxide cell culture incubator at 37°C and 5% CO2 for routine culture for 24 h. The triple-helical structure recombinant humanized type III collagen sample solution obtained in Example 3 was prepared with serum-free culture medium at a concentration of 0.5 mg / ml, and the solution was filtered with a 0.22 μm filter to remove bacteria. Commercially available type III collagen competitors were also prepared at a concentration of 0.5 mg / ml, and the solution was filtered with a 0.22 μm filter to remove bacteria. After the HSF cells were routinely cultured for 24 h, the old culture medium was discarded,

[0067] 100 μL of serum-free culture medium was added to the blank group, which did not contain serum and collagen protein, serving as a negative control; 100 μL of commercially available collagen competitor solution was added to the control group; and 100 μL of triple-helical structure recombinant humanized type III collagen sample solution was added to the experimental group,

[0068] Each group had 3 parallel samples. After 24 h of continuous culture, the culture medium was discarded, and 100 μL of CCK-8 (purchased from Shengong Bioengineering (Shanghai) Co., Ltd.) diluted 10 times with serum-free culture medium was added to each well, and the cells were incubated in the cell culture incubator for 2 h. The cell relative growth rate was detected by the CCK-8 method, and the absorbance was measured at a wavelength of 450 nm by an enzyme marker. The cell relative growth rate (RGR) % was calculated as follows: experimental group absorbance value / normal control group absorbance value x 100% (as shown in the figure, where DMEM represents the blank group negative control, and 24 represents the experimental group). The results showed that the triple-helical structure recombinant humanized type III collagen of the present application had a certain ability to promote cell proliferation and was non-toxic to cells within the selected concentration range. Figure 5

[0069] Example 6

[0070] Triple-helical structure identification

[0071] Circular dichroism is a commonly used method for characterizing protein structure, and the positive peak near 225 nm is a characteristic peak of collagen triple-helical structure. The circular dichroism of the triple-helical structure recombinant humanized type III collagen prepared in the present application and the recombinant type A humanized type III collagen (collagen disclosed in patent No. CN202410768271.5) and commercially available type III collagen competitors were identified, and the results are shown in Figure 6 ​(Figure 24 represents the triple-helix recombinant humanized type III collagen prepared according to this invention). The triple-helix recombinant humanized type III collagen prepared according to this invention has a positive peak at 225 nm, indicating that the triple-helix recombinant humanized type III collagen prepared according to this invention has a triple-helix structure. The peak intensity at 225 nm of the triple-helix recombinant humanized type III collagen sample prepared according to this invention was monitored during the process of heating from 4℃ to 95℃, and its thermal change curve was obtained ( Figure 7 Figure 24 represents the triple-helix recombinant humanized type III collagen prepared in this invention, indicating that the triple-helix recombinant humanized type III collagen has a triple-helix structure at low temperatures, gradually loses its triple helix structure during heating, and transforms into a disordered structure. Circular dichroism spectroscopy characterization results show that the triple-helix recombinant humanized type III collagen possesses the characteristic triple-helix structure of collagen.

[0072] As can be seen from the above embodiments, the triple-helix recombinant humanized type III collagen provided by the present invention has the ability to promote cell proliferation and has no cytotoxicity. It also has high cell adhesion activity and has the triple-helix structure characteristic of collagen.

[0073] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A recombinant humanized type III collagen, characterized in that, The amino acid sequence of the recombinant humanized type III collagen is shown as SEQ No.

1.

2. The recombinant humanized type III collagen according to claim 1, wherein, The recombinant humanized type III collagen has a triple helix structure.

3. A gene segment encoding a recombinant humanized type III collagen with triple helix structure, characterized in that, The nucleotide sequence of the gene fragment is shown as SEQ ID NO.

2.

4. An engineered bacterium, characterized in that, The engineering bacteria comprise the gene fragment of claim 3.

5. The engineered bacteria according to claim 4, characterized in that, The engineering bacteria are Pichia pastoris expression engineering bacteria.

6. The method for constructing the engineered bacteria of claim 5, characterized in that, The method comprises the following steps: S1, cloning the gene fragment shown as SEQ ID NO. 2 into a eukaryotic expression vector to obtain a recombinant plasmid; S2, transfecting the recombinant plasmid obtained in S1 into Pichia pastoris cells to obtain Pichia pastoris expression engineering bacteria.

7. The construction method of claim 6, wherein, The method further comprises the following steps: S3, obtaining a high-efficiency secretory expression triple helix structure recombinant humanized type III collagen expression strain by culturing and high-copy screening of the Pichia pastoris expression engineering bacteria obtained in S2.

8. The construction method of claim 6, wherein, The eukaryotic expression vector in S1 is pPiC9K.

9. A method of producing a triple-helical recombinant humanized type III collagen, comprising the steps of, The method comprises the following steps: The engineering bacteria of claim 4 or 5 express the triple helix structure recombinant humanized type III collagen, and then separation and purification are performed to obtain the same.

10. Use of the recombinant humanized type III collagen of claim 1 or 2 in the preparation of a drug, a cosmetic, a medical device.

Images