Mitochondrial epilepsy mouse model and construction method and application thereof
By constructing a viral overexpression vector AAV-ul12.5 that efficiently expresses the ul12.5 gene and injecting it into mice, a mouse model of mitochondrial epilepsy was established. This solved the problem of the lack of suitable models in the existing technology and realized an effective means to truly reflect the disease mechanism and screen drugs.
Patent Information
- Application Number
- CN202410676333.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-05-28
- Publication Date
- 2025-11-28
AI Technical Summary
The lack of suitable biological models limits research on mitochondrial epilepsy, as existing technologies make it difficult to construct mitochondrial epilepsy models that can truly reflect the pathogenesis of the disease.
A mitochondrial epilepsy mouse model was established by constructing a viral overexpression vector AAV-ul12.5 that can efficiently express the ul12.5 gene and inducing mitochondrial DNA deletion in mice through injection, particularly brain localization injection, orbital vein injection, or tail vein injection.
This study provides a mouse model of mitochondrial epilepsy that can realistically reflect the disease mechanism, making it suitable for screening related drugs. It is specific, flexible, applicable, and biosafety-compliant, and can significantly simulate the disease state caused by mitochondrial DNA loss.
Smart Images

Figure BDA0004865649580000091 
Figure BDA0004865649580000101 
Figure BDA0004865649580000111
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biotechnology, in particular to a method for constructing a mouse model of mitochondrial epilepsy and application of the mouse model in screening drugs. BACKGROUND
[0002] Mouse disease models play an important role in the study of pathogenesis and drug screening. Mitochondrial epilepsy is a type of epilepsy related to mitochondrial dysfunction. Mitochondria are important organelles in cells, mainly responsible for producing adenosine triphosphate (ATP), the main source of cellular energy. Mitochondrial dysfunction can lead to cellular energy metabolism disorders, oxidative stress, DNA damage, etc., thereby affecting the normal function of neurons, and further triggering seizures. Compared with other cases of epilepsy, mitochondrial epilepsy is more likely to occur in the posterior quadrant and occipital lobe, and is more likely to manifest as non-convulsive status epilepticus lasting for several months, and is more resistant to treatment. The main genetic cause of mitochondrial epilepsy is mtDNA mutation. It has been reported that mitochondrial respiratory chain defects promote the hyperexcitability of neurons by changing the balance of the excitatory and inhibitory network. However, the lack of a suitable and relevant biological model limits the study of mitochondrial epilepsy.
[0003] The UL12 gene encodes herpes simplex virus type 1 (HSV-1) alkaline nuclease, which encodes two related proteins: full-length UL12 and amino acid truncated UL12.5. Full-length UL12 is located in the nucleus and promotes the generation of mature viral genomes from larger precursors. In contrast, UL12.5 is mainly mitochondrial and triggers the degradation of the mitochondrial genome at an early stage of infection.
[0004] Mitochondrial DNA depletion requires the exonuclease activity of UL12.5, and in addition, studies have shown that the mitochondrial localization of UL12.5 mainly depends on the sequence between UL12 residues 185 and 245 (UL12.5 residues 59 to 119). This region contains a sequence similar to a typical mitochondrial matrix localization signal, and mutations that reduce the positive charge of this element severely impair mitochondrial localization. This provides a new idea for us to use mitochondrial localization protein UL12.5 to safely and efficiently directly destroy the mitochondrial genome and construct a mitochondrial DNA-deficient mitochondrial epilepsy mouse disease model. SUMMARY
[0005] Therefore, the purpose of the present application is to provide a mitochondrial epilepsy disease model and a method for constructing the same and application thereof. The method for constructing the mitochondrial epilepsy disease model is simple to operate, and the constructed mitochondrial epilepsy disease model can truly and comprehensively reflect the pathogenesis or process of the disease.
[0006] In a first aspect of the present application, a method for constructing a mouse model of mitochondrial epilepsy is provided, the method comprising:
[0007] S1 construct a virus overexpression vector AAV-ul12.5 capable of efficiently expressing ul12.5 gene;
[0008] S2 infect mice by injection with the virus overexpression vector AAV-ul12.5 constructed;
[0009] S3 obtain a mitochondrial epilepsy mouse model after four weeks of injection.
[0010] In some embodiments thereof, the ul12.5 gene is as shown in SEQ ID NO: 15.
[0011] In some embodiments thereof, the vector is an AAV-PHP.eB vector.
[0012] In some embodiments thereof, the virus injection infection mode comprises brain positioning injection, orbital vein injection, and tail vein injection.
[0013] In some embodiments, the virus injection infection mode is tail vein injection.
[0014] In some embodiments, the injection dose is 1-2e+11 vg / 200 μL / each.
[0015] In a second aspect of the present application, the present application provides a mitochondrial epilepsy disease model obtained by the above-mentioned construction method. The mitochondrial epilepsy disease model provided by the embodiments of the present application has significant disease indicators and can comprehensively and truly reflect the disease mechanism or process, and can be used for screening of related drugs.
[0016] In a third aspect of the present application, the above-mentioned mitochondrial epilepsy mouse model is provided for use in drug screening.
[0017] In a fourth aspect of the present application, a method for screening drugs is provided, which comprises: contacting a candidate drug with the above-mentioned mitochondrial epilepsy mouse model; and detecting whether the candidate drug can be used for treating or preventing mitochondrial epilepsy disease by monitoring changes in the phenotype or function of the mouse before and after the contacting.
[0018] The method for screening drugs provided by the embodiments of the present application can be used for screening drugs for treating or preventing mitochondrial epilepsy disease. According to the embodiments of the present application, the above-mentioned mitochondrial epilepsy disease model has typical disease indicators, such as electroencephalogram or neural cell change indicators. If the candidate drug is applied to the above-mentioned mitochondrial epilepsy disease model, the phenotype or function indicators of the mouse model are improved, which indicates that the candidate drug has the use of treating or preventing mitochondrial epilepsy disease. The method for screening drugs provided by the embodiments of the present application has high feasibility and reliability.
[0019] Compared with the prior art, the present application has the following beneficial effects:
[0020] The inventors of the present application found in research that the mouse brain tissue infected by the virus-UL12.5 adeno-associated virus induces mitochondrial DNA deletion, and the constructed mitochondrial DNA deletion disease mouse model has the characteristics of significant mitochondrial DNA deletion index and significant epilepsy index, which can be used as a mitochondrial epilepsy disease model. In addition, the construction method provided by the present application has good specificity, flexibility, applicability, efficiency and biological safety, which makes it a powerful tool for studying mitochondrial related diseases. The mitochondrial epilepsy mouse disease model can comprehensively and truly reflect the disease mechanism or process, and can be used for screening of related drugs. BRIEF DESCRIPTION OF DRAWINGS
[0021] Figure 1 is a flow chart of the method for preparing a mitochondrial epilepsy disease model according to an embodiment of the present application.
[0022] Figure 2 is an AAV-PHP.eB empty vector map.
[0023] Figure 3 is a recombinant full map of the virus overexpression vector AAV-ul12.5.
[0024] Figure 4 is a detection of mitochondrial DNA deletion in mouse brain.
[0025] Figure 5 is an electroencephalogram of a mouse.
[0026] Figure 6 is a schematic diagram of the results of the detection of the electrophysiological experiment of the hippocampal region of the epilepsy mouse in vitro brain slice.
[0027] Figure 7 is a schematic diagram of the results of the western blotting detection experiment of the AAV virus efficiency of 293T cells, wherein 1. Protein marker, 2. 293t, 3. 293t+AAV-control, 4. 293t+AAV-UL12.5. DETAILED DESCRIPTION
[0028] In order to facilitate the understanding of the present application, the present application will be described more fully below. The present application can be implemented in many different forms, and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present application more thorough and comprehensive.
[0029] The experimental methods in the following examples, unless otherwise specified, were generally conducted in accordance with conventional conditions, for example, as described in the fourth edition of Molecular Cloning: A Laboratory Manual, edited by Green and Sambrook, published in 2013, or as recommended by the manufacturer. The various common chemical reagents used in the examples are commercially available products.
[0030] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used in the description of the application herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. As used in this application, the term "and / or" includes any and all combinations of one or more of the associated listed items.
[0031] UL12.5 CDS sequence: SEQ ID NO: 15
[0032]
[0033] In some embodiments of the present application, a method for constructing a model of a mitochondrial epilepsy disease is provided, the method comprising the following steps:
[0034] S1, a viral overexpression vector AAV-ul12.5 capable of efficiently expressing ul12.5 gene is constructed. There are more than 196 registered AAV types at present, and in some preferred embodiments, the adeno-associated virus (AAV) vector is further selected from the viral serotype of PHP.eB with strong neurotropism, i.e., the vector is an AAV-PHP.eB vector.
[0035] S2, the viral overexpression vector AAV-ul12.5 is injected into mice to infect the mice, and AAV-ul12.5 can effectively cross the blood-brain barrier and cut the mitochondrial gene in the brain tissue of the mice. The viral injection method includes brain positioning injection, orbital vein injection, and tail vein injection, and in some embodiments, tail vein injection is preferred. In some embodiments, the injection dose is 1-2e+11 vg / 200 μL per mouse.
[0036] Mouse selection: select a suitable mouse model, such as a wild-type mouse for viral infection, and preferably an 8-week-old wild-type mouse. Then collect the mouse brain tissue samples at an appropriate time point after infection.
[0037] Mitochondrial DNA deletion analysis and epilepsy behavior test are performed. The deletion of mitochondrial DNA in the brain tissue of the mice is detected using appropriate techniques (such as PCR, Southern blot, etc.).
[0038] The results of the epilepsy behavior test are quantitatively and qualitatively analyzed and compared with the control group. It is ensured that the mice induced to have mitochondrial DNA deletion exhibit behavior characteristics related to epilepsy.
[0039] The method for preparing a mouse disease model by adeno-associated virus infection has the following advantages according to the embodiments of the present application:
[0040] Specificity: viral-UL12.5 adeno-associated virus infection can achieve efficient delivery of specific genes, and thus can more accurately induce mitochondrial DNA deletion. This method can more accurately simulate the disease state caused by mitochondrial function defects compared to general gene knockout or mutation models.
[0041] Flexibility: viral-UL12.5 adeno-associated virus infection is a very flexible method, which can select different brain regions, time points, and infection doses according to research needs, thereby simulating mitochondrial DNA deletion lesions of different severity and location.
[0042] Applicability: The virus-UL12.5 adeno-associated virus infection method is applicable to various mouse models, which enables researchers to choose the best model for their research purposes.
[0043] Efficiency: Compared with other methods such as gene editing technology, the virus-UL12.5 adeno-associated virus infection method is generally more efficient, can establish the corresponding mouse disease model faster, and produce stable and controllable gene expression in infected cells.
[0044] Biological safety: As a commonly used gene delivery vector, viruses generally have good biological safety and can be infected without causing significant cytotoxicity or immune response.
[0045] According to the embodiments of the present application, the virus serotype is PHP.eB, which is modified from serotype 9, and the infection efficiency of neurons and glial cells is more than 40 times that of type 9, and it is convenient to inject systemically. It is recommended to use serotype PHP.eB, which can pass through the blood-brain barrier and has good diffusivity. When the infection efficiency is required to be higher, it is recommended to use serotype PHP.eB.
[0046] According to the embodiments of the present application, the mouse disease model is a mitochondrial DNA deletion mouse disease model. The method proposed in the embodiments of the present application is suitable for constructing a mitochondrial DNA deletion disease mouse model. According to the embodiments of the present application, the mitochondrial DNA deletion index of the mitochondrial DNA deletion disease model prepared by the method proposed in the embodiments of the present application is significant.
[0047] According to the embodiments of the present application, the mouse disease model is a mitochondrial DNA deletion mouse disease model. According to the embodiments of the present application, the mitochondrial DNA deletion mouse constructed by the method proposed in the embodiments of the present application has a significant mitochondrial DNA deletion index. The method proposed in the embodiments of the present application is more suitable for preparing a mitochondrial DNA deletion mouse disease model.
[0048] According to the embodiments of the present application, the mitochondrial DNA deletion disease model is a mitochondrial epilepsy disease model. According to the embodiments of the present application, the brain tissue mitochondrial DNA deletion of the mitochondrial epilepsy disease model prepared by the method proposed in the embodiments of the present application is significant. The method proposed in the embodiments of the present application is more suitable for a mitochondrial epilepsy disease model.
[0049] Some embodiments of the present application relate to a mitochondrial epilepsy mouse model. According to the embodiments of the present application, the mitochondrial epilepsy disease model is prepared by the method described above. The mitochondrial epilepsy disease model proposed in the embodiments of the present application has a significant disease index and can comprehensively and truly reflect the disease mechanism or process, and can be used for screening of related drugs.
[0050] In some embodiments of the present application, a method for screening drugs is provided, which comprises contacting a candidate drug with the mitochondrial epilepsy disease model described above, and determining whether the candidate drug can be used for treating or preventing mitochondrial epilepsy disease by monitoring the changes in the phenotype or function of the mouse before and after the contacting, and monitoring the electroencephalogram and / or the electrophysiology of the brain slice in vitro of the mouse before and after the contacting.
[0051] The method for screening drugs provided in the embodiments of the present application can be used for screening drugs for treating or preventing mitochondrial epilepsy disease. According to the embodiments of the present application, the mitochondrial epilepsy disease model described above has typical indicators of the disease, such as electroencephalogram or changes in nerve cells. If the candidate drug is applied to the mitochondrial epilepsy disease model described above, the phenotype or function of the mouse model is improved, which indicates that the candidate drug can be used for treating or preventing mitochondrial epilepsy disease. The method for screening drugs provided in the embodiments of the present application has high feasibility and reliability.
[0052] The present application will be further described in detail below with reference to specific embodiments.
[0053] In the following embodiments, the method for preparing a mouse disease model is described in detail by taking the preparation of a mitochondrial epilepsy disease model as an example.
[0054] Example 1 Preparation method
[0055] The blood-brain barrier is between the blood and the brain tissue, which is composed of the continuous capillary endothelium of the brain and the tight junction between the cells, the basement membrane, the pericyte and the astrocyte, and can selectively permeate the components required by the central nervous system and hinder the harmful components. The PHP.eB serotype virus can efficiently cross the blood-brain barrier by intravenous injection and achieve the purpose of whole brain expression. In the present application, the truncated UL12.5 gene (SEQ ID NO: 15) is constructed on the viral overexpression vector, the virus serotype is selected as PHP.eB which has strong neurotropism, and the promoter is selected as the strong promoter CAG, thereby obtaining AAV-ul12.5. The construction of AAV plasmid and the information of virus packaging are shown in the following table, and the recombination atlas of AAV-PHP.eB empty vector and viral overexpression vector AAV-ul12.5 is shown in FIGS. 1 and 2. Figure 2 and Figure 3
[0056]
[0057] CAG-FAGAGCCTCTGCTAACCATG SEQ ID NO: 1
[0058] WPRE-R CATAGCGTAAAAGGAGCAACA SEQ ID NO: 2
[0059] 1. Obtain the target gene by enzyme digestion:
[0060] Use restriction enzymes to digest the plasmid containing the target gene. The enzyme digestion reaction system is: 2 μg of plasmid, 5 μL of 10x reaction buffer, 1 μL of each restriction enzyme, and water to make up 50 μL. Incubate in a 37°C water bath for 2 hours or more. Perform agarose gel electrophoresis on the enzyme digestion products to detect the enzyme digestion effect, and cut the target gene band from the gel after agarose gel electrophoresis. Use TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.3.0 to recover the gel.
[0061] 2. Preparation of linearized expression vector:
[0062] Use restriction enzymes to digest the expression vector. The enzyme digestion reaction system is: 2 μg of plasmid, 5 μL of 10x reaction buffer, 1 μL of each restriction enzyme, and water to make up 50 μL. Incubate in a 37°C water bath for 2 hours or more. Perform agarose gel electrophoresis on the enzyme digestion products to detect the enzyme digestion effect, and cut the target vector band from the gel after agarose gel electrophoresis. Use TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.3.0 to recover the gel.
[0063] 3. Construct the target gene into the linearized expression vector:
[0064] Use the Seamless Cloning Kit (suitable for single target gene insertion fragment)
[0065] Add the target gene fragment and linearized vector to the centrifuge tube at a molar ratio of 2:1 for recombination reaction:
[0066]
[0067]
[0068] Optimal insertion fragment usage = [0.04 x insertion fragment base number] ng (0.03 pmol)
[0069] Optimal linearized vector usage = [0.02 x linearized vector base number] ng (0.03 pmol)
[0070] Mix well and incubate at 37°C for 30 minutes, then transfer to ice for 5 minutes. Direct transformation or store at -20°C for later transformation.
[0071] 5. Transform DH5α competent cells, clone and send for sequencing, and extract plasmid from positive bacterial solution.
[0072] 6.293T cells AAV viral efficiency western blotting detection
[0073] Vector information: AOV001: PAAV-CAG-MCS-3xFLAG-WPRE (293t+AAV-control)
[0074] H30259: PAAV-CAG-U12.5-CDS-3xFLAG-WPRE (293t+AAV-UL12.5).
[0075] The predicted U12.5-CDS protein is about 55KDa, and the experimental results show that the protein band is detected between Marker 35-70KDa, see Figure 7 .
[0076] The empty vector map is shown in Figure 1 , and the full recombinant map is shown in Figure 2 .
[0077] Example 2
[0078] Prepare 10 C57BL / 6 WT adult male mice of 2 months (8 weeks) of age and uniform weight, and divide them into a control group and an experimental group, of which 5 are in the AAV-control group and 5 are in the AAV-ul12.5 group. Correspondingly, inject AAV and AAV-ul12.5 into the C57BL / 6 WT mice in the AAV-control group and the AAV-ul12.5 group through the tail vein. The injection dose is 1e+11 vg / 200 μL per mouse, and the PHP.eB-UL12.5 is ensured to express in the whole brain of the mouse to model the mitochondrial epilepsy mouse (1). After four weeks of tail vein injection, the mouse brain tissue is taken to detect the change in the mitochondrial DNA copy number of the mouse (2) to determine whether the construction is successful.
[0079] Brief operation: (1) Inject AAV into 8-week-old mice through the tail vein. (2) After four weeks of injection of AAV and AAV-ul12.5, respectively, the mouse is anesthetized and dissected, and the brain tissue is taken to detect the change in the DNA copy number.
[0080] Reaction system for qPCR detection:
[0081]
[0082] Primer sequence:
[0083]
[0084] Reaction program of qPCR
[0085]
[0086]
[0087] Results see Figure 4 The virus tail vein injection system used in this embodiment does not require surgery on the mouse, ensuring the stability of the modeling and not affecting the mouse. PHP.eB can easily cut the mouse brain mitochondrial DNA and induce mitochondrial dysfunction mouse disease model.
[0088] II. In vivo EEG detection in mice by the following operation: Epilepsy electroencephalogram (EEG) experiment is one of the important methods to detect whether the mouse has epilepsy. The following are the general steps of this experiment:
[0089] 1. Animal preparation:
[0090] - The mouse should be in a fully anesthetized state, such as using isoflurane, chloride, etc. Anesthetics.
[0091] - The mouse head is fixed on the experimental table to prevent movement interference with the experimental process.
[0092] 2. Electrode implantation:
[0093] - Make a small incision on the mouse's head skin with a blade to expose the skull.
[0094] - Use a micro-drill to drill holes on the skull surface and insert electrodes. Usually, electrodes can be implanted into the cerebral cortex (usually in the hippocampus, cortical area) or other brain regions of interest.
[0095] - Connect the electrodes to the head socket to ensure stable electrical signal recording.
[0096] 3. Data acquisition:
[0097] - Place the mouse in the EEG recording device and allow it to adapt to the environment.
[0098] - Start recording the brain electrical signal. Usually, a period of baseline recording is needed to determine the basic brain electrical activity of the mouse.
[0099] 4. Epilepsy detection:
[0100] - Record the brain electrical signal continuously during the induction of seizures.
[0101] 5. Data analysis:
[0102] - Use professional data analysis software to analyze the recorded brain electrical signal. Parameters such as spectral characteristics, amplitude, frequency, etc. can be analyzed.
[0103] - Determine if there is abnormal brain electrical activity, such as sharp waves, slow waves, high-frequency discharges, etc.
[0104] 6. End of experiment:
[0105] - After the experiment is completed, the mice are returned to their normal feeding conditions and their behavior and health status are monitored.
[0106] These steps are general guidelines for conducting mouse epilepsy abnormal brain electrical experiments. During the experiment, strict adherence to animal experiment ethics and operation guidelines is required. During the experiment, one mouse in the control group died unexpectedly.
[0107] III. According to an embodiment of the present application, the second predetermined part is an in vitro brain slice electrophysiology. The following are the general experimental steps for detecting the in vitro brain slice electrophysiology of the hippocampus of epileptic mice:
[0108] 1. Preparation:
[0109] - Before the experiment begins, prepare all necessary equipment and reagents, including a slicer, physiological saline, ice-salt freezing solution, a microscope, an electrophysiological amplifier, electrodes, etc.
[0110] 2. Mouse euthanasia:
[0111] - According to animal ethics regulations, euthanize the mouse, for example, using carbon dioxide gas anesthesia.
[0112] - Quickly remove the mouse's brain through methods such as skull incision.
[0113] 3. Brain slice preparation:
[0114] - Use a brain slicer to cut the brain into thin slices (usually 300-400 microns), and keep the slices immersed in ice-salt freezing solution containing redox agents during the slicing process to maintain the integrity and activity of the tissue.
[0115] - Select the brain region of interest for slicing, such as the hippocampus, cortex, etc.
[0116] 4. Slice processing:
[0117] - Transfer the slices to a culture dish containing physiological saline to maintain the stability and activity of the slices.
[0118] - According to the experimental design, the slices can be exposed to different reagents, such as drugs, fluorescent probes, etc., to study their effects on neuronal activity.
[0119] 5. Electrophysiological recording:
[0120] - Transfer the slices to the electrophysiological recording chamber and place them under the microscope.
[0121] - Use microelectrodes or glass electrodes placed to the neuronal area of interest to record the electrical activity of neurons.
[0122] - Perform electrophysiological recordings of excitatory and inhibitory neurons, record action potentials, postsynaptic potentials, etc.
[0123] 6. Data collection and analysis:
[0124] - Record the electrical activity of neurons using electrophysiological amplifiers, while using data acquisition systems for data collection and preservation.
[0125] - Analyze the collected electrophysiological data using data analysis software, including changes in membrane potential, characteristics of synaptic transmission, etc.
[0126] It can be found through experiments that the method of Example 1 has high modeling efficiency and good stability, and after mitochondrial DNA copy number loss detection, the remaining mice of the same batch are further observed for mitochondrial epilepsy progression.
[0127] Among them, after the mouse is inserted with the electrode, the real-time monitoring of the mouse cortex electroencephalogram (3) is shown in the effect diagram, and the overexpression UL12.5 mouse has obvious epileptiform abnormal discharge, and the comprehensive Figures 4-5 It can be seen from the results that, by using the tail vein injection of AAV-UL12.5, the mouse brain tissue is infected, and after four weeks of detection, the copy number of the mouse brain tissue mitochondrial gene (Nd1 (P=0.0005), Nd4 (P=0.0012), Cox1 (P=0.0019), Cox3 (P=0.0041), Cytb (P=0.0004) significantly decreases, see Figure 4 , which shows that overexpression of UL12.5 can cause symptoms of mitochondrial DNA loss syndrome in mouse brain tissue.
[0128] Further, the mouse is recorded by electroencephalogram, and the hippocampal electroencephalogram of the control group (blue) and the UL12.5 mouse (red) is shown. The root mean square (RMS) of the electroencephalogram signal of the control and UL12.5 mice, and the spectrogram corresponding to the short-time Fourier transform (STFT) of the electroencephalogram signal are shown in Figure 5 . It is found that the mouse with mitochondrial DNA loss in brain tissue is accompanied by severe epileptiform abnormal discharge, and there are obvious differences in the daily frequency, average duration, epileptic peak amplitude and root mean square of the quantitative electroencephalogram. (n=4 for the control group, n=5 for the UL12.5 experimental group; *p<0.05, **p<0.01). As can be seen, compared with the control mouse, the UL12.5 mouse has abnormal discharge, and the frequency is significantly increased, see Figure 5 .
[0129] Patch-clamp whole-cell recording of hippocampal slices of isolated mice showed that the voltage-dependent sodium and potassium channel current and the amplitude of induced action potential of UL12.5 mice were significantly reduced, see Figure 6 Specifically, the amplitude of induced sodium current in the hippocampus of UL12.5 mice decreased. The excitation-inhibition balance showed an increase in the frequency of excitation-inhibition, resulting in an overall increase in the excitability of hippocampal neurons. These results indicate that mtDNA deletion leads to a seizure phenotype in the mouse brain, see Figure 6 (control group n=10 nerve cells, UL12.5 group n=7 nerve cells; *p<0.05, **p<0.01).
[0130] The above experimental results show that the disease model of the mitochondrial epilepsy mouse obtained by the method of the present application is significant. It is consistent with the clinical manifestations of patients with mitochondrial DNA deletion syndrome, such as stroke and epilepsy, can simulate the pathogenesis of patients with mitochondrial epilepsy, and can be used for mechanism research and drug screening.
[0131] The above examples only express several embodiments of the present application, and the description is more specific and detailed, but it cannot be understood as a limitation on the scope of the patent. It should be noted that for ordinary skilled persons in the art, without departing from the concept of the present application, a number of modifications and improvements can be made, which are within the scope of the present application. Therefore, the protection scope of the present application patent should be subject to the appended claims.
Claims
1. A method for constructing a mouse model of mitochondrial epilepsy, characterized in that, The construction method includes: S1 was used to construct the viral overexpression vector AAV-ul12.5, which can efficiently express the ul12.5 gene; S2 will construct the viral overexpression vector AAV-ul12.5 and infect mice by injection; A mouse model of mitochondrial epilepsy was obtained four weeks after S3 injection.
2. The method for constructing a mitochondrial epilepsy mouse model according to claim 1, characterized in that, The ul12.5 gene is shown in SEQ ID NO:
15.
3. The method for constructing a mitochondrial epilepsy mouse model according to claim 1, characterized in that, The carrier is the AAV-PHP.eB carrier.
4. The method for constructing a mitochondrial epilepsy mouse model according to claim 1, characterized in that, Viral injection methods include brain-targeted injection, orbital vein injection, and tail vein injection, with tail vein injection being the preferred method.
5. The method for constructing a mitochondrial epilepsy mouse model according to any one of claims 1-4, characterized in that, The injection dose is 1-2e+11vg / 200μL / animal.
6. The method for constructing a mitochondrial epilepsy mouse model according to any one of claims 1-4, characterized in that, The mice mentioned in step 2 are 8-week-old wild-type mice.
7. The mitochondrial epilepsy mouse model obtained by the construction method according to any one of claims 1-6.
8. The application of the mitochondrial epilepsy mouse model of claim 7 in drug screening.
9. A method for screening drugs, characterized in that, The method for screening drugs includes: contacting candidate drugs with the mitochondrial epilepsy mouse model of claim 7; By monitoring changes in the mouse phenotype or function before and after the exposure, it can be determined whether the candidate drug can be used to treat or prevent mitochondrial epilepsy.
10. The method for screening drugs according to claim 9, characterized in that, It also includes monitoring the electroencephalogram (EEG) in mice and / or the electrophysiology of ex vivo brain slices before and after the contact.
Citation Information
Patent Citations
Chemical heredity epilepsy persistent state disease animal model and construction method and application thereof
CN111839800A