High-activity chitinase mutant and application thereof in degradation of crustacean waste

Abstract

The invention provides a high-activity chitinase mutant and application thereof in degradation of crustacean waste, and belongs to the technical field of enzyme engineering and agricultural waste conversion. According to the invention, chitinase PbChi from Paenibacillus barengltzii is subjected to molecular modification, and a plurality of chitinase mutants with high activity are successfully constructed by increasing the flexibility of a connexin, changing steric hindrance at a substrate catalytic crack inlet and changing catalytic residues in a beta sheet layer in a catalytic structural domain through calculation design and experimental verification; the chitinase mutant can effectively degrade shrimp shell meal, so that carapace waste is effectively utilized, and the chitinase mutant has a wide application prospect in the biological feed industry.

Description

Technical Field

[0001] This invention belongs to the fields of enzyme engineering and agricultural waste conversion, and relates to highly active chitinase mutants and their application in the degradation of crustacean waste. Background Technology

[0002] Chitin, a linear polysaccharide composed of acetylglucosamine (GlcNAc) polymerized via β-1,4 glycosidic bonds, is the second most abundant polysaccharide in nature, after cellulose. Approximately 10 [units of something unspecified] are produced naturally each year. 11 Chitin is an important component of most organisms, such as fungal cell walls, crustacean exoskeletons, and shrimp and crab shells. The processing of chitin generates 6 to 8 million tons of shell waste annually, which is difficult to manage properly. Chitosan oligosaccharides (CHOS), a direct degradation product of chitin, have excellent water solubility and physiological activity. They possess good antioxidant, antibacterial, and antitumor properties and have wide applications in medicine, food, feed, and cosmetics. Therefore, the efficient degradation of chitin is beneficial to environmental protection and resource recycling.

[0003] Chitinases (EC 3.2.1.14) are classified into the GH18, 19, and 20 families based on amino acid sequence homology. They generally consist of multiple domains, including a signal peptide (SP), a catalytic domain (CD), a type III fibronectin (FnIII), and a substrate-binding domain (CBD). The catalytic domain of GH18 family chitinases is relatively conserved, exhibiting a classic (β / α)8TIM barrel structure composed of eight α-helices and eight β-sheets arranged in a random loop. The catalytic center sequence is DXDXEX. A long and deep catalytic slit lies above the barrel structure, containing six N-acetylglucosamine binding sites that exhibit different binding modes with different substrates. The substrate-binding domain influences substrate specificity and hydrolysis efficiency to some extent. Currently discovered chitinases are widely distributed in various organisms, and most have been purified and characterized. However, natural chitinases still suffer from insufficient enzyme activity and poor stress resistance, resulting in limited commercial availability and high cost. Therefore, there is an urgent need to perform molecular modification (directed evolution and rational design) on chitinases.

[0004] Directed evolution is a process that simulates natural evolution in the laboratory, which makes changes to the original amino acid sequence of the protein, often accompanied by high-throughput screening. In order to facilitate screening, the host cell is preferably Escherichia coli as a model organism, which is not only genetically stable, but also has a clear metabolic regulation pathway, and has been adapted to the laboratory environment for a long time, which greatly simplifies the operation steps. In addition, with the rapid development of structural biology, molecular biology and enzyme engineering technology, rational design has become a key strategy to improve enzyme activity and stability. Many research results show that rational design of proteins can improve enzyme catalytic activity, broaden substrate specificity and enhance stress resistance, thereby having greater application potential. Some studies based on the structural analysis and mutation analysis of Chi23 and (GlcNAc)5 docking obtained the key catalytic residues (Glu117) and 7 substrate binding residues, revealing the catalytic mechanism of endochitinase; after introducing disulfide bonds and replacing proline, the mutant showed higher specific activity at higher temperature, and the half-life value was increased by 26.3 times at 50℃, and the optimal reaction temperature was increased from 45℃ to 52.5℃. However, there are many types of chitinases, and the catalytic mechanisms of different chitinases are not the same, the functions of each beta / alpha structure in the catalytic domain are not completely clear, and the relationship between the surface aromatic amino acids in the binding domain and the binding efficiency is still uncertain, and the fine division and cooperation of chitin degradation enzyme system still need to be further explored.

[0005] Therefore, it is necessary to develop new high-activity chitinase mutants. SUMMARY

[0006] In view of the problems in the prior art, the present application provides a high-activity recombinant chitinase and its application in degrading shellfish waste; the chitinase PbChi from Paenibacillus barengoltzii is molecularly modified, the flexibility of the linker protein is increased, the catalytic residues in the beta sheet in the catalytic domain are changed, the steric hindrance at the entrance of the substrate catalytic crack is changed, and through calculation design and experimental verification, a plurality of high-activity chitinase mutants are successfully constructed; the chitinase mutant can effectively degrade shrimp shell powder, so that the shellfish waste is effectively utilized, and has a wide application prospect in the biological feed industry.

[0007] In order to achieve the above technical purpose, the present application adopts the following technical means:

[0008] The present application first provides a chitinase mutant, which is any mutation of the following on the basis of SEQ ID NO. 1:

[0009] (a) the amino acid at position 555 of SEQ ID NO. 1 is mutated from aspartic acid (Asp) to glycine (Gly); or

[0010] (b) the amino acid at position 555 of SEQ ID NO. 1 is mutated from aspartic acid (Asp) to glycine (Gly), the amino acid at position 365 is mutated from glutamic acid (Glu) to alanine (Ala), and the amino acid at position 368 is mutated from serine (Ser) to tyrosine (Tyr); or

[0011] (c) the amino acid at position 555 of SEQ ID NO. 1 is mutated from aspartic acid (Asp) to glycine (Gly), the amino acid at position 365 is mutated from glutamic acid (Glu) to alanine (Ala), the amino acid at position 368 is mutated from serine (Ser) to tyrosine (Tyr), the amino acid at position 63 is mutated from glutamic acid (Glu) to tyrosine (Tyr), the amino acid at position 196 is mutated from glutamic acid (Glu) to tyrosine (Tyr), and the amino acid at position 225 is mutated from lysine (Lys) to threonine (Thr).

[0012] Preferably, the amino acid sequence of the chitinase mutant is as shown in SEQ ID NO. 3, SEQ ID NO. 4, or SEQ ID NO. 5.

[0013] The present application also provides a polynucleotide encoding the chitinase mutant.

[0014] The present application also provides a recombinant vector comprising the polynucleotide.

[0015] The present application also provides a genetically engineered bacterium expressing the chitinase mutant or comprising the recombinant vector.

[0016] Preferably, the host bacterium of the genetically engineered bacterium comprises Bacillus subtilis WB800N.

[0017] The present application also provides an enzyme preparation, wherein one or more of the chitinase mutants (a)-(c) is mixed as the main active ingredient.

[0018] The present application also provides the use of the chitinase mutant, the polynucleotide encoding the chitinase mutant, the recombinant vector, the genetically engineered bacterium, or the enzyme preparation, wherein the use comprises:

[0019] (1) degrading shell waste; and / or

[0020] (2) fermenting to produce biological feed.

[0021] Preferably, the shell waste comprises one or more of shrimp shells and crab shells, and the raw material of the biological feed comprises shell waste.

[0022] The present application also provides a method for preparing shrimp shell powder fermented feed, wherein the method comprises:

[0023] Fermentation strains were inoculated into shrimp shell powder fermented feed, and then the chitinase mutant or enzyme preparations mentioned above were added. After stirring and mixing, the mixture was placed in a one-way valve anaerobic fermentation bag for one-step constant temperature fermentation.

[0024] Preferably, the shrimp shell powder fermented feed uses shrimp shell powder and soybean residue as the main ingredients, and wheat bran and rice bran as auxiliary ingredients, with the ratio of shrimp shell powder: soybean residue: wheat bran: rice bran = 4:3:2:1.

[0025] The total inoculation amount of the fermentation bacteria is 6%, and the inoculation ratio is Saccharomyces cerevisiae: Bacillus licheniformis: Lactobacillus fermentum: Lactobacillus rhamnosus = 2:2:1:1;

[0026] The amount of chitinase mutant or enzyme preparation added is 12% (w / w) of the shrimp shell powder fermented feed.

[0027] Preferably, during the fermentation process, the moisture content of the shrimp shell powder fermented feed is controlled at 45%, the fermentation temperature is 35℃, and the fermentation is carried out in sealed packaging for 7 days.

[0028] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0029] (1) This invention elucidates the molecular mechanism of chitinase's efficient catalysis. After the amino acid residues at the end of each β-sheet in the TIM bucket are replaced with aromatic amino acids, the aromatic residues can interact with multiple N-acetyl groups of the substrate through hydrogen bonds or hydrophobic interactions, thereby enhancing the substrate binding ability. At the same time, the non-specific CH-π / π-π interactions between the chitinase and the substrate contribute to the stability of the overall model structure and the hydrolysis ability. The substrate binding domain and the catalytic domain are connected by a "track" filled with aromatic amino acids. The chitin sheet slides along this track from the chitin binding region to the vicinity of the substrate binding pocket. The reduction of the substrate molecule's movement trajectory and the steric hindrance at the entrance of the active pocket is more conducive to improving the catalytic efficiency.

[0030] This invention mutates the 365th amino acid of chitinase PbChi from glutamic acid (Glu) to alanine (Ala) and the 368th amino acid from serine (Ser) to tyrosine (Tyr). The E365A mutation leads to a reduction in the side chain volume, causing the interaction between this site and the substrate molecule to disappear. The S368Y mutation, however, retains the benzene ring structure, which maintains substrate anchoring through hydrophobic interactions and π-π stacking, performing the same function as the substrate guiding residue. Together, they form an extended surface, facilitating smoother substrate entry into the active site, stabilizing the substrate structure, and thus improving the enzyme's catalytic efficiency.

[0031] In this invention, the amino acid at position 63 of the chitinase PbChi is mutated from glutamic acid (Glu) to tyrosine (Tyr), position 196 is mutated from glutamic acid (Glu) to tyrosine (Tyr), and position 225 is mutated from lysine (Lys) to threonine (Thr). After the aspartic acid (D) at position 196 is changed to tyrosine (Y), it forms an additional hydrogen bond, a van der Waals force, and a π-Cation interaction with lysine (K) at position 155. The interaction with threonine (T) at position 156 changes from two hydrogen bonds and a van der Waals force to a single hydrogen bond. At the same time, the interaction with the lysine (K) residue at position 243 also changes from a van der Waals force to a π-Cation interaction. For the amino acid at position 63, which originally only interacted with asparagine (N) at position 60, the mutation not only preserved the hydrogen bond with the residue at position 60 but also formed a π-π bond with phenylalanine (F) at position 59. Furthermore, all three interacted with the overall model structure, resulting in a more stable structural network between the mutated residue and the protein backbone. This contributes positively to maintaining the overall stability of the protein model.

[0032] (2) This invention discloses a formula and fermentation process for preparing fermented feed using shrimp shell powder. The prepared multi-group chitinase preparation is used for synergistic fermentation of bacteria and enzymes. The modified chitinase can effectively degrade shrimp shell powder, so that shell waste is effectively utilized and shows broad application prospects in the bio-feed industry.

[0033] (3) After 7 days of fermentation, the pH of the fermented feed significantly decreased from 6.59 to approximately 5.2. Regarding soluble protein, the content of all modified enzyme preparation groups was increased, with the T-PbChi-S enzyme preparation group reaching 7.81±0.09 mg / mL, 2.46 times that of the wild type. The reducing sugar content also significantly increased, reaching 19.24±0.55% (T-PbChi-M1), 23.38±0.41% (T-PbChi-N1), and 27.25±0.67% (T-PbChi-S) in the modified mutant groups, with the highest group reaching 5.78 times that of the wild type. Attached Figure Description

[0034] Figure 1 Gel electrophoresis images of the PbChi-BsCBD gene (A) and the linearized pHT vector (B).

[0035] Figure 2The docking results of various domains of chitinase are visualized. In the figure, A is a visualization of the molecular docking results of the substrate binding domain of chitinase; B is a visualization of the molecular docking results of the chitinase linker protein region; C is a visualization of the molecular docking results of the chitinase active pocket inlet region; and D is a visualization of the molecular docking results of the chitinase catalytic crack region.

[0036] Figure 3 This is a gel electrophoresis image of site-directed mutagenesis PCR for recombinant plasmids.

[0037] Figure 4 Force analysis of the linker protein region before and after mutation (D555G).

[0038] Figure 5 This describes the changes in electron cloud arrangement and spatial steric hindrance at the entrance of the active pocket.

[0039] Figure 6 These are aromatic amino acids arranged on both sides of the catalytic crack of chitinase.

[0040] Figure 7 The interaction relationships between protein residues before and after the D63Y mutation (A) and the interaction relationships between protein residues before and after the D196Y mutation (B) are shown.

[0041] Figure 8 The results are molecular dynamics simulations of the wild type and the mutant. A and B represent the changes in the total solvent contact surface area (SASA) during the catalytic process of the wild type (A) and the mutant (B), while C and D represent the changes in the root mean square fluctuation (RMSF) of the wild type (C) and the mutant (D).

[0042] Figure 9 The results of Western blotting validation for the six-point combination mutants.

[0043] Figure 10 The values ​​are pH and soluble protein content (A) and reducing sugar content (B) of the fermented feed. Detailed Implementation

[0044] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the scope of protection of the present invention is not limited thereto.

[0045] In the following examples, the E. coli-B. subtilis shuttle expression vector pHT, Escherichia coli DH5α, Escherichia coli BL21, and Bacillus subtilis WB800N and PbChi are all known contents, and their acquisition methods can be found in patent CN116926101A or literature.

[0046] In the preparation of shrimp shell powder fermented feed, the fermentation strains used were *Saccharomyces cerevisiae* (CGMCC 2.1527), *Bacillus licheniformis* (CGMCC 1.813), *Lactobacillus fermentum* (CGMCC 1.15608), and *Lactobacillus rhamnosus* (CGMCC 1.577), all purchased from the China General Microbiological Culture Collection Center. The yeast was inoculated at a 1% inoculum on LB medium and cultured at 30°C with a shaker at 150 rpm until OD600 = 0.6. The Bacillus spores were inoculated at a 1% inoculum on LB medium and cultured at 37°C with a shaker at 150 rpm until OD600 = 0.6. Lactic acid bacteria were inoculated into MRS medium at a 1% inoculum and cultured anaerobically at 37°C until OD600 = 0.6; the corresponding fermentation seed liquid was obtained.

[0047] The following embodiments relate to a method for determining chitinase activity using a colloidal substrate. The specific operation is as follows: The chitinase activity is determined by measuring the reducing sugar content in the reaction system using the 3,5-dinitrosalicylic acid (DNS) colorimetric method. A reducing sugar standard curve is prepared using 0–1.2 mg / mL GlcNAc. When determining chitinase activity, 100 μL of enzyme is added to 400 μL of buffer (50 mM phosphate buffer), and reacted with 500 μL of colloidal chitin at 55°C for 1 h. After the reaction, the supernatant is collected by centrifugation, 1 mL of DNS reagent is added, the mixture is boiled in a water bath for 10 min, and then rapidly cooled to room temperature. The reaction is then measured at OD0.05. 540nm The absorbance was measured at the specified location. Enzyme activity (U) is defined as the amount of enzyme required to release 1 μmol of reducing sugar per minute under these conditions, using GlcNAc as a standard.

[0048] In the following embodiments, the molecular dynamics simulations involved all follow these steps: water molecules and hydrogen atoms are removed from the protein to complete the protein preparation. The molecular states of the protein structure before and after amino acid mutations are predicted using the PDB 2QR online server (https: / / server.poisonboltzmann.org / pdb2pqr), and charge distribution is performed. Then, parameters are set, and the system is heated from 100K to 310K in 20ps under CHARMM, followed by a 100ps density equilibrium operation under the NPT system. After density equilibrium, molecular dynamics (MD) simulations are performed using AMBER 22 with the built-in protein.ff14SB force field at an ambient temperature of 310K, pH 7, and pressure of 1.0 kPa under the NVT system for 50ns. The entire process of substrate movement from the substrate-binding domain into the active pocket via aromatic orbitals and catalysis was observed. The trajectory and conformational changes of the substrate molecule were observed, and the opening / closing state of the substrate channel, as well as changes in interaction forces, soluble contact area, and RMSF, were monitored as standards to evaluate the merits and contributions of each mutation site. VMD 1.9.3 was used to analyze the trajectory files obtained from MD simulations, including root mean square deviation (RMSD), root mean square fluctuation (RMSF), and hydrogen bonds. The protein structure after MD simulations was visualized using PyMOL software.

[0049] Example 1:

[0050] This embodiment examines the effect of enhancing the flexibility of the linker protein of the recombinant chitinase, as shown in SEQ ID NO.1, on the overall structural stability of the chitinase. The specific steps are as follows:

[0051] (1) Chitinase from Paenibacillus barengoltzii (NCBI sequence number: KJ634701) was selected. The mature peptide sequence of the chitinase was optimized according to the codon preference of Bacillus subtilis and synthesized to obtain the codon-optimized chitinase gene. At the same time, the substrate binding domain was replaced to obtain the recombinant chitinase, denoted as PbChi-BsCBD. Its amino acid sequence is shown in SEQ ID NO.1, and the nucleotide sequence encoding the gene is shown in SEQ ID NO.2.

[0052] (2) Using SEQ ID NO.1 as a template, the PbChi gene fragment was amplified using primers pHT-PbChi-F and pHT-PbChi-R (SEQ ID NO.6-7). The shuttle expression vector pHT fragment was linearized using primers pHT-F and pHT-R (SEQ ID NO.8-9). The PbChi gene fragment and pHT vector fragment were ligated using a seamless cloning kit. The ligation product was transformed into E. coli DH5α competent cells, plated on solid LB medium containing 0.2 mg / mL ampicillin sodium, and cultured at 37°C for 14 h. Single colonies were picked for colony PCR verification. After correct sequencing, the colonies were amplified and plasmids were extracted to obtain the recombinant plasmid, denoted as pHT-PbChi-BsCBD.

[0053] The amplification conditions were: 98℃ for 3 min, 98℃ for 10 s, 55℃ for 15 s, 72℃ for 15 s / 60 s, 72℃ for 10 min, for 30 cycles; the verification PCR conditions were: 94℃ for 3 min, 94℃ for 30 s, 55℃ for 30 s, 72℃ for 60 s, for 30 cycles.

[0054] Figure 1 A represents the amplified PbChi-BsCBD gene fragment. Figure 1 B represents the linearized pHT vector fragment, indicating that the PbChi-BsCBD gene and the linearized pHT vector fragment were successfully obtained.

[0055] (3) The obtained recombinant plasmid pHT-PbChi-BsCBD was electroporated into Bacillus subtilis WB800N competent cells to obtain engineered bacteria, denoted as B. subtilis pHT-PbChi-BsCBD. The engineered bacteria were then inoculated into LB medium containing chloramphenicol and kanamycin and induced to grow at 37°C with shaking at 170 rpm. After the culture was completed, the bacteria were centrifuged at 8000 rpm for 15 min. The supernatant collected by centrifugation contained crude recombinant chitinase. The purified recombinant enzyme solution was denoted as T-PbChi-BsCBD.

[0056] (4) Using the amino acid sequence of the gene fragment PbChi-BsCBD as a template, a three-dimensional protein model was constructed, resulting in a protein model denoted as PBCHI-BSCBD. This model was then used as a macromolecular protein, and molecular docking was performed using octachiochitin oligosaccharide with minimal energy as the substrate. Specifically, this involved removing water molecules and adding hydrogen atoms to the macromolecular protein, adding hydrogen atoms to the small substrate, and determining the rotational bonds. The docking box was then set, parameters were determined, and Autodockvina was run to perform docking for each domain separately. This yielded substrate molecular conformations ordered by binding energy. Finally, PyMOL was used to export the visualized complex structure. Figure 2The docking results of the various domains of chitinase are visualized. Figure 2 A is a visualization of the molecular docking results of the chitinase substrate binding domain; Figure 2 B represents the visualization of the molecular docking results of the chitinase linker protein region; Figure 2 -C indicates visualization of molecular docking results in the chitinase active pocket inlet region; Figure 2 D is a visualization of the molecular docking results in the chitinase-catalyzed crack region.

[0057] (5) Using the recombinant plasmid pHT-PbChi-BsCBD as a template, a one-step site-directed PCR mutagenesis was performed using primers D555G-F and D555G-R to change Asp555 in the linker region to Gly555 (D555G). The mutated recombinant plasmid was then incorporated into E. coli DH5α, plated on solid LB medium containing 0.2 mg / mL ampicillin sodium, and incubated at 37°C for 14 h. The PCR site-directed mutagenesis conditions were: 98°C for 3 min, 98°C for 10 s, 55°C for 15 s, 72°C for 120 s, for 30 cycles.

[0058] Single colonies were picked and colony PCR was performed using validation primers pHT-YZ-F and pHT-YZ-R. After successful sequencing, the colonies were amplified and plasmids were extracted to obtain the mutant plasmid pHT-PbChi-D555G, denoted as pHT-PbChi-M1. The mutant fragment is...

[0059] PbChi-M1.

[0060] The mutant plasmid pHT-PbChi-M1 was transformed into B. subtilis WB800N competent cells to obtain recombinant engineered bacteria B. subtilis WB800N-pHT-PbChi-M1. The chitinase mutant was obtained according to the method in step (3) and denoted as T-PbChi-M1. Its amino acid sequence is shown in SEQ ID NO.3.

[0061] D555G-F (SEQ ID NO.10):ATCCAGGTGGTTCAACTGCTCCAAC;

[0062] D555G-R (SEQ ID NO. 11): AGCAGTTGAACCACCTGGATTAGTACCTGGTTCAG;

[0063] pHT-YZ-F (SEQ ID NO. 12): ACGGGGGTGAAAAAGCTAACG

[0064] pHT-YZ-R (SEQ ID NO. 13): ACTATTCCTAATAAGCCGATATTAGC.

[0065] (6) Using the amino acid sequence of the mutant fragment PbChi-M1 as a template, a three-dimensional protein model was constructed, denoted as PBCHI-M1. Subsequently, the linker protein region of PbChi-M1 was molecularly docked with the octamer chitosan oligosaccharide (GlcNAc)8 to obtain a protein-ligand complex. Scanning the complex, aspartic acid (D) at position 555 was selected, which is located at the junction of the two domains and generates hydrogen bonds at 552N, 556S, 557T, 585N, and 631N. After mutation to glycine (G), it only interacts with 552N and 631N (Fig.). The reduction in interaction forces ensures the freedom of polypeptide skeletonization, and the overall protein structure has sufficient spatial folding to obtain the original biological activity, and the functional proteins at both ends are not rigidly constrained. The enzyme activity was measured to be 23.55±0.89U / mg, reaching 141.74±3.5% of the wild type.

[0066] Combination Figure 3 and Figure 4 It can be seen that introducing flexible amino acid sequences into the linker protein region of chitinase can improve the overall flexibility and stability of the protein structure.

[0067] Example 2:

[0068] This embodiment further refines the chitinase mutant T-PbChi-M1 based on the steric hindrance effect at the active pocket inlet by rational design, building upon Example 1. The specific steps are as follows:

[0069] (1) Using pHT-PbChi-M1 as a template, two one-step whole-plasmid PCR site-directed mutagenesis experiments were performed using primers E365A-F / E365-R and S368Y-F / S368Y-R to change the catalytic residue Glu365 to Ala365 and Ser368 to Tyr368. The mutated recombinant plasmid was then introduced into Escherichia coli DH5α, plated on solid LB medium containing 0.2 mg / mL ampicillin sodium, and cultured at 37 °C for 14 h. The PCR site-directed mutagenesis conditions were: 98 °C for 3 min, 98 °C for 10 s, 55 °C for 15 s, 72 °C for 120 s, for 30 cycles. The nucleotide sequences of primers E365A-F / E365-R and S368Y-F / S368Y-R are shown in SEQ ID NO. 14-17.

[0070] Single colonies were selected and colony PCR was performed using the validation primers pHT-YZ-F and pHT-YZ-R. After the sequencing was confirmed to be correct, the colonies were amplified and plasmids were extracted to obtain the mutant plasmid pHT-PbChi-M1-E365A / S368Y, denoted as pHT-PbChi-N1, with the mutant fragment being PbChi-N1.

[0071] The mutant plasmid pHT-PbChi-N1 was transformed into B. subtilis WB800N competent cells to obtain recombinant engineered bacteria B. subtilis WB800N-pHT-PbChi-N1. The chitinase mutant was obtained according to the method of step (3) in Example 1, and was denoted as T-PbChi-N1. Its amino acid sequence is shown in SEQ ID NO.4.

[0072] (2) Using the amino acid sequence of the mutant fragment PbChi-N1 as a template, a three-dimensional protein model was constructed, resulting in a protein model denoted as PBCH1-N1, as follows: Figure 5 As shown in the figure, during the docking process, sites 365E and 368S are located at the entrance of the active pocket channel where the substrate molecule enters, preferentially interacting with the substrate molecule and exhibiting a significant steric hindrance effect, thus affecting catalytic activity. Simultaneously, these two sites (E365 and S368) form overlapping electron clouds with the substrate, which may affect the reaction between the protein macromolecule and the substrate's preferred conformation. After mutation, the E365A mutation leads to a reduction in side chain volume, causing the interaction between this site and the substrate molecule to disappear. The S368Y mutation retains the benzene ring structure, maintaining substrate anchorage through hydrophobic interactions and π-π stacking, playing the same role as the substrate guiding residue. Together, they form an extended surface, facilitating smoother substrate entry into the active site, stabilizing the substrate structure, and thus improving the enzyme's catalytic efficiency.

[0073] Meanwhile, alanine has only one methyl group in its side chain. Not only is its structure simple, but compared to the hydrogen atom side chain of glycine, alanine also possesses a certain volume and rigidity. This rigidity of the side chain allows alanine to provide a certain degree of stability in protein structures without introducing excessive complexity (such as polarity or charge). Although the side chain of glycine provides almost no steric hindrance, glycine is typically used in protein structures for regions requiring high flexibility (such as corners or loops). Mutating to glycine may lead to an overly flexible and loose protein structure, or even disrupt the original secondary structure (such as α-helices or β-sheets), making it impossible to accurately assess the contribution of that position to protein stability. The specific activity of the purified enzyme was measured to be 49.10 ± 2.3 U / mg, which is 2.09 times that of the chitinase mutant T-PbChi-M1 and reaches 294.27 ± 4.7% of the wild type.

[0074] As can be seen, the catalytic efficiency of the chitinase mutant T-PbChi-N1 obtained in Example 1 by mutating the 365th amino acid of the chitinase mutant T-PbChi-M1 from glutamic acid (Glu) to alanine (Ala) and the 368th amino acid from serine (Ser) to tyrosine (Tyr) is further improved. This is because the substrate-binding domain and the catalytic domain are connected by a "track" filled with aromatic amino acids. The chitinous sheet slides along this track from the chitin-binding region to the vicinity of the substrate-binding pocket. The reduction in steric hindrance as the substrate slides into the catalytic TIM barrel is more conducive to improving catalytic efficiency.

[0075] Example 3:

[0076] This embodiment further refines the rational design of the catalytic domain α / β sheet of the obtained chitinase mutant T-PbChi-N1 based on Example 2. The specific steps are as follows:

[0077] (1) Using pHT-PbChi-N1 as a template, primers D63Y-F / D63Y-R, D196Y-F / D196Y-R and

[0078] Three one-step whole-plasmid PCR site-directed mutagenesis trials were performed on K225T-F / K225T-R to change the catalytic residues Glu63 to Tyr225, Glu196 to Tyr196, and Lys225 to Thr225. The mutated recombinant plasmids were then injected into *E. coli* DH5α and plated on solid LB medium containing 0.2 mg / mL ampicillin sodium, and incubated at 37°C for 14 h. The PCR site-directed mutagenesis conditions were: 98°C for 3 min, 98°C for 10 s, 55°C for 15 s, and 72°C for 120 s, for 30 cycles. The nucleotide sequences of primers D63Y-F / D63Y-R, D196Y-F / D196Y-R, and K225T-F / K225T-R are shown in SEQ ID NO. 18–23.

[0079] Single colonies were selected and colony PCR was performed using the validation primers pHT-YZ-F and pHT-YZ-R. After the sequencing was confirmed to be correct, the colonies were amplified and plasmids were extracted to obtain the mutant plasmid pHT-PbChi-N1-D63Y / D196Y / K225T, denoted as pHT-PbChi-S, and the mutant fragment was PbChi-S.

[0080] The mutant plasmid pHT-PbChi-S was transformed into B. subtilis WB800N competent cells to obtain recombinant engineered bacteria B. subtilis WB800N-pHT-PbChi-S. Chitinase mutant was obtained according to the method of step (3) in Example 1, and was denoted as T-PbChi-S. Its amino acid sequence is shown in SEQ ID NO.5.

[0081] (2) Using the amino acid sequence of the mutant fragment PbChi-S as a template, a three-dimensional protein model was constructed, resulting in a protein model denoted as PBCHI-S. Figure 6 It can be seen that the catalytic crack of chitinase consists of multiple aromatic residues arranged linearly on both sides of the catalytic center. The arrangement of these aromatic clusters can regulate the geometry and dynamic stability of the catalytic pocket, forming stacking or hydrophobic interactions with one or both sides of the sugar ring, and forming a flexible sheath that propels the chitin chain to slide along the sheath. Molecular dynamics simulations were performed on the amino acids located on the α / β-sheet. Through comparison of the final structure and trajectory analysis results, it was predicted that Glu63, Glu196, and Lys225 are site-directed amino acid selection mutations with significant impact on the RMSF on the β-sheet. Subsequently, the interaction relationships between the internal residues of the protein before and after the mutation were analyzed using the online tool RING, to understand the relationship between protein structure and function from a network topology perspective.

[0082] Figure 7 The interactions between protein residues before and after the D63Y mutation are shown in (A) and (B) respectively. After the aspartic acid at position 196 (D) is changed to tyrosine (Y), it forms an additional hydrogen bond, a van der Waals force, and a π-Cation interaction with lysine at position 155 (K). The interaction with threonine at position 156 (T) changes from two hydrogen bonds and a van der Waals force to a single hydrogen bond. Simultaneously, the interaction with lysine at position 243 (K) also changes from a van der Waals force to a π-Cation interaction. For the amino acid at position 63 (… Figure 7 A) Originally, the protein only interacted with asparagine (N) at position 60. After mutation, it not only retained the hydrogen bond with the residue at position 60, but also formed a π-π bond with phenylalanine (F) at position 59. Furthermore, all three interacted with the overall model structure, resulting in a more stable structural network between the mutated residue and the protein backbone. This contributes positively to maintaining the overall stability of the protein model.

[0083] Figure 8The changes in overall SASA and RMSF of the wild-type and mutant are shown. The results indicate that the overall solvent-accessible surface area after domain substitution is larger than that of the wild-type, with fluctuations within the range of 10,000 ps to 30,000 ps, ​​after which the solvent-accessible surface area of ​​both types remains relatively stable. Meanwhile, the RMSF results show that the wild-type exhibits greater overall fluctuation compared to the mutant, while the mutant tends to stabilize within the range of 0.2 nm to 1.0 nm. Finally, Western blotting was used to validate the combined mutant, and the results are as follows. Figure 9 As shown, the bands are consistent with the target size, and the specific enzyme activity after purification was measured to be 124.75±6.5 U / mg, which is 2.53 times that of T-PbChi-N1 and reaches 747.26±5.2% of the wild type.

[0084] As can be seen, the chitinase mutant T-PbChi-S described in this embodiment exhibits further improved hydrolysis efficiency and catalytic activity compared to the chitinase mutant T-PbChi-N1 obtained in Example 2. This may be because the rigid benzene ring structure of the aromatic amino acid at the β-sheet end of the chitinase catalytic domain can immobilize the carbocation intermediate through electrostatic and hydrophobic interactions, regulating the cyclization reaction pathway. Furthermore, it enhances substrate binding capacity through hydrogen bonding or hydrophobic interactions with multiple N-acetyl groups of the substrate. Simultaneously, the non-specific CH-π / π-π stacking interactions with the substrate can stabilize the substrate or intermediate, regulating catalytic activity. Additionally, aromatic amino acids may participate in the formation of "oxygen anion holes" in the active center, stabilizing the transition state intermediate through hydrogen bonding or electrostatic interactions. Mutating these residues may alter the substrate binding mode, thereby affecting hydrolysis efficiency.

[0085] Example 4:

[0086] In this embodiment, enzyme preparations of the chitinase mutants described in Examples 1-3 were prepared, and the enzyme preparations were used to prepare shrimp shell powder fermented feed through bacterial-enzyme synergistic processing. The specific steps are as follows:

[0087] (1) Preparation of enzyme preparations using chitinase mutants:

[0088] The engineered bacteria B. subtilis WB800N-pHT-PbChi-M1, B. subtilis WB800N-pHT-PbChi-N1, and B. subtilis WB800N-pHT-PbChi-S obtained in Examples 1-3 were inoculated into LB liquid medium containing chloramphenicol and kanamycin and induced to grow at 37°C with shaking at 170 rpm. After the culture was completed, the cultures were centrifuged at 8000 rpm for 15 min. The supernatant collected by centrifugation was the chitinase preparation and was designated as T-PbChi-M1, T-PbChi-N1, and T-PbChi-S.

[0089] (2) Synergistic preparation of shrimp shell powder fermented feed using bacteria and enzymes:

[0090] Feed ingredients were formulated using shrimp shell powder and soybean residue as the main ingredients, and wheat middlings and rice bran as auxiliary ingredients, with a shrimp shell powder: soybean residue: wheat middlings ratio of 4:3:2:1. The total inoculation amount of the feed was set at 6%, and the inoculation ratio was Saccharomyces cerevisiae: Bacillus licheniformis: Lactobacillus fermentum: Lactobacillus rhamnosus = 2:2:1:1. The enzyme preparation dosage was 10%, the moisture content was 45%, and the fermentation temperature was 35℃. Each group had three replicates, and a one-step fermentation method was used for sealed fermentation, that is, the various strains were directly inoculated into the mixed raw materials according to the ratio, and then water was added to the specified moisture content. After stirring and mixing, the mixture was immediately placed into one-way valve anaerobic fermentation bags and placed in a constant temperature incubator for 7 days of anaerobic fermentation. The following 7 groups were set up, and the pH, reducing sugar, and soluble protein content of each group were measured.

[0091] Before inoculation, Saccharomyces cerevisiae and Bacillus licheniformis were cultured in LB liquid medium to an OD 600 of 0.8-1.0, and Lactobacillus fermentum and Lactobacillus rhamnosus were cultured in MRS medium to an OD 600 of 0.8-1.0.

[0092] The grouping is as follows:

[0093] Group 1: Unfermentation group (unfermented after mixing raw materials);

[0094] Group 2: Raw materials were mixed and 12% B. subtilis WB800N pHT was added to the empty fermentation group (denoted as T);

[0095] Group 3: The raw materials were mixed and 12% B. subtilis WB800N pHT-PbChi free enzyme preparation was added to the fermentation group (denoted as T-PbChi);

[0096] Group 4: The raw materials were mixed and 12% B. subtilis WB800N pHT-PbChii-BsCBD free enzyme preparation was added to the fermentation group (denoted as T-PbChi-BsCBD);

[0097] Group 5: The raw materials were mixed and 12% B. subtilis WB800N pHT-PbChi-M1 chitinase preparation was added to the fermentation group (denoted as T-PbChi-M1);

[0098] Group 6: The raw materials were mixed and 12% B. subtilis WB800N pHT-PbChi-N1 chitinase preparation was added to the fermentation group (denoted as T-PbChi-N1);

[0099] Group 7: The raw materials were mixed and 12% B. subtilis WB800N pHT-PbChi-S chitinase preparation was added to the fermentation group (denoted as T-PbChi-S).

[0100] The results are shown in Table 1 and Figure 10 As shown, the initial pH of the feed was 6.59. After fermentation, the pH of the unfermented group decreased slightly to 6.25, and the pH of both the blank and control groups also decreased. Due to the continuous action of lactic acid bacteria, the pH of the experimental groups decreased to around 5.1. Regarding soluble protein, the control group had a lower soluble protein content, with the wild-type enzyme preparation group containing only 3.17±0.13 mg / mL. The content of soluble protein in the improved enzyme preparation groups was increased, with the optimal group (T-PbChi-S) reaching 7.81±0.09 mg / mL, 2.46 times that of the wild type.

[0101] The reducing sugar content of the fermented feed was measured, showing that the reducing sugar content in the blank control group was only 2.96±0.21%, and in the wild-type group it was only 4.71±0.63%. However, after replacing the substrate-binding domain, the data showed that the improved enzyme preparation had a significant degradation effect on shrimp shell powder. The reducing sugar content in the improved wild group reached 12.63±0.23%, while the modified mutants reached 19.24±0.55% (T-PbChi-M1), 23.38±0.41% (T-PbChi-N1), and 27.25±0.67% (T-PbChi-S), respectively, with the highest group reaching 5.78 times that of the wild type. These results indicate that the modified chitinase can effectively degrade shrimp shell powder, enabling the effective utilization of shell waste and showing broad application prospects in the bio-feed industry.

[0102] Table 1. pH, reducing sugar, and soluble protein content of each group of fermented feed

[0103]

[0104]

[0105] In summary, this invention has molecularly modified the chitinase PbChi from Paenibacillus barengoltzii. By increasing the flexibility of the linker protein, altering the catalytic residues in the β-sheet of the catalytic domain, and changing the steric hindrance at the substrate catalytic crack entrance, and through computational design and experimental verification, several highly active chitinase mutants were successfully constructed. These chitinase mutants can effectively degrade shrimp shell powder, enabling the effective utilization of shell waste and demonstrating broad application prospects in the bio-feed industry.

[0106] The embodiments described above are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments. Any obvious improvements, substitutions or modifications that can be made by those skilled in the art without departing from the essence of the present invention shall fall within the protection scope of the present invention.

Claims

1. A chitinase mutant, characterized in that, The chitinase mutant is modified based on SEQ ID NO.1 by any of the following mutations: (a) Mutate the amino acid at position 555 of SEQ ID NO. 1 from aspartic acid to glycine; or (b) Mutate the amino acid at position 555 of SEQ ID NO.1 from aspartic acid to glycine, the amino acid at position 365 from glutamic acid to alanine, and the amino acid at position 368 from serine to tyrosine; or (c) The amino acid at position 555 of SEQ ID NO.1 is mutated from aspartic acid to glycine, the amino acid at position 365 is mutated from glutamic acid to alanine, the amino acid at position 368 is mutated from serine to tyrosine, the amino acid at position 63 is mutated from glutamic acid to tyrosine, the amino acid at position 196 is mutated from glutamic acid to tyrosine, and the amino acid at position 225 is mutated from lysine to threonine.

2. The chitinase mutant according to claim 1, characterized in that, The amino acid sequence of the chitinase mutant is shown in SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.

5.

3. A polynucleotide encoding the chitinase mutant of claim 1 or 2.

4. A recombinant vector comprising the polynucleotide of claim 3.

5. Genetically engineered bacteria expressing the chitinase mutant of claim 1 or 2, or containing the recombinant vector of claim 4.

6. An enzyme preparation, characterized in that, The enzyme preparation uses one or more of the chitinase mutants (a) to (c) described in claim 1 as the main active ingredient.

7. The application of the chitinase mutant according to any one of claims 1 to 2, or the polynucleotide according to claim 3, or the recombinant vector according to claim 4, or the genetically engineered bacterium according to claim 5, or the enzyme preparation according to claim 6, wherein the application includes: (1) Degrading crustacean waste; and / or (2) Fermentation to produce biological feed.

8. The application according to claim 7, characterized in that, The shell waste includes one or more of shrimp shells and crab shells; The raw materials for the biological feed include shell waste.

9. A method for preparing fermented shrimp shell powder feed, characterized in that, The method includes: Fermentation strains are inoculated into shrimp shell powder fermented feed, and then chitinase mutants of any one of claims 1 to 2 or enzyme preparations of claim 6 are added. After stirring and mixing, the mixture is placed in a one-way valve anaerobic fermentation bag for one-step constant temperature fermentation.

10. The method for preparing fermented shrimp shell powder feed according to claim 9, characterized in that, The fermented shrimp shell powder feed uses shrimp shell powder and soybean residue as the main ingredients, and wheat bran and rice bran as auxiliary ingredients, with the ratio of shrimp shell powder: soybean residue: wheat bran: rice bran = 4:3:2:

1. The total inoculation amount of the fermentation bacteria is 6%, and the inoculation ratio is Saccharomyces cerevisiae: Bacillus licheniformis: Lactobacillus fermentum: Lactobacillus rhamnosus = 2:2:1:1; The amount of chitinase mutant or enzyme preparation added is 12% (w / w) of the shrimp shell powder fermented feed.

Images