MiRNA (micro Ribonucleic Acid) molecule for regulating and controlling fat deposition in pig muscle as well as product and application of miRNA molecule

Abstract

The invention relates to the technical field of molecular biology, and discloses a miRNA molecule for regulating and controlling fat deposition in pig muscle, one of the purposes of the invention is to provide a miRNA molecule for regulating and controlling fat deposition in pig muscle, the miRNA is SSC-miR-874, and the mature sequence of the miRNA is shown as SEQ ID NO1: CUGCCCUGGCCGAGGGACCGAC. The second purpose of the invention is to provide a product, and the product comprises SSC-miR-874 mimics or SSC-miR-874 inhibitor, and is characterized in that the SSC-miR-874 mimics and the SSC-miR-874 inhibitor are added into the product; wherein the sequences of the SSC-miR-874 mimics are as shown in SEQ ID NO1 (sequence identifier number 1) and SEQ ID NO2 (sequence identifier number 2), and the sequence of the SSC-miR-874 inhibitor is as shown in SEQ ID NO3 (sequence identifier number 3). The application reveals that the SSC-miR-874 can negatively regulate and control the proliferation and adipogenic differentiation of the precursor fat cells in the pig muscle, provides a new molecular target for deeply understanding the fat deposition mechanism in the pig muscle, provides an effective miRNA intervention strategy for optimizing the pork quality and increasing the fat content in the muscle, and has important breeding application value and industrialization prospect.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of pig breeding technology, and particularly relates to a miRNA molecule for regulating intramuscular fat deposition of pigs and a product and application thereof. BACKGROUND

[0002] Intramuscular fat (IMF) is one of the important factors affecting pork quality, and the content of which directly affects the flavor, tenderness and juiciness of pork. The deposition of intramuscular fat is affected by the proliferation and adipogenic differentiation of intramuscular precursor adipocytes. In recent years, with the development of whole transcriptome sequencing technology, the biological function of microRNA (miRNA) has gradually been known by everyone. As one of non-coding RNAs (ncRNAs), miRNA cannot encode proteins, but it plays an important role in the body. Studies have shown that miRNA is an important epigenetic regulatory factor, which can regulate the transcription of fat-related genes at the post-transcriptional level, and then regulate the generation of IMF. Therefore, taking miRNA as the starting point, in-depth study of the molecular mechanism of pig intramuscular precursor adipocyte proliferation and differentiation will help to further understand the regulation network of pig fat deposition, and has important significance for the molecular breeding of high-quality pork pigs. SUMMARY

[0003] To solve the technical problems proposed in the background art, the present application provides a miRNA molecule for regulating intramuscular fat deposition of pigs and a product and application thereof.

[0004] The present application adopts the following technical solutions: one of the purposes of the present application is to propose a miRNA molecule for regulating intramuscular fat deposition of pigs, and the miRNA is SSC-miR-874, and the mature sequence is as shown in SEQ ID NO1: CUGCCCUGGCCCGAGGGACCGAC.

[0005] The second purpose of the present application is to propose a product, which comprises SSC-miR-874 mimics or SSC-miR-874 inhibitor.

[0006] The sequence of the SSC-miR-874 mimics is as follows

[0007] SEQ ID NO1: CUGCCCUGGCCCGAGGGACCGAC

[0008] and

[0009] SEQ ID NO2: CGGUCCCUCGGGCCAGGGCAGUU

[0010] The sequence of the SSC-miR-874 inhibitor is shown as follows

[0011] SEQ ID NO 3: GUCGGUCCCUCGGGCCAGGGCAG.

[0012] Further, the product also comprises a pharmaceutically or agronomically acceptable carrier.

[0013] The third object of the present application is to propose the use of SSC-miR-874 or the above product in any of the following applications:

[0014] A1) preparing a product for inhibiting the proliferation of porcine intramuscular preadipocytes;

[0015] A2) preparing a product for inhibiting the adipogenic differentiation of porcine intramuscular preadipocytes;

[0016] A3) preparing a product for down-regulating the expression of proliferation-related genes, including at least one of PCNA, CDK1, CDK2, and CCND1;

[0017] A4) preparing a product for down-regulating the expression of adipogenic differentiation-related genes, including at least one of PPARγ, C / EBPβ, FABP4, and FASN;

[0018] A5) preparing a product for reducing the lipid droplet accumulation or triglyceride content of porcine intramuscular preadipocytes;

[0019] A6) molecular breeding of porcine intramuscular fat deposition.

[0020] Further, the preadipocytes are derived from porcine longissimus dorsi tissue.

[0021] Further, the molecular breeding in A6) aims to improve pork quality.

[0022] The fourth object of the present application is to propose a method for regulating the function of porcine intramuscular preadipocytes by transfecting SSC-miR-874 mimics or SSC-miR-874 inhibitors:

[0023] Transfecting the mimics inhibits cell proliferation and adipogenic differentiation;

[0024] Transfecting the inhibitors promotes cell proliferation and adipogenic differentiation.

[0025] Further, the transfection uses a complex comprising SSC-miR-874 mimics / inhibitors, Opti-MEM medium, and Lipofectamine 2000.

[0026] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0027] This application uses porcine intramuscular preadipocytes as experimental material and employs miRNA intervention methods, including cell transfection, CCK8 assay for cell proliferation, Oil Red O staining, isopropanol extraction, triglyceride (TG) content determination, and RT-qPCR, to systematically investigate the regulatory effect of SSC-miR-874 on the proliferation and adipogenic differentiation of porcine intramuscular preadipocytes.

[0028] This application is the first to identify and verify the key regulatory function of porcine miRNA molecule SSC-miR-874 in intramuscular fat deposition. The results showed that overexpression of SSC-miR-874 significantly inhibited the proliferation and adipogenic differentiation of porcine intramuscular preadipocytes, manifested as decreased cell activity, reduced lipid droplets, and decreased triglyceride content, accompanied by a significant downregulation of the expression of proliferation-related genes (PCNA, CDK1, CDK2, CCND1) and adipogenic differentiation-related genes (PPARγ, C / EBPβ, FABP4, FASN). Conversely, inhibition of SSC-miR-874 expression significantly promoted cell proliferation and adipogenesis, with upregulation of related gene expression.

[0029] This application reveals that SSC-miR-874 can negatively regulate the proliferation and adipogenic differentiation of porcine intramuscular preadipocytes, providing a new molecular target for a deeper understanding of the mechanism of intramuscular fat deposition in porcines. It also provides an effective miRNA intervention strategy for optimizing pork quality and increasing intramuscular fat content, and has important breeding application value and industrialization prospects. Attached Figure Description

[0030] Figure 1 This is the temporal expression profile of SSC-miR-874 during the adipogenic differentiation of porcine intramuscular preadipocytes in this embodiment of the invention; Note: All the above differences are compared with day 0;

[0031] Figure 2 This is a measurement of the transfection efficiency of mimics and inhibitor in the embodiments of the present invention; Note: A is the transfection efficiency of mimics; B is the transfection efficiency of inhibitor; the mimics group is the SSC-miR-874mimics group, and the inhibitor group is the SSC-miR-874inhibitor group.

[0032] Figure 3 This invention illustrates the effect of SSC-miR-874 overexpression on the proliferation of porcine intramuscular preadipocytes. Note: A shows cell proliferation as measured by CCK8 assay; B shows the effect of SSC-miR-874 overexpression on proliferation-related genes.

[0033] Figure 4This invention illustrates the effect of inhibiting SSC-miR-874 on the proliferation of porcine intramuscular preadipocytes; where: Note: A represents cell proliferation as measured by CCK8; B represents the effect of inhibiting SSC-miR-874 on proliferation-related genes;

[0034] Figure 5 This invention illustrates the effect of SSC-miR-874 overexpression on adipogenic differentiation of porcine intramuscular preadipocytes. Note: A is Oil Red O staining; B is Oil Red O extracted with isopropanol; C is triglyceride content; D is the effect of SSC-miR-874 overexpression on adipogenic differentiation-related genes.

[0035] Figure 6 This invention illustrates the effect of inhibiting SSC-miR-874 on adipogenic differentiation of porcine intramuscular preadipocytes; wherein: A is Oil Red O staining; B is Oil Red O extracted with isopropanol; C is triglyceride content; and D is the effect of inhibiting SSC-miR-874 on adipogenic differentiation-related genes. Detailed Implementation

[0036] The present invention will now be further described in conjunction with the accompanying drawings and specific embodiments. It should be noted that, without conflict, the various embodiments or technical features described below can be arbitrarily combined to form new embodiments.

[0037] Example:

[0038] Primary culture of porcine intramuscular preadipocytes was conducted in a laboratory cell culture facility.

[0039] In this embodiment, the main reagents used in the experiment are shown in Table 2-1.

[0040] Table 2-1: Main Reagents

[0041]

[0042]

[0043] In this embodiment, the main instruments used in the experiment are shown in Table 2-2.

[0044] Table 2-2: Main Instruments

[0045]

[0046]

[0047] The experimental method proposed in this embodiment is carried out as follows:

[0048] The primer design and synthesis procedures are detailed below:

[0049] The primers used in the experiment were designed and synthesized by Shanghai Sangon Biotech Co., Ltd., and their sequences are shown in Table 2-3. Primers for SSC-miR-874 and U6 were designed using the stem-loop method. GAPDH was used as an endogenous control gene for mRNA. U6 was used as an endogenous control gene for SSC-miR-874.

[0050] Table 2-3: Primer Sequences

[0051]

[0052]

[0053]

[0054] In this embodiment, the total RNA extraction and quality testing procedures are detailed as follows:

[0055] (1) Extraction of total RNA from cells

[0056] a. Discard the culture medium and wash the cells 1-2 times with pre-cooled PBS;

[0057] b. Per 10cm 2 Add Trizol at a ratio of 1 mL Trizol to the bottom area of ​​the culture dish (e.g., 1 mL per well in a six-well plate). After pipetting 5-10 times, place the dish on ice and lyse for 5-10 minutes.

[0058] c. After mixing thoroughly by pipetting, transfer the solution to a 1.5 mL EP tube;

[0059] d. Add 200 μL of pre-cooled chloroform at a ratio of Trizol:chloroform = 5:1, shake vigorously for 15 seconds, let stand on ice for 10-15 minutes, and then centrifuge at 4°C and 12000 rpm for 15-20 minutes.

[0060] e. During the centrifugation process in step d, prepare 75% ethanol at a ratio of anhydrous ethanol: DEPC = 3:1, mix by inverting, and then pre-cool on ice;

[0061] f. Pipette 400 μL of the supernatant after centrifugation into a new EP tube, add 400 μL of pre-cooled isopropanol, invert the tube 10 times, let it stand on ice for 15-20 min, and then centrifuge at 4°C and 20,000 rpm for 15-20 min.

[0062] g. Discard the supernatant, add 1 mL of pre-cooled 75% ethanol to each EP tube, pipette and blow about 10 times, then centrifuge at 4°C and 20,000 rpm for 5-10 min.

[0063] h. Repeat step g 1-2 times;

[0064] i. After discarding the supernatant, open the cap and invert it onto ice to air dry the precipitate. Add pre-cooled DEPC water to dissolve the precipitate, and store the resulting RNA solution in a -80°C freezer.

[0065] (2) RNA concentration and quality detection

[0066] Take 1 μL of RNA solution and determine its concentration and OD. 260 / OD 280 OD 260 / OD 230 The value of OD 260 / OD 280 Within the range of 1.8-2.2 and OD 260 / OD 230 A value in the range of 2.0-2.5 is sufficient for subsequent experiments.

[0067] In this embodiment, the quantitative real-time PCR procedure for SSC-miR-874 is detailed as follows:

[0068] (1) Reverse transcription of miRNA

[0069] According to HyperScript TM III miRNA 1 st The Strand cDNA Synthesis Kit (by stem-loop) (EnzyArtisan, China) provides the following steps for reverse transcription of miRNA. The reaction system and conditions are shown in Table 2-4.

[0070] Table 2-4: Reverse transcription system and conditions for miRNAs

[0071]

[0072] (2) qPCR of miRNA

[0073] Following the operating procedures provided with the 2×S6 miRNA SYBR qPCR Mix (EnzyArtisan, China) kit, the BIO-RAD (CFX96) was used. TM qPCR was performed using a Real-Time System instrument. U6 was used as an endogenous control gene for miRNAs. Three technical replicates were set up for each group. The reaction system and reaction conditions are shown in Table 2-5.

[0074] Table 2-5: qPCR system and conditions for miRNA

[0075]

[0076] In this embodiment, the mRNA quantification procedure is detailed as follows:

[0077] (1) Reverse transcription

[0078] According to HyperScript TM The III RT SuperMix for qPCR with gDNA Remover (EnzyArtisan, China) kit provides the following steps for reverse transcription of mRNA. The reaction system and conditions are shown in Table 2-6.

[0079] Table 2-6: mRNA reverse transcription system and conditions

[0080]

[0081] (2) qPCR

[0082] Following the operating procedures provided with the 2×S6 Universal SYBR qPCR Mix (EnzyArtisan, China) kit, the BIO-RAD (CFX96) was used. TM qPCR was performed using a Real-Time System instrument. GAPDH was used as an endogenous control gene for mRNA. Three technical replicates were set up for each group. The reaction system and reaction conditions are shown in Table 2-7.

[0083] Table 2-7: qPCR system and conditions for mRNA

[0084]

[0085] Continued from Table 2-7: qPCR system and conditions for mRNA

[0086]

[0087] In this embodiment, the isolation, culture, and induction procedures of porcine intramuscular preadipocytes are detailed as follows:

[0088] (1) Primary isolation of porcine intramuscular preadipocytes

[0089] Primary porcine intramuscular preadipocytes were isolated using collagenase digestion. The specific steps are as follows:

[0090] a. Three-day-old piglets were injected with sodium pentobarbital solution, and died after being put into a coma and bleeding out of their hearts.

[0091] b. Clean the whole body with 1-5% (v / v) benzalkonium chloride, soak in 75% ethanol for 20-30 minutes, and separate the longissimus dorsi muscle tissue under aseptic conditions;

[0092] c. Wash the tissue 3-5 times with PBS containing double the amount of antibiotics. Use sterilized ophthalmic scissors to remove visible connective tissue and blood vessels, and cut the tissue into 1-2 mm pieces. 3 A tissue block of about the same size;

[0093] d. Add twice the volume of type I collagenase digestion solution to each gram of tissue, and digest at 37°C for 1-2 hours, shaking repeatedly during the process to promote complete tissue digestion;

[0094] e. Neutralize the digestion solution with an equal volume of DMEM / F12 medium containing 10% FBS to terminate digestion, filter using 70-mesh and 200-mesh cell sieves, and collect the filtrate;

[0095] f. Centrifuge the collected filtrate at 1500 rpm for 10 min, discard the supernatant, resuspend the cells in serum-free DMEM / F12 medium, centrifuge at 1500 rpm for 10 min, and repeat this step twice.

[0096] g. Resuspend cells in DMEM / F12 medium containing 10% FBS;

[0097] h. After cell counting, at 2.5 × 10 5 Live cells were seeded at a density of 10 cm culture dish, transferred to a 37°C 5% CO2 incubator and cultured for 1 h. The medium was then changed and the cells were washed with sterile PBS until the background was clean.

[0098] i. Replace with fresh complete culture medium and transfer the cells to a 37°C 5% CO2 incubator for continued culture;

[0099] (2) Passage of porcine intramuscular preadipocytes

[0100] When the cells reach 80-90% confluence, passage them. Discard the old culture medium, wash the cells once with PBS, and then add 2 mL of 0.25% trypsin digestion solution to digest for 2-3 min. Add twice the volume of complete culture medium to stop digestion, pipette and agitate the bottom of the culture dish to remove all cells from the bottom, collect the cell suspension in a 1.5 mL centrifuge tube, and centrifuge at 1500 rpm for 10 min. Discard the supernatant, add 2 mL of complete culture medium to resuspend the cells, and seed them according to experimental requirements. After shaking the cells well, transfer them to a 37℃ 5% CO2 incubator for culture.

[0101] (3) Induction and differentiation of porcine intramuscular preadipocytes

[0102] Once the cells reached 90% confluence, they were cultured in complete medium for about 2 days to induce contact inhibition. After inducing differentiation for 2 days, they were cultured in complete medium containing 0.5 mM IBMX, 1 μM DEX and 5 μg / mL insulin (i.e., induction medium). Then, they were cultured in complete medium containing 5 μg / mL insulin (i.e., maintenance medium). The medium was changed every 2 days until the cells were used for subsequent experiments.

[0103] All cells used in all experimental groups in this study were F3 generation porcine intramuscular adipocytes.

[0104] In this embodiment, the Oil Red O staining procedure is detailed as follows:

[0105] Cells induced to differentiate into lipids for 8 days were stained with Oil Red O. The specific steps are as follows:

[0106] (1) Discard the waste culture medium, wash with PBS 2-3 times, and fix with Oil Red O fixative for 20-30 min;

[0107] (2) Discard the fixative and wash the cells 2-3 times with distilled water;

[0108] (3) Add 60% isopropanol and rinse for 20-30 seconds;

[0109] (4) After discarding 60% isopropanol, add freshly prepared Oil Red O staining solution (Oil Red O staining solution A: Oil Red O staining solution B = 3:2) and immerse for 10-20 minutes. The immersion time can be adjusted according to the staining situation.

[0110] (5) Discard the staining solution, rinse with 60% isopropanol until the interstitial tissue is clear, and then rinse with distilled water until there is no excess staining solution.

[0111] (6) Add Mayer's hematoxylin staining solution and counterstain the nuclei for 1-2 min. Discard the staining solution and wash with water 2-5 times. Add Oil Red O buffer for 1 min and discard.

[0112] (7) Add distilled water to cover the cells and observe and photograph them under a microscope;

[0113] (8) Add 1 mL of isopropanol to each well of a six-well plate, shake on a shaker for 5 min, and transfer 100 μL of the solution to a 96-well plate. Measure the solution at 490 nm using a microplate reader. [142,143] The absorbance value was recorded.

[0114] In this embodiment, the triglyceride content was measured in detail as follows:

[0115] On day 8 after the cells were induced to differentiate into lipids, the old culture medium was discarded, the cells were washed with PBS 2-3 times, and 600 μL of Triton X-100 (1-2%) solution was added to each well of a six-well plate. The cells were lysed for 30-40 min, and the cells were repeatedly pipetted. The cells were observed under a microscope to see if they were completely lysed. After complete lysis, the liquid was transferred to a 1.5 mL EP tube.

[0116] The total protein quantification kit (A045-3-2) and triglyceride assay kit (A110-1-1) were used to determine and calculate the triglyceride content of the samples, and the data were recorded. The triglyceride data were normalized during intergroup comparison analysis.

[0117] In this embodiment, the transfection efficiency measurement procedure is detailed as follows:

[0118] (1) Synthesis of transfection reagent

[0119] The SSC-miR-874 mimics and SSC-miR-874 inhibitor used in the experiment were purchased from Shanghai Jima Pharmaceutical Technology Co., Ltd., and the sequence design is shown in Table 2-8.

[0120] Table 2-8: Sequence Information

[0121]

[0122] (2) Cell transfection

[0123] Cells were packed at 8×10 5 Cells were seeded per well in 6-well plates and transferred to a 37°C CO2 incubator for culture. Transfection was performed when the cell confluence reached approximately 50%.

[0124] SSC-miR-874 transfection efficiency test groups: NC, SSC-miR-874 mimics and inhibitor NC (iNC), SSC-miR-874 inhibitor;

[0125] Each group had 3 replicates. The transfection steps were as follows:

[0126] a. Number several 1.5mL EP tubes according to the above grouping. Add 250μL of OPTI-MEM serum-depleted medium and 5μL of Lipofectamine to each 1.5mL EP tube. TM 2000, gently blow to mix, and incubate at room temperature for 5 minutes;

[0127] b. Take a new 1.5 mL EP tube, add 250 μL of OPTI-MEM serum-depleted medium, and add 100 nM NC, 100 nM SSC-miR-874 mimics and 200 nM iNC, 200 nM SSC-miR-874 inhibitor in separate groups. Gently pipette to mix, and incubate at room temperature for 5 min;

[0128] c. Add the mixture from step b to the mixture from step a dropwise, gently blow and mix, and incubate at room temperature for 15-20 minutes.

[0129] d. Change the medium for the cells to be transfected, add 1500 μL of antibiotic-free complete medium to each well, add the mixture from step c to the well plate, gently shake to mix, and then transfer to a 37℃ CO2 incubator for culture. After 6 h, change to complete medium. After 24 h of transfection, collect cells to extract RNA, and after 48 h of transfection, extract cell proteins.

[0130] (3) Total RNA extraction and quality detection from porcine intramuscular preadipocytes

[0131] The steps are the same as above.

[0132] (4) cDNA synthesis and fluorescence quantification

[0133] The methods for miRNA reverse transcription and qPCR are the same as in 2.2.4; the methods for mRNA reverse transcription and qPCR are the same as in 2.2.5.

[0134] In this embodiment, the time sequence representation detection operation is detailed as follows:

[0135] Cells were packed at 8×10 5 Cells were seeded per well in 6-well plates at 6 time points: 0d, 2d, 4d, 6d, 8d, and 10d, with 3 replicates at each time point. Cells were then transferred to a 37℃ CO2 incubator for culture. When cell confluence reached approximately 90%, cells were cultured in complete medium for about 2 days to induce contact inhibition. This was then switched to induction medium, recorded as day 0. After 2 days of induction, cells were cultured in maintenance medium until day 10, with the maintenance medium changed every 2 days. Cell samples from days 0, 2, 4, 6, 8, and 10 were collected using the Trizol assay for RNA extraction and quantitative PCR, following the same steps as in 2.2.3, 2.2.4, and 2.2.5. The expression level of SSC-miR-874 at these 6 time points was measured to detect the temporal expression profile of SSC-miR-874 during porcine intramuscular preadipocyte differentiation.

[0136] In this embodiment, the CCK8 method for detecting proliferation efficiency is performed in detail as follows:

[0137] (1) The cells were arranged at 2×104 Cells were seeded per well in 96-well plates and transferred to a 37°C CO2 incubator for culture. Transfection was performed when the cell confluence reached approximately 50%.

[0138] (2) SSC-miR-874 transfection experiment grouping

[0139] NC, SSC-miR-874mimics, iNC and SSC-miR-874inhibitor, each group with 5 replicates;

[0140] (3) Cell transfection

[0141] a. Add 25 μL of OPTI-MEM serum-depleted medium and 1 μL of Lipofectamine to a 1.5 mL sterile, enzyme-free EP tube. TM 2000, gently blow to mix, and incubate at room temperature for 5 minutes;

[0142] b. Take a new 1.5 mL sterile enzyme-free EP tube and add 25 μL of OPTI-MEM serum-depleted medium. Then, add 100 nM iNC and 100 nM SSC-miR-874 mimics; or 200 nM iNC and 200 nM SSC-miR-874 inhibitor, in separate groups. Gently pipette to mix and incubate at room temperature for 5 min.

[0143] c. Add the mixture from step b to the mixture from step a dropwise, gently blow and mix, and incubate at room temperature for 15-20 minutes.

[0144] d. Replace the cells to be transfected with antibiotic-free medium, add 10 μL of the mixture from step c to each well, and incubate in a 37℃ CO2 incubator. After 6 h, replace with complete medium. After 24 h, 48 h and 72 h of transfection, add 10 μL of CCK8 reagent to each well, incubate at 37℃ for 1 h, and then measure the absorbance at 450 nm and record the data.

[0145] (4) RT-qPCR assay of cell proliferation factors

[0146] Cell plating, experimental grouping, and cell transfection methods are the same as above. Use 8 × 10⁸ cells per cell line. 5 Each sample was seeded into a 6-well plate, with 3 replicates per group during transfection. Samples were collected 24 hours after transfection, and RNA was extracted using the Trizol method. After reverse transcription, quantitative PCR was performed using the same method as above, which will not be repeated here.

[0147] In this embodiment, the detailed detection procedures for adipogenic differentiation-related indicators are as follows:

[0148] (1) The cells were arranged at 8×10 5Cells were seeded per well in 6-well plates and transferred to a 37°C CO2 incubator for culture. Transfection was performed when the cell confluence reached about 50%.

[0149] (2) SSC-miR-874 transfection experiment grouping

[0150] NC, SSC-miR-874mimics, iNC and SSC-miR-874inhibitor, with 3 replicates for each group;

[0151] (3) Transfection steps.

[0152] (4) Inducing differentiation.

[0153] (5) Oil Red O staining.

[0154] (6) Determination of triglyceride content.

[0155] (7) RT-qPCR determination of adipogenic differentiation-related genes

[0156] The procedure is the same as above. Cells induced to differentiate for 2d, 4d, 6d and 8d were collected respectively. RNA was extracted using the Trizol method, reverse transcribed and then subjected to fluorescence quantification. The above steps are the same as those described above and will not be repeated here.

[0157] The data analysis for the above experiment is as follows:

[0158] Specifically, gene expression levels in RT-qPCR experiments were measured using 2... –ΔΔCT The methods were used for calculation. Each experiment had at least three biological replicates. Statistical analysis and graphing were performed using Graphpad Pism 9.5 software. Results are expressed as mean ± standard deviation (M ± SD). Data between two groups were analyzed using t-tests, and data from three or more groups were analyzed using one-way ANOVA. At the significance level, ns indicates P > 0.05, * indicates P < 0.05, ** indicates P < 0.01, and *** indicates P < 0.001.

[0159] Temporal expression profile analysis of SSC-miR-874

[0160] In detail, to verify whether SSC-miR-874 plays a role in porcine intramuscular preadipocytes, RT-qPCR was performed on cells induced to differentiate into adipocytes at 0d, 2d, 4d, 6d, 8d, and 10d to determine the expression level of SSC-miR-874 at different time points during the adipogenic differentiation of porcine intramuscular preadipocytes, thus constructing a temporal expression profile of SSC-miR-874. Figure 1The results showed that the expression level of SSC-miR-874 was significantly downregulated during adipogenic differentiation (P < 0.001), decreasing sharply from day 0 to day 6, slightly increasing from day 6 to day 8, and then decreasing again. Figure 1 The results indicate that SSC-miR-874 may play a role in the adipogenic differentiation of porcine intramuscular preadipocytes, providing a basis for further research on the function of SSC-miR-874.

[0161] Analysis of transfection efficiency determination of mimics and inhibitors in SSC-miR-874:

[0162] Specifically, overexpression and interference of SSC-miR-874 expression levels were achieved by transfecting porcine intramuscular preadipocytes with mimics and inhibitors. RT-qPCR results showed that the expression level of SSC-miR-874 was significantly upregulated after the addition of mimics (P < 0.001). Figure 2 A) After the inhibitor was added, the expression level of SSC-miR-874 was significantly downregulated (P < 0.001). Figure 2 B).

[0163] Analysis of the effect of SSC-miR-874 on the proliferation of porcine intramuscular preadipocytes

[0164] Specifically, overexpression of SSC-miR-874 inhibits the proliferation of porcine intramuscular preadipocytes.

[0165] To clarify the specific effects of SSC-miR-874 on the proliferation of porcine intramuscular preadipocytes, this study overexpressed SSC-miR-874 by transfection with chemically synthesized mimics. Cell proliferation capacity was measured at 24 h, 48 h, and 72 h post-transfection using the CCK8 assay. Figure 3 A) It was found that the OD value at 450 nm was significantly reduced after transfection with mimics (P < 0.05), indicating a decrease in the proliferative capacity of porcine intramuscular preadipocytes. Quantitative analysis of proliferation-related genes was performed using RT-qPCR, and the results are as follows: Figure 3 As shown in Figure B, overexpression of SSC-miR-874 significantly downregulated the expression levels of CDK1 and CDK2 genes (P < 0.05), and extremely significantly downregulated the expression levels of PCNA and CCND1 genes (P < 0.01). These data indicate that overexpression of SSC-miR-874 can downregulate the expression levels of proliferation-related genes and inhibit the proliferation of porcine intramuscular preadipocytes.

[0166] Specifically, inhibiting SSC-miR-874 promotes the proliferation of porcine intramuscular preadipocytes.

[0167] To further determine the effect of SSC-miR-874 on the proliferation of porcine intramuscular preadipocytes, this study also transfected cells with an inhibitor to suppress the expression level of SSC-miR-874 in porcine intramuscular preadipocytes. Cell proliferation was measured using the CCK8 assay at 24 h, 48 h, and 72 h post-transfection. Figure 4 A) The OD values ​​at 450 nm were found to be significantly increased after transfection with the inhibitor (P < 0.001), indicating enhanced proliferative capacity of porcine intramuscular preadipocytes. RT-qPCR was used to detect the expression levels of proliferation-related genes, and the results are as follows: Figure 4 As shown in Figure B, the expression level of CCND1 gene was significantly upregulated (P < 0.05), and the expression levels of PCNA and CDK2 genes were extremely significantly upregulated (P < 0.01). These data indicate that inhibiting SSC-miR-874 can upregulate the expression of proliferation-related genes and promote the proliferation of porcine intramuscular preadipocytes.

[0168] Effects of SSC-miR-874 on adipogenic differentiation of porcine intramuscular preadipocytes

[0169] Specifically, overexpression of SSC-miR-874 inhibits adipogenic differentiation of porcine intramuscular preadipocytes.

[0170] To determine the specific role of SSC-miR-874 in the adipogenic differentiation of porcine intramuscular preadipocytes, this study performed Oil Red O staining, isopropanol extraction, and TG content determination on cells induced to differentiate into adipocytes for 8 days. The results showed that, compared with the NC group, significantly increased SSC-miR-874 expression levels resulted in a significant reduction in intracellular lipid droplets. Figure 5 A). The results of quantitative Oil Red O staining using isopropanol extraction showed that the lipogenic effect of the mimics group was significantly lower than that of the NC group (P < 0.001). Figure 5 B). TG measurement results revealed ( Figure 5 C), the TG content in the SSC-miR-874 overexpression group was significantly lower than that in the NC group (P < 0.01). Further analysis of the expression levels of adipogenic differentiation-related genes after SSC-miR-874 overexpression showed that ( Figure 5D) The expression levels of PPARγ in the mimics group were significantly lower than those in the control group on days 4 and 6 (P < 0.001); the expression levels of C / EBPβ on days 2, 4, 6, and 8 were significantly lower than those in the control group (P < 0.05); the expression levels of FABP4 on days 4 and 6 were significantly lower than those in the control group (P < 0.01); and the expression levels of FASN on days 2, 4, 6, and 8 were significantly lower than those in the control group (P < 0.05). These data suggest that overexpression of SSC-miR-874 may inhibit the adipogenic differentiation capacity of porcine intramuscular preadipocytes by suppressing the expression of adipogenic differentiation-related genes.

[0171] To further investigate the effect of SSC-miR-874 on adipogenic differentiation of porcine intramuscular preadipocytes, Oil Red O staining revealed that a significant decrease in SSC-miR-874 expression led to a significant increase in intracellular lipid droplets. Figure 6 A). The results of quantitative Oil Red O staining using isopropanol extraction confirmed that the lipogenic effect in the inhibitor group was significantly higher than that in the control group (P < 0.001). Figure 6 B), and the TG content was also significantly higher than that of the NC group (P < 0.01). Figure 6 C). Further analysis of the expression levels of adipogenic differentiation-related genes after SSC-miR-874 inhibition showed that ( Figure 6 (D) The expression levels of PPARγ, C / EBPβ, FABP4, and FASN in the inhibitor group were significantly higher than those in the control group on day 2 of induction (P < 0.05); the expression level of PPARγ was significantly lower than that in the control group on day 4 (P < 0.01); the expression levels of FABP4 and FASN were significantly lower than those in the control group on day 4 (P < 0.01); and the expression levels of FASN were significantly higher than those in the control group on days 6 and 8 of induction (P < 0.01). These data suggest that inhibiting SSC-miR-874 may promote adipogenic differentiation of porcine intramuscular preadipocytes by promoting the expression of adipogenic differentiation-related genes.

[0172] To investigate whether SSC-miR-874 is involved in porcine intramuscular adipocyte differentiation, this application collected time-series expression samples of SSC-miR-874 at 0, 2, 4, 6, 8, and 10 days after induction of differentiation. RT-qPCR was used to detect the expression level of SSC-miR-874 at these six time points, constructing a temporal expression profile of SSC-miR-874 during the adipogenic differentiation of porcine intramuscular preadipocytes. In the temporal expression profile of SSC-miR-874, the expression level of SSC-miR-874 continuously decreased from 0 to 6 days after induction of differentiation, and the expression level thereafter was significantly lower than that on day 0. These results indicate that SSC-miR-874 exhibits significantly differential expression during the adipogenic differentiation of porcine intramuscular preadipocytes, suggesting that SSC-miR-874 may be closely related to fat deposition in pigs. Therefore, further in-depth exploration of the detailed role of SSC-miR-874 in porcine fat deposition will help to further discover new targets regulating porcine fat deposition traits.

[0173] This application describes transfecting porcine intramuscular preadipocytes with SSC-miR-874 mimics and inhibitors to alter its expression level in cells. Overexpression of SSC-miR-874 decreased the proliferation capacity of porcine intramuscular preadipocytes, and significantly downregulated the expression levels of proliferation-related genes; intracellular lipid droplet accumulation decreased, triglyceride content decreased, and adipogenic differentiation-related genes such as PPARγ, C / EBPβ, FABP4, and FASN were also significantly downregulated during adipogenic differentiation. When the expression level of SSC-miR-874 decreased, the proliferation capacity of porcine intramuscular preadipocytes increased, and the expression levels of proliferation-related genes PCNA, CDK2, and CCND1 were also significantly upregulated; intracellular lipid droplet accumulation increased, triglyceride content increased, and adipogenic differentiation-related genes such as PPARγ, C / EBPβ, FABP4, and FASN were also significantly upregulated during adipogenic differentiation. Based on the results of this experiment, it can be inferred that SSC-miR-874 can inhibit the proliferation and adipogenic differentiation of porcine intramuscular preadipocytes, thereby affecting fat deposition in pigs.

[0174] The above description is merely a specific embodiment of this application, but the scope of protection of this application is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in this application should be included within the scope of protection of this application. Therefore, the scope of protection of this application should be determined by the scope of the claims.

Claims

1. A miRNA molecule that regulates intramuscular fat deposition in porcine muscles, characterized in that, The miRNA is SSC-miR-874, and its sequence is shown in SEQ ID NO1.

2. A product, characterized in that, Contains the SSC-miR-874 mimics or SSC-miR-874 inhibitor as described in claim 1; The sequences of the SSC-miR-874mimics are shown in SEQ ID NO1 and SEQ ID NO2. The sequence of the SSC-miR-874 inhibitor is shown in SEQ ID NO3.

3. The product according to claim 2, characterized in that, It also includes pharmaceutically or agriculturally acceptable carriers.

4. The SSC-miR-874 of claim 1, or the product of claims 2-3, in any of the following applications: A1) Prepare a product that inhibits the proliferation of porcine intramuscular preadipocytes; A2) Prepare a product that inhibits adipogenic differentiation of porcine intramuscular preadipocytes; A3) Prepare products that downregulate the expression of proliferation-related genes, wherein the genes include at least one of PCNA, CDK1, CDK2, and CCND1; A4) Prepare products that downregulate the expression of adipogenic differentiation-related genes, wherein the genes include at least one of PPARγ, C / EBPβ, FABP4, and FASN; A5) Prepare products that reduce lipid droplet accumulation or triglyceride content in porcine intramuscular preadipocytes; A6) Molecular breeding of intramuscular fat deposition in pigs.

5. The application according to claim 4, characterized in that, The precursor fat cells were derived from the longissimus dorsi muscle tissue of pigs.

6. The application according to claim 4, characterized in that, The molecular breeding described in A6 aims to improve pork quality.

7. A method for regulating the function of porcine intramuscular preadipocytes, characterized in that, This can be achieved by transfecting SSC-miR-874 mimics or SSC-miR-874 inhibitor: Transfection with the mimics inhibited cell proliferation and adipogenic differentiation; Transfection with the inhibitor promotes cell proliferation and adipogenic differentiation.

8. The method according to claim 7, characterized in that, The transfection was performed using a complex containing SSC-miR-874 mimics / inhibitor, Opti-MEM medium, and Lipofectamine 2000.

Images