Application of SQLE gene in inhibition of PEDV virus replication

Abstract

The invention belongs to the field of gene engineering, and particularly relates to application of an SQLE gene in inhibition of PEDV virus replication. The invention provides shRNA (short hairpin Ribonucleic Acid) of a specific targeting SQLE gene, the shRNA can specifically target the SQLE gene, the knock-down of the SQLE gene is realized, and an LLC-PK1 cell line of the knock-down cholesterol metabolism gene SQLE is obtained. The cell line has resistance phenotype to PEDV virus, can significantly inhibit PEDV virus, and is expected to enhance immunogenicity and induce a body to generate stronger immune response, so that PEDV infection is effectively resisted, and the problem of poor immune effect of a traditional vaccine is solved.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of genetic engineering, and particularly relates to application of an SQLE gene in inhibiting PEDV virus replication. BACKGROUND

[0002] Porcine epidemic diarrhea (PED) is a fatal diarrhea in piglets caused by porcine epidemic diarrhea virus (PEDV). PEDV belongs to the alpha virus of the coronavirus family, and is a highly contagious disease. The virus gene is prone to variation, and currently a variety of different gene subtypes have evolved, and mixed infection of various subtype strains is serious in clinic. Sick pigs show symptoms such as vomiting, severe watery diarrhea and dehydration, and the morbidity and mortality are more than 50%, which seriously threatens the development of China's pig industry and brings huge economic losses to the pig industry. At present, immunization is the most effective method to resist PEDV, and inactivated vaccines and attenuated vaccines are widely used in the market, but no major breakthrough has been made in the research on etiology and pathogenesis. The immune protection effect of the existing vaccines is not satisfactory for the PEDV variant strains; and when antibiotics are used for treatment, there are problems such as the production of drug-resistant strains and toxic side effects. Therefore, it is of great significance to develop a general vaccine with good broad-spectrum neutralizing activity to control PEDV.

[0003] Cholesterol homeostasis in the body is a complex metabolic regulatory network, which is jointly determined by the dynamic relationship between biosynthesis, exogenous intake, excretion and storage. Cholesterol and its derivatives play an important role in the regulation of innate immunity and adaptive immunity, such as monocyte proliferation, neutrophil activation, hematopoietic stem cell mobilization and T lymphocyte proliferation. Host cells can participate in antiviral infection through various effective pathways. Among them, viral infection can induce host cells to change the expression of cholesterol metabolic enzymes and metabolites, and cholesterol metabolism can also regulate the antiviral response of host cells. Innate immunity is the first important defense line for the host to resist microbial infection. Current articles have shown that during viral infection, cholesterol synthesis is inhibited, and then through the STING-TBK1-IRF3 signaling pathway, it promotes the antiviral activity mediated by type I IFN. Cholesterol metabolism is related to the activation of innate immunity, and cholesterol metabolism may regulate viral immunity through this. These studies provide a certain basis and ideas for knocking down the SQLE gene to inhibit PEDV virus replication.

[0004] Before, researchers by designing and synthesizing specific siRNA and transfecting into hepatocyte cell lines, successfully knock down SQLE gene expression. Similarly, the present study uses specific shRNA transfection LLC-PK1 cells, also achieved knock down of SQLE gene. Although both with the help of gene knockdown technology, but there are differences in the targeted gene sequence, plasmid construction and application direction. The present study focuses on the immune control of PEDV. Studies have shown that cholesterol plays an important role in the process of antiviral innate immune response, and as a key gene of cholesterol metabolism SQLE, its specific role in the process of viral infection still needs to be further explored. SUMMARY

[0005] To solve the above problems, the present application provides the application of SQLE gene in inhibiting PEDV virus replication.

[0006] The present application also provides a specific shRNA targeting SQLE gene, and the shRNA sequence is shown as SEQ.NO.1.

[0007] The present application also provides the application of the above shRNA in regulating SQLE gene expression in cells.

[0008] The present application also provides a method for inhibiting PEDV virus replication by reducing SQLE gene expression.

[0009] The present application has the following beneficial effects:

[0010] ①The present application finds that by inhibiting host SQLE gene, the replication of PEDV virus can be inhibited, which can be used as a target for preparing a drug for inhibiting PEDV virus replication;

[0011] ②The present application takes SQLE gene as a target, and designs shRNA, which can interfere with PEDV virus replication, and can be used for preparing a drug for inhibiting PEDV virus replication;

[0012] ③The present application provides a shRNA targeting SQLE gene, which can specifically target SQLE gene, and can realize significant knockdown of SQLE gene in host cells by combining gene knockdown technology; the shRNA targeting SQLE gene is delivered to the animal body by liposome wrapping, which can realize the inhibition of SQLE gene, and then inhibit the replication of PEDV virus;

[0013] 4. The application provides a method for constructing a SQLE gene coding protein function knockdown cell line by transfecting the shRNA into a host cell through a gene knockdown technology. The method obtains a cell line with an SQLE resistance phenotype by inhibiting the function of the SQLE gene coding protein, and the cell line can significantly inhibit the replication of a PEDV virus. The application provides a research tool and material for further studying the molecular mechanism of SQLE gene in the regulation of pathogenic microorganism replication in cells, and the cell line can also be used for animal breeding against PEDV. BRIEF DESCRIPTION OF DRAWINGS

[0014] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor on the basis of these drawings.

[0015] Figure 1 RT-qPCR verification of shSQLE knockdown efficiency result analysis;

[0016] Figure 2 Western blot verification of SQLE knockdown success result analysis;

[0017] Figure 3 5MOI PEDV infection of LLC-PK1 shSQLE cells for 24h to analyze the effect on virus replication ability;

[0018] Figure 4 0.1MOI PEDV infection of LLC-PK1 shSQLE cells for 12 / 24 / 48 / 72h to analyze the effect on virus replication ability;

[0019] Figure 5 Real-time fluorescent quantitative detection of the effect of PEDV infection of shSQLE LLC-PK1 cells on PEDV-M protein expression result analysis;

[0020] Figure 6 Real-time fluorescent quantitative detection of the effect of PEDV infection of LLC-PK1 shSQLE cells on ISG15 result analysis;

[0021] Figure 7 Real-time fluorescent quantitative detection of the effect of PEDV infection of LLC-PK1 shSQLE cells on OAS1 result analysis;

[0022] Figure 8 Real-time fluorescent quantitative PCR detection of the effect of PEDV infection of LLC-PK1 shSQLE cells on IFN-λ3 result analysis;

[0023] Figure 9 Analysis of the effect of real-time quantitative PCR on IFN-β in LLC-PK1 shSQLE cells infected with PEDV. Detailed Implementation

[0024] Various exemplary embodiments of the present invention are now described in detail. Unless otherwise specified, the methods used in the embodiments are conventional methods, and the reagents used are commercially available reagents or reagents prepared using conventional methods. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and embodiments of the present invention.

[0025] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0026] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0027] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0028] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0029] 1. Design of shRNA targeting the SQLE gene

[0030] By querying the SQLE gene sequence (Gene ID: 100113409) in the database, the first exon segment of SQLE in the overlapping region of different transcripts in different transcriptomes of the genome was located for target design.

[0031] According to the shRNA design principle, the shRNA design website is logged in:

[0032] https: / / portals.broadinstitute.org / gpp / public / gene / search. The design of shRNA is named: SQLE-shRNA; The shRNA targeting SQLE gene is artificially synthesized, and the target sequence is CCGGGCTGCAGTTATTAGAAGAATCGATTCTTCTAATAACTGC AGCTTTTTT as the shRNA oligonucleotide (shRNA1-oligo) targeting SQLE gene. The shRNA-oligo is synthesized by GenScript Biotech Corporation.

[0033] 2. Construction of shRNA recombinant plasmid plko.1-CMV-copGFP-PURO-shRNA

[0034] Restriction enzyme digestion of plko.1-CMV-copGFP-PURO vector plasmid: plko.1-CMV-copGFP-PURO vector is digested with Bbs I restriction enzyme, the system is (20 μL): plko.1-CMV-copGFP-PURO vector, 5 μL; Bbs I, 1 μL; 10×Buffer, 2 μL; ddH2O, 12 μL. Incubate at 37°C for 3 h for enzyme digestion. Then perform nucleic acid electrophoresis, and purify and recover the plko.1-CMV-copGFP-PURO vector linearized fragment containing sticky ends using the DNA purification kit of Omega Corporation.

[0035] Obtaining double-stranded shRNA-oligo, annealing two oligo DNAs to form double-stranded DNA. The annealing reaction system is (20 μL): SQLE-shRNA-F-oligo, 0.5 μL; SQLE-shRNA-R-oligo, 0.5 μL; ddH2O, 18 μL; Annealing Buffer (20×), 1 μL.

[0036] After the above system is centrifuged momentarily, incubate in a PCR instrument for 3 min, and then naturally cool for 20 min. Take 3.5 μL of the hybridized double-stranded DNA for T4 DNA ligase ligation reaction, and the reaction system is (5 μL): plko.1-CMV-copGFP-PURO enzyme digestion purified fragment, 0.5 μL; double-stranded DNA, 3.5 μL; T4 DNA Ligase, 0.5 μL; 10×T4 DNA Ligase Buffer, 0.5 μL.

[0037] The ligation product was directly transformed into DH5a E. coli high-efficiency competent cells. The transformation procedure was as follows: 50 μL of DH5a E. coli high-efficiency competent cells were mixed with 500 ng of the ligation product, and placed on ice for 30 min. Heat shock at 42°C for 45 s, and then taken out of the ice bath for 2 min. 500 mL of LB culture solution without antibiotics was added, and the bacteria were shaken at 37°C and 220 rpm for 1 h. The recovered bacterial solution was centrifuged at 4000 rpm and room temperature for 5 min, and 400 μL of supernatant was discarded. The remaining supernatant and the precipitated bacteria were thoroughly suspended, and the transformed E. coli was spread on an LB culture plate with ampicillin resistance using a bacterial spreader. The plate was incubated in a 37°C incubator for 12 h, and the growth was observed.

[0038] A single colony was picked and shaken in LB culture solution containing ampicillin for 12 h. The plasmid was extracted using an Omega plasmid extraction kit and verified by sequencing. The sequence of the constructed plasmid was detected using universal primers and compared with the original vector. The results were consistent with the expected results, indicating that the plasmid expressing shRNA, plko.1-CMV-copGFP-PURO-SQLE-shRNA, was successfully constructed.

[0039] 3. Cell transfection (construction of knockdown cell line)

[0040] LLC-PK1 cells were cultured in DMEM medium containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin double antibody. After 2-3 passages, when the growth characteristics tended to be stable and the state was good, the cells were seeded in a cell six-well plate after digestion. When the cell confluence reached 80%, the transfection operation was carried out. 1 μg of the constructed recombinant plasmid was mixed with 3 μL of transfection reagent Lipofectamine 2000, and each was diluted with an equal volume of DMEM medium and incubated for 5 min. Then, the two were mixed in equal volumes and incubated for another 5 min to prepare the transfection mixture. The mixture was transfected into LLC-PK1 cells and cultured in a 37°C, 5% CO2 incubator for 48 h. Then, the cells were treated with medium containing 1.5 μg / mL puromycin for 2-3 days to screen for positive cells, and the positive cells were then subcultured.

[0041] 4. shSQLE Western blotting verification

[0042] Take shLUC cells and knockdown candidate cell strains respectively, and after the cells grow, collect the cells. Add RIPA and 2x SDS-PAGE Buffer 1:1 mixture for lysis, move to 1.5 mL EP tube, 100℃ metal bath 15 min, 12000 rpm centrifugal 1 min. Take the supernatant for polyacrylamide gel electrophoresis. After the program, block with 5% skim milk TBST for 1h; incubate the primary antibody (HA antibody) at 4℃ overnight, wash the membrane with 1x TBST 3 times, 5 min each time; secondary antibody (HRP-conjugated goat anti-mouse antibody) is incubated at room temperature for 1h, and the membrane is washed with 1x TBST 3 times, 5 min each time. Add luminescent substrate ECL developer to the nitrocellulose membrane, expose and develop, and verify the SQLE gene knockout LLC-PK1 cell line at the protein expression level.

[0043] Example 1 Effect of SQLE gene knockdown LLC-PK1 cell line on PEDV replication

[0044] 1. Virus titer TCID50 determination

[0045] After normal passage of SQLE gene knockdown LLC-PK1 cells and wild type LLC-PK1 cells, they are all plated in cell culture dishes, and when the cells grow to 80%, wild type LLC-PK1 and SQLE gene knockdown LLC-PK1 cells are infected with PEDV. The supernatant is collected at different time points. After freeze-thawing once, the obtained cell sample is diluted 2 -2 ~2 -9 times gradient, and each dilution is inoculated into 8 wells of Vero cells with a single layer in a 96-well cell culture plate, 100 μL per well. Place in a 37℃, 5% CO2 incubator and observe for 3 days, observe and record the cytopathic effect (CPE) every 12h, and calculate the TCID50 of the amplified virus according to the Reed-Muench method.

[0046] 2. Relative quantitative verification of PEDV replication on SQLE gene knockdown LLC-PK1 cell line

[0047] SQLE gene knockdown LLC-PK1 cells and wild type LLC-PK1 cells were collected at 0, 12, 24h and 0, 12, 24, 48, 72h after PEDV infection, and total RNA was extracted from the cells using Trizol lysis method. M-MLV reverse transcriptase (Promega) was used for cDNA synthesis, and qPCR was completed using SYBR Green Mix (TAKARA) reagent. GAPDH was used as an internal reference gene, and the primers were as follows:

[0048] Sus-GAPDH-F: ACATGGCCTCCAAGGAGTAAGA,

[0049] Sus-GAPDH-R: GATCGAGTTGGGGCTGTGACT;

[0050] Sus-PEDV-M-F: GATACTTTGGCCTCTTGTGT,

[0051] Sus-PEDV-M-R: CACAACCGAATGCTATTGACG.

[0052] Example 2 Effect of SQLE gene knockdown LLC-PK1 cell line on interferon

[0053] The effect of PEDV infection on SQLE gene knockdown LLC-PK1 cells and wild type LLC-PK1 cell lines on interferon was verified by fluorescence quantitative PCR method. Cells were collected at 0, 6, 12, and 24 h after PEDV infection, and total RNA was extracted by Trizol lysis method. cDNA was synthesized using Moloney mouse leukemia virus (M-MLV) reverse transcriptase (Promega). qPCR was completed using SYBR Green Mix (TAKARA) reagent. GAPDH was used as an internal reference gene, and the primers used were:

[0054] Sus-GAPDH-F: ACATGGCCTCCAAGGAGTAAGA,

[0055] Sus-GAPDH-R: GATCGAGTTGGGGCTGTGACT;

[0056] Sus-IFNB1-F: GCTAACAAGTGCATCCTCCAAA,

[0057] Sus-IFNB1-R: AGCACATCATAGCTCATGGAAAGA;

[0058] Sus-IFN-λ3-F: ACTTGGCCCAGTTCAAGTCT,

[0059] Sus-IFN-λ3-R: CATCCTTGGCCCTCTTGA;

[0060] Sus-ISG15-F: GATCGGTGTGCCTGCCTTC,

[0061] Sus-ISG15-R: CGTTGCTGCGACCCTTGT;

[0062] Sus-OAS1-F: GCCTGTGATTCTGGACCCGGCTGA,

[0063] Sus-OAS1-F: GCCTGTGATTCTGGACCCGGCTGA,

[0064] Results analysis

[0065] The wild type LLC-PK1 cells and the LLC-PK1 cells with knocked down SQLE gene were transfected with HA-SQLE respectively, and then the expression was verified by Western blot, and the results are shown in Figure 2 The SQLE protein was not expressed in the LLC-PK1 cell line with knocked down SQLE gene, and the SQLE protein size in the wild type LLC-PK1 cells was correct, which was consistent with the expectation, so we considered that the knocking down was successful.

[0066] TCID50 determination was performed on Vero cells, Figure 3 The virus titers of 5 MOI virus infection for 24 hours are shown in the figure, and shLUC is the wild type LLC-PK1 cell, and shSQLE is the SQLE gene knocked down LLC-PK1 cell described in the application. The results show that the SQLE gene knocked down LLC-PK1 cell has weaker virus replication ability than the wild type LLC-PK1 cell after being inoculated with PEDV influenza virus. It is proved that the SQLE gene function loss monoclonal cell line LLC-PK1 can significantly inhibit the replication of PEDV, and has the phenotype of PEDV resistance.

[0067] The SQLE gene knocked down LLC-PK1 cells and the wild type LLC-PK1 cells were collected at 0, 6 and 12 hours after PEDV infection, and the total RNA of the cells was extracted by Trizol lysis method, and real-time fluorescent quantitative PCR was performed, and the results are shown in Figure 5 The relative copy number of PEDV in the SQLE gene knocked down LLC-PK1 cell is lower than that in the wild type LLC-PK1 cell. The results show that knocking down the SQLE gene can significantly inhibit the replication of PEDV, and has the phenotype of PEDV resistance.

[0068] Real-time fluorescent quantitative detection of the effect of LLC-PK1 shSQLE cell on ISG15 after PEDV infection showed that SQLE gene played a negative regulation role in the expression regulation of ISG15 gene.

[0069] Real-time fluorescent quantitative detection of the effect of LLC-PK1 shSQLE cell on OAS1 after PEDV infection showed that SQLE gene played a negative regulation role in the expression regulation of OAS1 gene.

[0070] Real-time fluorescent quantitative qPCR detection of LLC-PK1 shSQLE cells infected with PEDV on the influence of IFN-λ3 results analysis, the results show that SQLE gene in the expression regulation of IFNλ3 gene plays a negative regulation.

[0071] Real-time fluorescent quantitative qPCR detection of LLC-PK1 shSQLE cells infected with PEDV on the influence of IFN-β results analysis, the results show that SQLE gene in the expression regulation of IFNβ gene plays a negative regulation.

[0072] The above-described embodiments are only to describe the preferred modes of the present application, and not to limit the scope of the present application, without departing from the design spirit of the present application, various modifications and improvements of the technical solutions of the present application made by those skilled in the art, all should fall within the protection scope determined by the claims of the present application.

Claims

1. Application of SQLE gene in inhibiting PEDV virus replication.

2. A shRNA that specifically targets the SQLE gene, characterized in that, The shRNA sequence is shown in SEQ.NO.

1.

3. The application of the shRNA as described in claim 2 in regulating intracellular SQLE gene expression.

4. A method for inhibiting PEDV virus replication, characterized in that, PEDV virus replication is inhibited by reducing SQLE gene expression.

Images