A sgRNA for knocking out zebrafish pde6a and application thereof in visual diseases

By constructing a zebrafish pde6a gene loss-of-function mutant model and combining genetic data, the PDE6A gene associated with high myopia was discovered. This solves the problem that existing technologies cannot fully reflect the genetic characteristics of high myopia, and enables a deeper understanding of the genetic basis of high myopia and the development of potential treatment methods.

CN121022847BActive Publication Date: 2026-02-06THE EYE HOSPITAL OF WENZHOU MEDICAL UNIVERSITY +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511574490.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-10-31
Publication Date
2026-02-06
Estimated Expiration
2045-10-31

AI Technical Summary

Technical Problem

Existing technologies are insufficient to fully and accurately reflect the true characteristics of high myopia and cannot effectively explore its genetic basis, leading to difficulties in the prevention and treatment of high myopia.

Method used

A zebrafish pde6a gene loss-of-function mutant model was constructed. The pde6a gene in zebrafish was knocked out using CRISPR-Cas9 technology to establish an animal model with impaired visual function but normal retinal development. Combined with genetic data from 4,540 Chinese individuals, the PDE6A gene associated with high myopia was discovered.

Benefits of technology

This study provides a comprehensive and multidimensional genetic cohort of ocular biomarkers, elucidates the genetic structure of high myopia, delves into its pathogenesis, provides information for the development of precise intervention measures, and helps to understand the genetic basis of high myopia.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121022847B_ABST
    Figure CN121022847B_ABST
Patent Text Reader

Abstract

The application provides sgRNA for knocking out pde6a of zebrafish and application thereof in visual diseases. By using the sgRNA for a specific position provided by the application, the pde6a of zebrafish can be targeted to be knocked out or knocked down by using a CRISPR / Cas9 system. After the pde6a is successfully knocked out or knocked down, a zebrafish model with impaired visual function but normal retinal development is obtained, and the model also has morphological changes such as shorter body length, smaller eyes and shorter interocular distance, and also shows a trend of increased axial length of the eye. The zebrafish model provides an experimental tool and a model basis for the research on diseases related to visual function.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of animal model construction, and particularly relates to sgRNA for knocking out pde6a of zebrafish and application thereof in visual diseases. BACKGROUND

[0002] High myopia (HM) as a key factor leading to irreversible visual impairment presents a complex and not fully clear genetic basis in the Chinese population. Currently, HM is usually determined by equivalent spherical lens equal to or less than -6.00 diopters (D), or an ocular axis greater than 26 mm. This disease is closely related to a series of serious eye fundus complications that threaten vision, such as myopic choroidal neovascularization (mCNV), retinal detachment (RD), and myopic macular degeneration (MMD). These complications can cause great damage to visual function and eventually lead to irreversible blindness, seriously affecting the quality of life of patients. It is worth noting that the prevalence of HM in the 16-18 year old adolescent population is showing a significant upward trend, and is expected to rise from 7.3% in 2001 to 22.1% in 2050, highlighting the severity of the HM prevention and control situation.

[0003] Similar to many complex diseases, the susceptibility of HM is determined by both genetic and environmental factors. Therefore, in-depth exploration of the genetic susceptibility of HM is of great significance for the prevention, diagnosis and treatment of the disease. In fact, HM has high complexity, and its heterogeneity cannot be accurately defined by simple classification diagnosis tags. This research method has certain limitations and cannot fully and accurately reflect the true characteristics of HM. SUMMARY

[0004] In view of the deficiencies in the prior art, the present application constructs a comprehensive investigation on high myopia, involving five eye parameters and genetic data in the exome range of 4540 Chinese people, finds the gene PDE6A related to high myopia, and provides a zebrafish model with impaired visual function but normal retinal development by knocking out the homologous gene pde6a in zebrafish through CRISPR-Cas9. The model also has morphological changes such as shorter body length, smaller eyes, shorter eye distance, and shows a trend of increased axial length.

[0005] In order to achieve the above-mentioned application purposes, the present application provides the following technical solutions:

[0006] The first aspect of the present application provides sgRNA targeting zebrafish pde6a gene, the recognition sequence of the sgRNA is located in the 2nd exon of zebrafish pde6a gene, the sgRNA has a nucleotide sequence as shown in SEQ ID NO: 1, and the PAM sequence is TGG.

[0007] In the present application, PDE6A refers to phosphodiesterase 6A, which encodes the alpha subunit of cGMP-specific phosphodiesterase 6A, is located in the long arm of chromosome 5 31.2-34 region (5q31.2-q34), consists of 22 exons, the gene length is about 45-50 kb, and the gene ID is 5145. In zebrafish, PDE6A is encoded by the pde6a gene, and the gene ID is 368410.

[0008] The second aspect of the present application provides a preparation method of a pde6a gene function loss type zebrafish mutant, which comprises the following steps: 1) designing and synthesizing an sgRNA sequence for recognizing a target site of the pde6a gene, wherein the sgRNA sequence comprises the nucleotide sequence shown in SEQ ID NO: 1; and 2) co-injecting the sgRNA and Cas9 protein into zebrafish fertilized eggs to obtain the pde6a gene function loss type zebrafish mutant.

[0009] In the present application, the pde6a gene function loss type zebrafish mutant is prepared by co-injecting sgRNA (SEQ ID NO: 1) targeting the 2nd exon of the pde6a gene and Cas9 protein, and the mRNA expression amount of the A gene is reduced by at least 85% compared with the wild type.

[0010] Further, in the step 2), the injection final concentration of the sgRNA is 320 ng / μL, and the injection final concentration of the Cas9 protein is 800 ng / μL.

[0011] Further, in the step 2), the zebrafish fertilized eggs are single cell stage embryos, and 1 nL is injected into each embryo.

[0012] Optionally, the preparation method further comprises the following step: 3) culturing the pde6a gene function loss type zebrafish mutant to obtain a stably inherited pde6a gene function loss type zebrafish mutant.

[0013] Further, in the step 3), the obtaining of the stably inherited pde6a gene function loss type zebrafish mutant comprises the following steps: 1) culturing the injected fertilized eggs into adult fish to obtain F0 generation pde6a gene function loss type zebrafish; 2) mating the obtained F0 generation pde6a gene function loss type zebrafish with wild type zebrafish to obtain F1 generation zebrafish, and identifying F1 generation pde6a gene function loss type zebrafish; and 3) crossing the obtained F1 generation pde6a gene function loss type female and male zebrafish to obtain F2 generation zebrafish, and identifying homozygous F2 generation pde6a gene function loss type zebrafish.

[0014] The third aspect of the present application provides the sgRNA of the first aspect of the present application for use in constructing a pde6a gene function loss type zebrafish mutant.

[0015] The fourth aspect of the present application provides the pde6a gene function loss type zebrafish mutant prepared by the preparation method of the second aspect of the present application for use in any one of the following applications, which include: 1) use in pde6a gene function research; 2) use in preparing a high myopia animal model; 3) use in screening a high myopia treatment drug.

[0016] In some embodiments, the screening of the high myopia treatment drug is by a method comprising administering a drug to the pde6a gene function loss type zebrafish mutant prepared by the preparation method of the second aspect of the present application, and if the drug can improve the symptoms of the mutant related to high myopia, the drug is a candidate drug for high myopia.

[0017] In some embodiments, the improvement refers to that the symptoms (such as body length, interocular distance, eye area, axial length, etc.) of the mutant are improved by at least about 10%, at least about 30%, at least about 50%, at least about 80% or more compared with before the administration of the drug.

[0018] Further, the candidate drug includes a protein analogue, an antibody, DNA, RNA, a small molecule compound.

[0019] Further, the source of the small molecule compound is selected from the group consisting of: newly synthesized or existing databases; wherein the existing databases include, but are not limited to, general natural product databases (COCONUT, Super Natural II, NPASS), plant natural product databases (KNApSaCK, CMAUP, TriForC, Alkamid, NPACT DB, BioPhytMol), Chinese medicine natural product databases (TCM@Taiwan, CEMTDD, CHDD, ETCM, TM-MC, TCMID, YaTCM), microbial natural product databases (StreptomeDB, NP Altas, ProCarDB, PAMDB, Lichen Database), marine natural product databases (MNPD, SWMD), natural product databases of different countries and regions (IMPPAT, NeMedPlant, MedPServer, TlPdb, AfroDB, ANPDB, BIOFACQUIM, NUBBEDB), food natural product databases (FooDB, BitterDB, Phenol-Explorer, PhytoHub, SuperSweet database), toxic natural product databases (Exposome-Explorer, T3DB, Snake Neurotoxin Database, TPPT), natural product industry catalogs (Greenpharma, AnalytiCon Discovery, InterBioScreen, Indofine Chemical Company, Pi Chemicals Systems\Specs, TargetMol), databases for MS data dereplication (MoNA, MassBank, METLIN, HMDB, YMDB, ReSpect, GNPS), databases for NMR data dereplication (NMRShiftDB, NAPROC-13), and the like.

[0020] Further, the DNA includes single-stranded DNA, double-stranded DNA, circular DNA, and ligated DNA.

[0021] Further, the RNA includes mRNA, tRNA, rRNA, snRNA, hRNA, antisense RNA, tCRNA, dsRNA, SCRNA, catalytically active RNA, and various viral RNAs.

[0022] Further, the candidate drug includes various pharmaceutically acceptable salt forms.

[0023] Further, the candidate drug includes a drug used alone or a pharmaceutical composition.

[0024] Further, the pharmaceutical composition refers to the combination of the candidate drug and the pharmaceutically acceptable carrier.

[0025] The term "pharmaceutically acceptable" is used herein to refer to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication commensurate with a reasonable benefit / risk ratio. Suitable carriers can be large, slowly metabolized macromolecules, such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, and amino acid copolymers. Such carriers are well known in the art. Pharmaceutically acceptable carriers in the pharmaceutical compositions can include fluids such as water, saline, glycerol, and ethanol. Auxiliary substances can also be present in such vehicles, such as wetting or emulsifying agents, pH buffering substances, and the like.

[0026] The fifth aspect of the present application provides the use of PDE6A in the preparation of an animal model of high myopia, the animal including mice, rats.

[0027] In some embodiments, the animal model is a rodent, a rabbit, a pig, a cow (e.g., a cow, a bull, a buffalo), a deer, a sheep, a goat, a chicken, a cat, a dog, a ferret, a primate (e.g., a rhesus monkey); preferably, a rodent (e.g., a mouse, a rat, and the like).

[0028] The sixth aspect of the present application provides the use of PDE6A in the preparation of a gene therapy product for high myopia.

[0029] In some embodiments, the gene therapy product for high myopia comprises a nucleic acid construct of a PDE6A-specific regulatory sequence.

[0030] Advantages and beneficial effects of the present application: The present application helps to understand the genetic basis of high myopia, and provides a strong framework for elucidating the genetic structure of high myopia by establishing a comprehensive and multi-dimensional genetic cohort of eye biological characteristics. According to the analysis of eye biological characteristics and genetic characteristics, the key gene PDE6A of high myopia is obtained, and the knock-out or knock-down model of the homologous gene pde6a in zebrafish is constructed, which verifies the important significance of the key gene in high myopia. Further research on the molecular mechanism not only deepens our understanding of the pathogenesis of high myopia, but also provides information for the development of precise intervention measures. BRIEF DESCRIPTION OF DRAWINGS

[0031] Figure 1 Statistical result graph of five eye parameters of participants.

[0032] Figure 2Figure for Mendelian randomization analysis of quantitative traits. A, Mendelian randomization analysis results of two samples of quantitative traits related to HM (IVW model); B, the association between exposure factors and the risk of HM, the red p value indicates that there is a significant causal relationship between exposure and outcome; C, Beta represents the size of the causal relationship between exposure and outcome; D, causal effect of eye parameters.

[0033] Figure 3 Figure for single-cell enrichment analysis of PDE6A.

[0034] Figure 4 Figure for the characteristics of pde6a gene function loss zebrafish. A, schematic diagram of sgRNA edited pde6a gene location; B, quantification of expression levels in negative control and pde6a gene function loss zebrafish by qPCR; C-E, quantification of body and eye measurements, including body length (C), eye spacing (D), and eye area (E); F, quantification of axial length of negative control and pde6a gene function loss zebrafish eyes; G, H&E staining of zebrafish larval retina, PCL, photoreceptor layer; INL, inner nuclear layer; IPL, inner plexiform layer; GCL, ganglion cell layer; H, statistical analysis of the thickness of each layer of the retina; H-I, thickness of GCL (H) and INL (I); J, frequency distribution (times / minute) of zebrafish larva eye movement; K, difference in swimming speed of negative control and pde6a gene function loss zebrafish in 5 minutes of light and 5 minutes of darkness.

[0035] Figure 5 Figure for the characteristics of pde6a gene function loss zebrafish. A, statistical diagram of inner plexiform layer (IPL) thickness, B, statistical diagram of photoreceptor layer (PCL) thickness. DETAILED DESCRIPTION

[0036] In order to enable persons skilled in the art to better understand the present application, the technical solutions in the embodiments of the present application will be described clearly and completely below in combination with the accompanying drawings of the embodiments of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, not all. Based on the embodiments in the present application, all other embodiments obtained by persons skilled in the art without creative labor fall within the scope of protection of the present application.

[0037] EMBODIMENT

[0038] I. Experimental method

[0039] 1. Study design and participants: Participants in this study were from the Myopia Genetics and Interventions Consortium (MAGIC) project, a subset of whom received ophthalmic examinations, including refractive error measurements and ocular biometry, covering five ocular parameters: spherical equivalent (SE), axial length (AL), corneal curvature (K), axial length to corneal curvature ratio (AL / CR), and white-to-white distance (WTW). High myopia was defined based on the worst eye refractive status or axial length (WSE < -6.00 D or WAL > 26.0 mm). The study was approved by the Eye Hospital of Wenzhou Medical University and conducted in accordance with the principles of the Declaration of Helsinki. Written informed consent was obtained from all participants.

[0040] 2. Participant exclusion criteria: At the initial stage of data processing, individuals who lacked valid identification cards or both SE and AL were excluded. Then, participants who had undergone ophthalmic surgery previously were excluded. In addition, subjects were excluded if the refractive status of the eye was greater than -6.00 diopters (D) or the axial length was less than 26.0 mm.

[0041] 3. Genotype data and quality control: All genotype data were retrieved from the patient database collected by the MAGIC project and were filtered using standardized approaches. Then, the corresponding genotypes of the five ocular phenotypes were extracted. The second-stage variant-level quality control included the following exclusion steps: call rate < 90%, Hardy-Weinberg equilibrium p < 1 x 10 −6 , minor allele frequency (MAF) < 0.01.

[0042] 4. Construction of pde6a gene loss-of-function zebrafish: Zebrafish (AB strain) were obtained from Hunter Biotech Co., Ltd. (China) and maintained at 28°C. Wild-type AB strain zebrafish were bred by natural pair mating. Clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated protein 9 (Cas9) systems were used to inject zebrafish single-cell stage embryos through the PICOSPRITZER® III (Park Systems, USA) microinjector to construct CRISPR-mediated zebrafish mutants.

[0043] (1) The target site is designed as follows: ATTCTTTGCATGGGAGACAGTT-GCTCTAATAAGGAGGCTAAAGACCATGACCTCTAGCGTCTGTCGCTAGAGCACCTTCAGAAGTCACAGGAGTGAGGTTTACCTGCATAGCACTTCACTAGCTGGCCTCTATTACAGTTCTATTGCTTTACCATCATATATGCTTCACTCTCCAG-GACAGCCATTTCAGTGACTTTGTGGACAACTTGACAGAGTACGAGA CCAAGAATGTGCTTGCGACCCCT ATCATGAATGGCAAGGACATGGTGGCTGTCATGATGGCAGTCAACAAGATCGGGGCTCCTCA TTTCACTGCTCAGGATGAAGAG -GTACCGTTCACTCATACCATACTCAACACTAACTTCGAGCCTTGGTGTGATGATGTCAATTTGAAACGTAAACACTGCAGAAAAAATTAATTATATGCATTGTGCGACCTACGCATTTCTAATCTCCAAAAGTTTCACTGAATATTAAAACTGTTTAAGCATTCTGATTAAACTGACTTTAACAGAACAGATTAAACA-CTCTGCTGAACTGAATCCAATG (SEQ ID NO: 2).

[0044] wherein ATTCTTTGCATGGGAGACAGTT (SEQ ID NO: 3), CTCTGCTGAACTGAATCCAATG (SEQ ID NO: 4) are sequence amplification primers, GACAGCCATTTCAGTGACTTTGTGGACAACTTGACAGAGTACGAGACCAAGAATGTGCTTGCGACCCCTATCATGAATGGCAAGGACATGGTGGCTGTCATGATGGCAGTCAACAAGATCGGGGCTCCTCATTTCACTGCTCAGGATGAAGAG (SEQ ID NO: 5) is a gene exon sequence, CCAAGAATGTGCTTGCGACCCCT (SEQ ID NO: 6), TTTCACTGCTCAGGATGAAGAG (SEQ ID NO: 7) are target sequences.

[0045] (2) The target detection primer is designed and synthesized as follows:

[0046] pde6a-F1 : ATTCTTTGCATGGGAGACAGTT (SEQ ID NO: 3).

[0047] pde6a-R1 : CATTGGATTCAGTTCAGCAGAG (SEQ ID NO: 8).

[0048] (3) Target sequence verification:

[0049] The wild type zebrafish genome was used as a template for PCR amplification with synthetic detection primers and ExTaq enzyme, and the product length was 549 bp. By comparing the sequence downloaded from the ENSEMBL database with the sequencing results, it was found that the actual sequence of Target 1 and Target 2 and the target sequence designed according to the database were consistent.

[0050] (4) The designed target sequence is as follows:

[0051] pde6a-Target1 : AGGGGTCGCAAGCACATTCT TGG (SEQ ID NO: 1) Forward.

[0052] pde6a-Target2: TTTCACTGCTCAGGATGAAG AGG (SEQ ID NO: 9) Reverse.

[0053] (5) The forward primers for amplifying the target sgRNA are as follows (where the underlined sequence is the target sequence):

[0054] pde6a-Target1 F: TTAATACGACTCACTATAGA GGGGTCGCAAGCACATTCT GTTTTAGAGCTAGAAATAG (SEQ ID NO: 10).

[0055] pde6a-Target2 F: TTAATACGACTCACTATA GTTTCACTGCTCAGGATGAAG GTTTTAGAGCTAGAAATAG (SEQ ID NO: 11).

[0056] (6) The reverse primer for transcribing the target sgRNA is:

[0057] T7gRNA-R: AAAAAAAGCACCGACTCGGTGCCAC (SEQ ID NO: 12).

[0058] (7) Amplification of target sgRNA transcription

[0059] The target forward primer and T7sgRNA-R primer were used to amplify and recover the transcription template, and the E2040s transcription kit was used for in vitro transcription. The transcribed sgRNA was recovered using the AM1561 kit, and the product was dissolved in NF water. The concentration was detected by ultraviolet spectrophotometry, and used for embryo injection.

[0060] The candidate knockout sgRNA target site of pde6a was used to construct a knockout group. The sgRNA of the target gene (SEQ ID NO: 1) was 5'-AGGGGTCGCAAGCACATTCT-3', and the PAM sequence was 5'-TGG-3', located 3 nt downstream of the target gene, used for Cas9 protein recognition. The Cas9 protein (EnGen® SpyCas9 NLS (catalog number M0646T, NEB, USA)) that had been synthesized, capped and purified was diluted in nuclease-free water and used for control injection.

[0061] (8) The target sgRNA and Cas9 protein were mixed and injected into AB wild-type zebrafish embryos. The final concentration of Cas9 protein was 800 ng / μL, and the final concentration of sgRNA was 320 ng / μL.

[0062] (9) Microinjection was performed at the 1-embryo stage of zebrafish, 1 nL was injected per embryo, and about 200 embryos were injected per target.

[0063] Then, we used 15 randomly selected zebrafish to evaluate the cleavage efficiency of each target gene by Sanger sequencing. We randomly selected 20 larvae and used qPCR to detect the expression level of the target gene. The primer sequence was TTAATACGACTCACTATA GAGGGGTCGCAAGCACATTCT GTTTTAGAGCTAGAAATAG (SEQ ID NO: 10, where the underlined sequence is the target sequence). After comparing the knockdown efficiency, Target 1 with higher knockdown efficiency was selected for subsequent injection and experiment.

[0064] All procedures performed in this study comply with the ARVO Statement on the Use of Animals in Ophthalmic and Visual Research. At the same time, the handling method of zebrafish used in this study has been approved by the Institutional Animal Care and Use Committee of Wenzhou Medical University.

[0065] 5. Eye measurement and morphological analysis: Phenotypic abnormalities were assessed for all embryos at 5 dpf (days post fertilization). For each experiment, 8-20 larvae were collected as control and target gene knockdown groups, respectively. Vertical and lateral images of each larva were captured by stereomicroscope (SZX16 and MVX10, OLYMPUS, Japan). Body length, eye area and interocular distance were calculated by ImageJ. Axial length was measured by built-in program (OLYMPUS cellsens standard 1.14).

[0066] 6. Zebrafish behavior experiment: This study analyzed optokinetic response (OKR) following the method of OKR measurement by Brockerhoff et al. in 2006 (Nature Protocols, Vol. 1, pp. 2448-2451), which is hereby incorporated in its entirety. We randomly selected 16 injected larvae at 5 dpf and performed routine experiments. We used OKR software (ViewPoint OKR 2.0, ViewPoint, France) to record the eye movement of larvae within 1 minute.

[0067] 7. Zebrafish swimming ability determination: Swimming behavior was performed at 5 dpf and recorded by a behavioral evaluation system (ZebraLab 3.22.3.31, Viewpoint, France). Ten larvae from control and gene knockdown groups were collected to measure the speed. The average swimming speed under 5 minutes dark and 5 minutes light stimulation for two cycles was measured. The difference of zebrafish swimming speed per minute under light and dark stimulation was calculated to evaluate the visual function.

[0068] 8. Frozen section and H&E staining: We fixed zebrafish embryos at 5 days of development by immersion in 4% paraformaldehyde for 24 hours. The samples were embedded using an embedding mold. Larvae were dehydrated in ethanol at stepwise concentrations (75%, 85% and 90%). Then, frozen sections were performed using JB-P5 (Wuhan Jianji Electronic Co., Ltd.) and RM2016 (Leica Microsystems Shanghai Co., Ltd.) with a section thickness of 2.5 μm. Images were taken using Pannoramic MIDI (3DHISRECH, Hungary). The thickness of the ganglion cell layer (GCL), inner nuclear layer (INL), photoreceptor layer (PR) and inner plexiform layer (IPL) of the retina was calculated using CaseViewer and Photoshop.

[0069] 9. Statistical analysis: Data are presented as mean ± standard error of the mean. Wilcox rank-sum test and t-test were used to determine statistical significance between data sets using R (version 4.1.1). p-value < 0.05 was considered statistically significant.

[0070] II. Experimental Results

[0071] 1. Participant demographics related to five ocular parameters: Five ocular parameters (spherical equivalent (SE), axial length (AL), corneal curvature (K), AL / CR ratio, and white-to-white distance (WTW)) were obtained for 4540 participants. After applying quality control procedures, a total of 3642 participants were included in the final analysis. As shown in Table 1, data for each ocular parameter were summarized. Figure 1

[0072] In addition, Table 1 summarizes the demographics and ocular characteristics. Among the people who participated in this study, 1961 (53.84%) participants were male and 1681 (46.16%) were female, aged between 3 and 22 years. A total of 3474 participants had available data for SE, 1206 for AL, 1341 for K, 1341 for AL / CR ratio, and 1112 for WTW. In the poor vision group, the average SE was -8.01 ± 2.61 D, and the average AL was 27.40 ± 0.86 mm. The average K was 43.36 ± 2.07 D. The average AL / CR ratio for the poor vision group was 3.49 ± 0.02. The average WTW was 12.09 ± 0.16 mm.

[0073] Table 1. Statistical summary of high myopia multi-dimensional ocular parameters

[0074]

[0075] 2. Mendelian randomization to prove the causal relationship between multi-dimensional phenotypes: Colocalization analysis observed phenotypic correlations between SE and AL / CR, K and AL, WTW and AL, and WTW and K, however, the explicit causal relationship between these ocular characteristics has not yet been investigated (A-B in Figure 2 ). To further investigate the potential causal relationship, we used genetic variation as an instrumental variable and conducted a two-sample bidirectional Mendelian randomization (MR) analysis based on inverse-variance weighting (IVW). When SE was taken as the exposure factor and AL / CR as the outcome variable, SE was a risk factor for AL / CR ( ) (B-C in Figure 2 ). When AL / CR was taken as the exposure variable and SE as the outcome variable, the causal relationship still existed ( ). Therefore, SE and AL / CR showed a bidirectional regulatory relationship. When K was taken as the exposure and AL as the outcome variable, the results showed that K was a risk factor for AL ( , Figure 2 ) (B-C in ). However, when AL was taken as the exposure and K as the outcome variable, no causal relationship was observed between AL and K ( ). Furthermore, Mendelian randomization analysis showed no causal relationship between AL and WTW (p=0. 0001). When WTW was taken as the exposure factor, K as the outcome variable, a negative correlation was observed (p=0. 0001). In contrast, when K was taken as the exposure factor, WTW as the outcome factor, no significant overall effect was detected.

[0076] MR-PRESSO test showed no evidence of directional pleiotropy between SE and AL / CR, K and AL, and WTW and AL, further confirming the validity of the results (Table 2). However, sensitivity analysis of the IVW method showed that there was significant heterogeneity and pleiotropy (p(heterogeneity) WTWvsK =0.007, p(pleiotropy) WTWvsK =0.113, p(non-heterogeneity) KvsWTW =0.001, p(pleiotropy) KvsWTW =0.008) between WTW and K in bidirectional Mendelian randomization.

[0077] Table 2. Results of Mendelian randomization analysis

[0078]

[0079] The key gene PDE6A was obtained by screening of highly myopic related eye phenotypes and corresponding genotypes, and was subjected to computational analysis. PDE6A was most strongly expressed in the choroid, retinal pigment epithelium (RPE) and retinal peripheral tissue, indicating that it can be a key regulator of the choroid and retina (K-W test, p=4.147x10 -7 , Wilcoxon rank sum test, p strongest vs others =2.424x10 -5 . In detail, single cell enrichment analysis showed that PDE6A was highly specifically expressed in rod cells and photoreceptors, which is consistent with the specific expression trend recorded in the Human Protein Atlas (https: / / www.proteinatlas.org / ENSG00000198797- PDE6A / pathology). Figure 3 In addition, pathway analysis showed that PDE6A was mainly enriched in visual function, and the most significant enrichment was observed in phototransduction (FDR p-value=1.05x10 -21 ).

[0080] 3. Zebrafish model reveals the regulatory role of pde6a: To further understand the biological characteristics of the key gene and its influence on eye refractive development, we studied the evolutionary conservation and created a zebrafish knockdown model. Homology analysis showed that pde6a is the ortholog of zebrafish, and we further explored the consequences of targeted mutagenesis. Using CRISPR Cas9, Cas9 protein and pde6a single guide (sgRNA) were co-injected into zebrafish embryos at the single cell stage (https: / / www.zfin.org / zfinfo / ). Figure 4A). Then, qPCR showed that pde6a expression was significantly reduced in the KD(pde6a) group compared to the control group (NC(pde6a)) (P<0.001, Figure 4 B) of FIG. 1.

[0081] The KD(pde6a) and NC(pde6a) zebrafish larvae phenotypes were evaluated at 5 dpf. Zebrafish injected with KD(pde6a) showed shorter body length, shorter interocular distance and smaller eyes (p 体长 = 0.042, p 眼间距 <0.001, p 眼面积 = 0.002, Figure 4 C-E) of FIG. 1. To investigate whether the small eyes were associated with refractive errors, we measured the changes in axial length (AL). Although an increasing trend in axial length was observed in the pde6a knockdown group, the difference did not reach statistical significance (p = 0.125, AL increased 1.81%, Figure 4 F) of FIG. 1. To investigate whether the changes in the eye were associated with abnormal retinal development, we performed hematoxylin and eosin (HE) staining in cross-sections. As shown in Figure 4 G, H and I of FIG. 1, in the pde6a knock-out group, the ganglion cell layer (GCL) and inner nuclear layer (INL) were thinner, while the inner plexiform layer (IPL) was slightly thicker (p Figure 5 A), but knocking down pde6a did not cause significant changes in retinal development. There was no significant change in the photoreceptor layer (PCL) (p Figure 5 B) of FIG. 1. To further assess the effect of pde6a knock-out on the visual function of zebrafish, the optokinetic response (OKR) was evaluated. Notably, the results of the OKR study showed that the eye movement frequency decreased with the knockdown of pde6a, indicating that the visual function of zebrafish can be impaired (eye movement frequency decreased by 56.39%, p = 0.006, Figure 4 J) of FIG. 1.

[0082] Then, to investigate the behavioral changes after pde6a knock-out, we evaluated the average swimming speed per minute in light and darkness for the control and KD(pde6a) groups. The protocol involved two consecutive cycles, each consisting of 5 minutes of darkness and 5 minutes of light. The control group showed greater differences in average swimming speed per minute in light and darkness compared to the KD(pde6a) group, indicating that the knockdown of pde6a can disrupt the normal visual or neural response of zebrafish to light-dark transitions (decrease of 52.96%, p < 0.001, Figure 4 K) of FIG. 1. Overall, these results indicate that KD(pde6a) has a weaker response to light.

[0083] This study involved 4540 highly myopic patients aged 3-22 years from the MAGE cohort with data on five ocular parameters, i.e. SE, AL, K, AL / CR and WTW. We found the key gene PDE6A significantly associated with Chinese high myopia (HM). In addition, co-localization analysis identified four genomic regions, each containing a pair of putative causal variants shared between pairs of ocular traits: SE and AL / CR, K and AL, WTW and AL, and WTW and K. Mendelian randomization further supported the significant bidirectional relationship between SE and AL / CrR, and the unidirectional effects of K on AL and WTW on K. Moreover, the observed RNA structure, functional enrichment and phenotypes in zebrafish knockout models were consistent, suggesting that PDE6A is a major risk factor for myopia and a potential regulator of high myopia. Our findings provide new insights into the genetic effects and possible regulatory mechanisms causally associated with HM.

[0084] The above description of the embodiments is only for the purpose of understanding the method of the present application and its core idea. It should be noted that for those skilled in the art, without departing from the principles of the present application, several improvements and modifications can be made to the present application, and these improvements and modifications will also fall within the protection scope of the claims of the present application.

Claims

1. An sgRNA targeting the zebrafish pde6a gene, characterized in that, The recognition sequence of the sgRNA is located in exon 2 of the zebrafish pde6a gene, and the nucleotide sequence of the sgRNA is shown in SEQ ID NO:

1. The PAM sequence is TGG.

2. A method for preparing a zebrafish mutant with a pde6a gene loss of function, characterized in that, The preparation method includes the following steps: 1) Design and synthesize an sgRNA sequence that recognizes the target site of the pde6a gene, wherein the nucleotide sequence of the sgRNA is shown in SEQ ID NO:1; 2) The sgRNA and Cas9 protein were co-injected into zebrafish fertilized eggs to obtain zebrafish mutants with loss of function of the pde6a gene.

3. The preparation method according to claim 2, characterized in that, The final injection concentration of sgRNA in step 2) is 320 ng / μL, and the final injection concentration of Cas9 protein is 800 ng / μL.

4. The preparation method according to claim 2, characterized in that, The zebrafish fertilized eggs mentioned in step 2) are single-cell embryos, and 1 nL is injected into each embryo.

5. The preparation method according to claim 2, characterized in that, The preparation method further includes the following steps: 3) Culture zebrafish mutants with loss of function of the pde6a gene to obtain stably inherited zebrafish mutants with loss of function of the pde6a gene.

6. The preparation method according to claim 5, characterized in that, Step 3) involves obtaining a stably inherited pde6a gene loss-of-function zebrafish mutant, which includes the following steps: 1) The injected fertilized eggs were cultured to adulthood to obtain F0 generation zebrafish with loss of function of the pde6a gene; 2) The F0 generation of zebrafish with loss of function of the pde6a gene was crossed with wild-type zebrafish to obtain F1 generation zebrafish, and the F1 generation of zebrafish with loss of function of the pde6a gene was identified. 3) The F1 generation female and male zebrafish with loss of function of the pde6a gene were hybridized to obtain F2 generation zebrafish, and the homozygous F2 generation zebrafish with loss of function of the pde6a gene were identified.

7. The use of the sgRNA according to claim 1 in constructing a zebrafish mutant with loss of function of the pde6a gene.

8. The following application of the pde6a gene loss-of-function zebrafish mutant prepared by the preparation method according to any one of claims 2-6, characterized in that, The applications include: 1) Application in pde6a gene function research; 2) Application in the preparation of animal models of high myopia; 3) Application in screening drugs for the treatment of high myopia.

Citation Information

Patent Citations

  • Application of phosphodiesterase 5 activity inhibitor as ripening agent for inducing maturation of zebrafish oocyte

    CN110305837A

  • Methods of treating epilepsy via phosphodiesterase 4 (PDE4) inhibition

    CN113490739A