Method for regulating osteogenic differentiation of periodontal ligament stem cells in inflammation microenvironment based on stem cell-derived extracellular matrix

Abstract

The invention relates to a method for regulating osteogenic differentiation of periodontal ligament stem cells in an inflammatory microenvironment based on a stem cell-derived extracellular matrix. The method comprises the following steps: 1) separating and identifying bone marrow cells BMCs and periodontal ligament cells PDLCs; (2) preparing a bone marrow stem cell derived extracellular matrix B-ECM and a periodontal ligament stem cell derived extracellular matrix P-ECM; 3) intervening PDLSCs in an inflammation microenvironment by using the B-ECM and the P-ECM obtained in the step 2), and 4) performing animal experiment.The adverse effect of inflammation on the osteogenic differentiation capacity of periodontal ligament stem cells in the stem cell treatment process is reversed, so that a basis is provided for developing a novel periodontitis regeneration treatment strategy based on an ECM stent.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and provides a method for regulating osteogenic differentiation of periodontal ligament stem cells in an inflammatory microenvironment based on stem cell-derived extracellular matrix. Background Technology

[0002] Periodontitis is a chronic inflammatory disease caused by dental plaque microorganisms, characterized by progressive destruction of periodontal supporting tissues, ultimately leading to tooth loss. Current clinical treatments (including non-surgical debridement, drug therapy, and regenerative surgery) can control inflammation, but cannot achieve true periodontal tissue regeneration.

[0003] In recent years, tissue engineering technology has provided new insights into periodontal regeneration, and its success relies on three key elements: seed cells, signaling factors, and scaffold materials. Among these, periodontal ligament stem cells (PDLSCs) are considered ideal seed cells due to their multi-lineage differentiation potential (differentiating into cementoblasts, fibroblasts, and osteoblasts) and immunomodulatory functions. Studies have shown that PDLSCs express mesenchymal stem cell markers such as CD73 / CD90 / CD105 / Stro-1 and Scleraxis ligament-specific markers, and can regenerate the cementum-periodontal ligament complex in both in vivo and in vitro experiments.

[0004] However, PDLSCs in patients with periodontitis are situated in an inflammatory microenvironment, where their stem cell characteristics are significantly impaired. Inflammatory factors (TNF-α, IL-1β, IL-6) and pathogenic components (such as Porphyromonas gingivalis lipopolysaccharide Pg-LPS) inhibit the osteogenic differentiation capacity of PDLSCs by activating pathways such as TLR4 / NF-κB (downregulating Runx2 expression) and induce apoptosis (ROS-mediated). Although the proliferation and migration capacity of PDLSCs may be enhanced in the early stages of inflammation, they ultimately tend towards apoptosis and their regenerative function declines, which becomes a bottleneck for clinical application.

[0005] The extracellular matrix (ECM), as a dynamic microenvironment regulating stem cell behavior, plays a crucial role in tissue regeneration. Decellularized ECM, due to its retention of the diverse components (collagen, fibronectin, proteoglycans, etc.), three-dimensional structure, and bioactivity of natural ECM, along with its low immunogenicity and degradability, has become an ideal carrier for optimizing stem cell function. Compared to tissue-derived ECM, cell-derived ECM has significant advantages: ① Customizable preparation (selection of specific cell types and differentiation stages); ② It is easy to decellularize and has good structural integrity; ③ Aseptic and controllable. Studies have confirmed that the tissue specificity and developmental stage of ECM directly affect stem cell fate: for example, bone marrow-derived ECM promotes osteogenic differentiation, while adipose-derived ECM induces adipogenic differentiation; young cell ECM can enhance stem cell proliferation capacity more than aged ECM.

[0006] Currently, periodontal tissue-specific ECMs—periodontal ligament stem cell-derived ECM (P-ECM) and jawbone bone marrow stem cell-derived ECM (B-ECM)—have been successfully constructed. Both have been found to promote the proliferation and maintenance of stemness of periodontal ligament stem cells (PDLSCs), with B-ECM exhibiting significantly stronger osteogenic induction than P-ECM. However, whether these two ECMs can promote the osteogenic differentiation of PLSCs under inflammatory conditions remains unstudied, and whether periodontal tissue-specific ECMs can reverse osteogenic inhibition of PLSCs under inflammatory conditions is still unclear.

[0007] Therefore, it is urgent to verify the rescue effect of P-ECM / B-ECM on osteogenic differentiation of PDLSCs under Pg-LPS inflammatory conditions and to elucidate its mechanism, which is of great significance for the development of ECM-based periodontitis regeneration therapy. Summary of the Invention

[0008] To overcome the shortcomings of the prior art, the purpose of this invention is to provide a method for regulating the osteogenic differentiation of periodontal ligament stem cells in the inflammatory microenvironment based on stem cell-derived extracellular matrix, which reverses the adverse effects of inflammation on the osteogenic differentiation ability of periodontal ligament stem cells during stem cell therapy, thereby providing a basis for developing novel periodontitis regenerative treatment strategies based on ECM scaffolds.

[0009] To achieve the above objectives, the technical solution adopted by the present invention is as follows: A method for regulating osteogenic differentiation of periodontal ligament stem cells in an inflammatory microenvironment based on stem cell-derived extracellular matrix includes the following steps: 1) Isolation and identification of bone marrow stem cells (BMSCs) and periodontal ligament stem cells (PDLSCs): 1.1) Extracted teeth from healthy individuals aged 18-25 years (orthodontic or impacted tooth extraction) were placed in α-MEM containing 10% double antibiotics. After thorough washing with PBS, the periodontal ligament tissue of 1 / 3 of the root was aseptically scraped and cut into small pieces of about 1 mm². The pieces were then inoculated into 25T culture flasks containing α-MEM culture medium and cultured at 37°C and 5% CO2 for about 7 days. Half of the α-MEM culture medium was replaced. After 12-20 days of culture, fibroblast-like cells were observed to migrate out. When the confluence reached 80%, the cells were digested and passaged. 1.2) Cancellous bone was obtained from the jawbone of patients undergoing orthognathic surgery, aseptically minced, and cultured in a 10 cm culture dish containing α-MEM until 80% fusion was achieved. 1.3) Primary PDLCs and BMCs were diluted to a concentration of 10 cells / mL and seeded into 96-well plates (100 μL / well). Single clone wells were screened under a microscope, digested, mixed and amplified to obtain PDLSCs and BMSCs. 1.4) Third-generation PDLSCs and BMSCs were extracted and identified. Flow cytometry showed that both highly expressed CD73, CD90, CD105, and Stro-1, and lowly expressed CD34 and CD45. After 3 weeks of osteogenic induction, Alizarin Red staining showed the formation of calcium nodules. Adipogenic induction medium: α-mem A solution: IBMX 0.5mM, indomethacin 0.2mM, dexamethasone 10uM, insulin 10ug / ml; B solution: insulin 10ug / ml. After 14 days, Oil Red O staining confirmed lipid droplet accumulation, proving that both PDLSCs and BMSCs have multi-lineage differentiation potential. 2) Preparation of decellularized extracellular matrix (B-ECM) derived from bone marrow mesenchymal stem cells and decellularized extracellular matrix (P-ECM) derived from periodontal ligament stem cells; 2.1) Resuscitate and passage third-generation BMMSCs and PDLSCs until 80%-90% confluence, digest with 0.25% trypsin, and then use 1×10 6 Seeds were placed in six-well plates at a density of 10 cells / well. When the cells proliferated to a confluence of 70%-80%, the culture medium was replaced with a film-forming culture medium containing 50 mg / L ascorbic acid. The medium was changed halfway every 3 days. After about 10 days of culture, a milky white and translucent film-like substance could be observed at the bottom of the culture dish. 2.2) Subsequently, decellularization was performed as follows: the supernatant was discarded, the sample was washed twice with PBS, and then the sample was decellularized using a sterile decellularization solution containing 20 mM NH4OH in 1% Triton X-100 solution. The decellularization solution was added and allowed to stand for 5 minutes at a constant temperature of 37°C, after which the solution was removed. Subsequently, the sample was carefully washed three times with PBS to obtain P-ECM and B-ECM. 2.3) Add 1 mL of PBS solution to each culture well and store the ECM samples at 4°C. The samples are valid for 2 months and their morphological characteristics and biosafety are tested. 3) An inflammatory microenvironment was constructed using lipopolysaccharide derived from Porphyromonas gingivalis at a concentration of 10 μg / mL. The B-ECM and P-ECM obtained in step 2) were used to intervene in PDLSCs in the inflammatory microenvironment. 4) Based on step 3), B-ECM and P-ECM were used to intervene in the inflammatory microenvironment of PDLSCs. After passage culture of the third-generation PDLSCs, they were implanted into different six-well plates and divided into four groups: ① TCP group; ② TCP + 10 μg / mL P.g -LPS group; ③P-ECM + 10 μg / mL P.g -LPS group; ④B-ECM + 10 μg / mL P.g - In the LPS group, after the cells reached 70%-80% confluence, the medium was replaced with PDLSC osteogenic differentiation induction medium. Groups ②, ③, and ④ were treated with LPS simultaneously, with the medium changed every 2 days. Samples from the three groups were collected on days 7 and 14 of culture. The effects of P-ECM and B-ECM on PDLSC osteogenic differentiation in an inflammatory environment were analyzed using alkaline phosphatase activity assay, qPCR, and Western blotting.

[0010] The α-MEM culture medium contains 10% fetal bovine serum, 2 mmol / L glutamine, 100 U / mL penicillin, and 100 mg / L streptomycin.

[0011] The PBS solution contained 0.25 mg / L amphotericin B, 100 U / mL penicillin, and 100 mg / L streptomycin. The osteogenic induction formula contains 10% fetal bovine serum, 10 mmol·L⁻¹ sodium β-glycerophosphate, 50 mg·L⁻¹ ascorbic acid, and 10⁻¹... 7 α-MEM of dexamethasone at mol·L⁻¹

[0012] The nonionic surfactant used is Triton X-100.

[0013] Furthermore, the morphological feature detection described in step 2) employs fluorescence microscopy and scanning electron microscopy (SEM), specifically including the following steps: The detection steps under a fluorescence microscope are as follows: After inducing BMMSCs and PDLSCs in the film-forming culture medium for 10 days, wash them three times with PBS for 5 minutes each time to remove the culture medium and non-adherent cells; then, add 4% paraformaldehyde solution and fix the samples at room temperature for 10 minutes; after fixation, aspirate the paraformaldehyde solution and wash three more times with PBS to ensure complete removal of the fixative; then, add DAPI (4',6-diamidinyl-2-phenylindole) staining solution under light-protected conditions and incubate for 5 minutes to stain the cell nuclei; after staining, observe in detail under a fluorescence microscope and take photographs to record the results; similarly, use the fixation and staining procedures described above to process the decellularized ECM samples; The SEM detection steps are as follows: First, the ECM sample was washed three times with double-distilled water and fixed with 1.25% glutaraldehyde at 4°C. After fixation, it was washed three more times with double-distilled water to remove glutaraldehyde residue. Then, it was dehydrated in gradient ethanol solutions of 50%, 70%, 80%, 90%, 95%, and 100% for 15 minutes each. Subsequently, it was stained with 1% OsO4 solution for 15 minutes to enhance contrast, and the aforementioned gradient ethanol dehydration was performed again to ensure that the sample was fully dried. After dehydration, critical point drying was performed using hexamethyldisiloxane (HMDS). The dried sample was mounted on a stud and sputtered. Finally, the microstructure and surface morphology of B-ECM and P-ECM were observed and recorded using a scanning electron microscope.

[0014] Furthermore, the biosafety test described in step 2) employs Live / Dead staining, specifically including the following steps: Third-generation PDLSCs were seeded at a density of 1×10⁵ cells / well in B-ECM, P-ECM, and standard TCP six-well plates for 24 h. Afterward, the culture medium was removed from the wells, and the cells were collected after digestion with 0.25% trypsin. The cells were then washed twice with 1xAssayBuffer and centrifuged (450 g, 5 min) to thoroughly remove trypsin and residual esterase. The resulting cell pellet was then resuspended in 1xAssayBuffer, and the cell concentration was adjusted to 1×10⁶ cells / mL. Then, 1-2 μL of Calcein-AM solution was added to each mL of the cell suspension, and after thorough mixing by pipetting, the cells were incubated at 37°C in the dark for 20-25 min. After incubation, 3-5 μL of Calcein-AM solution was added to the cell suspension. μL of PI solution was added, and then staining was performed at room temperature in the dark for 5 minutes. After staining, the staining solution was removed by centrifugation. Next, the cells were washed with PBS and centrifuged again with the same centrifugal force. The cells were then resuspended in PBS. Finally, a small amount of cell suspension was dropped onto a clean glass slide and gently pressed with a clean coverslip. The cells could then be observed and detected under a fluorescence microscope using a suitable filter. Statistical analysis and graphing were performed using GraphPad Prism 9.0. The survival rate of each group was a quantitative data, expressed as mean ± standard deviation (Mean ± SD), and the values ​​were normal and homogeneous in variance. One-way ANOVA was used to analyze differences between groups. A p-value less than 0.05 was considered statistically significant.

[0015] Furthermore, the establishment of the inflammation model described in step 3) specifically includes the following steps: Several commonly used Pg-LPS concentrations for constructing inflammation models were detected, and the concentration that best met the requirements of this experiment was selected. Third-generation PDLSCs were passaged and then seeded into six-well plates. When the cells reached 70%-80% confluence, the PDLSCs were treated with LPS at concentrations of 0, 1, 10, and 20 μg / mL, respectively. Total RNA was extracted from the cells after 24 hours, and the expression levels of inflammation-related mRNAs in each group were detected by qRT-PCR. On day 7, total RNA was extracted from the cells, and the expression levels of bone-related mRNAs in each group were detected by qRT-PCR. The medium was changed every other day.

[0016] Furthermore, the influence of P-ECM and B-ECM on osteogenic differentiation of PDLSCs in an inflammatory environment, as described in step 4), specifically includes the following steps: 1) Alkaline phosphatase activity assay: Alkaline phosphatase (ALP) activity was tested on day 7 of osteogenic induction using BCIP / NBT alkaline phosphatase chromogenic buffer (Beyotime, China). BCIP / NBT staining working solution was prepared, ensuring thorough mixing. Cells were washed three times with PBS for 3 minutes each time. Then, BCIP / NBT chromogenic substrate solution was added, controlling the volume to ensure the reaction solution fully wetted the cell growth surface. The chromogenic reaction was carried out in a constant temperature environment (25℃±2℃) in the dark for 30 minutes. After the chromogenic process was completed, residual reaction solution was thoroughly removed, and pre-cooled distilled water at 4℃ was injected to terminate the chromogenic process. Finally, observation and photography were performed to record the ALP staining results. 5) RNA extraction, reverse transcriptase polymerase chain reaction (RT-PCR), and quantitative real-time polymerase chain reaction (qPCR): 6) Total RNA extraction was performed on day 7 of osteogenic induction. Cells were first washed three times with pre-chilled PBS. 1 mL of RNAiso Plus lysis buffer was added to each well, and the cells were thoroughly lysed by pipetting. The lysis buffer was transferred to a 1.5 mL EP tube. The tube was centrifuged at 12000 g for 15 minutes at 4°C. The supernatant was transferred to a new tube, and 200 μL of chloroform was added. The tube was quickly sealed and inverted to mix. The tube was allowed to stand at room temperature for 5 minutes until the layers separated. The tube was then centrifuged again at 12000 g for 15 minutes at 4°C. After the solution separated into three layers, 300-400 μL of the clear upper aqueous phase was precisely transferred to a new EP tube. An equal volume of isopropanol was added and mixed. The tube was allowed to stand at room temperature for 10 minutes (or overnight at -20°C) to precipitate RNA. The tube was then centrifuged at 12000 g for 10 minutes at 4°C, and the supernatant was discarded. 500 μL of pre-chilled 75% ethanol was added to wash the precipitate. The washing and centrifugation were repeated twice. After removing any residual liquid, the precipitate was dried by inverting the tube. 20 μL of ethanol was added to the precipitate. The RNA precipitate was fully dissolved in DEPC water, and its purity and concentration were determined using a spectrophotometer. Reverse transcription was then performed: based on the RNA concentration, the volume was calculated at 1000 ng per system. Working solution was prepared using the Takara reverse transcription kit, incubated at 37°C for 15 minutes, and then terminated at 85°C for 5 seconds. The obtained cDNA was stored at -20°C. Finally, a qPCR system was prepared: using the cDNA as a template, a 20 μL reaction system was constructed according to the TB Green Premix Ex Taq™ II manual. The program was run on a real-time quantitative PCR instrument (95°C pre-denaturation for 30 seconds, followed by cyclic amplification at 95°C for 5 seconds → 60°C for 30 seconds). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the housekeeping gene for real-time quantitative polymerase chain reaction (qPCR), and the average value was derived using formula 2-ΔΔCt. Primer design and synthesis are as follows: ALP CCAAAGGCTTCTTCTCTGCTGCCACCAAATGTGAAGACGTG COL1A1TCTGCGACAACGGCAAGGTGTCGACGCCGGTGGTTTCTTGGT RUNX2 TCGCCAGGCTTCATAGCAAAGGCCTTGGGTAAGGCAGATT OCNGGCGCTACCTGTATCAATGGGTGGTCAGCCAACTCGTCA GAPDH TGCACCACCAACTGCTTAGCATGGACTGTGGTCATGAG 4) Western blotting: Western blotting involves staining gel electrophoresis-treated cell or tissue samples with specific antibodies. Analysis of the staining location and depth reveals the expression of specific proteins in the analyzed cells or tissues. Protein extraction was performed using a protein extraction kit. Total protein was extracted on day 14 of osteogenic induction using RIPA buffer. Cells were washed three times with pre-cooled PBS at 4°C. 80 μL of freshly prepared RIPA lysis buffer (containing the protease inhibitor PMSF, 100:1 ratio) was added to each well. The cell mixture was scraped and transferred to 1.5 mL EP tubes. The cells were then subjected to intermittent sonication (10 seconds / time × 3, 10-second intervals), followed by centrifugation at 12000 rpm for 10 minutes at 4°C to separate the supernatant. The protein concentration in the supernatant was determined using the BCA method, and the protein was extracted according to a standard of 20 μg / well using Loading... After the buffer was standardized to the desired concentration, it was stored at -20℃ for later use. SDS-PAGE electrophoresis was then performed: Glass plates were aligned and installed, separating gel was injected, and water was used to remove bubbles. After solidification, a comb was inserted to prepare a stacking gel. Samples were adjusted to the same concentration, and 20 μL were loaded. Electrophoresis was performed at 100V until the bromophenol blue indicator was reached. The gel was peeled off and trimmed. During the transfer stage, a sponge-filter paper-gel-filter paper-sponge sequence was stacked sequentially, and air bubbles were removed. The transfer tank was placed in an ice bath for cooling. After transfer, the membrane was blocked with 5% skim milk for 120 minutes. Primary antibody was incubated overnight at 4℃, followed by three TBST washes (10 minutes each). Secondary antibody was incubated at room temperature for 90 minutes, followed by another TBST wash. ECL chemiluminescence was used for development, and a gel imaging system was used to capture the signal. The main antibodies included: Fluor488-goat anti-rabbit secondary antibody (Beyotime, China), ALP monoclonal antibody (Abcam, UK), Col-I antibody (Abcam, USA), and GAPDH (Abcam, USA). The final results were analyzed using ImageJ. 1.53k quantitative strip gray values ​​(after background correction and internal reference standardization) were plotted using GraphPad Prism 9.0 and analyzed using SPSS 22.0 for Shapiro-Wilk normality test, Levene homogeneity of variance test, and ANOVA-LSD post-hoc statistical analysis.

[0017] The adipogenic induction process alternates between solution A and solution B, wherein the culture medium for solutions A and B is α-mem; solution A contains 0.5 mM IBMX, 0.2 mM indomethacin, 10 μM dexamethasone, and 10 μg / ml insulin; and solution B contains 10 μg / ml insulin.

[0018] Furthermore, animal experiments specifically include the following steps: All experimental methods and animal care were conducted in accordance with guidelines and approved by the Ethics Committee of the Fourth Military Medical University. All surgeries were performed under sodium pentobarbital anesthesia, and every effort was made to minimize animal suffering. Twenty-four 7-week-old female SD rats (weighing 200–250 g) were provided by the Animal Center of the Fourth Military Medical University. The rats were randomly divided into four groups: ① Experimental group (B-ECM): PDLSCs composite bone powder and B-ECM derived from PDLCs; ② Experimental group (P-ECM): PDLSCs composite bone powder and P-ECM derived from PDLCs; ③ Control group (No-ECM): PDLSCs composite bone powder; ④ Blank group: No material was implanted. Periodontitis was induced by ligation of silk sutures at the maxillary first molar of the rats, and then each group was transplanted to the defect site. The previously reported rat periodontitis model was used. Mesial defects of the rat maxillary first molar were then created using a 3 mm diameter ball drill, ensuring that the size of each defect was the same as that of the ball drill. Maxillary alveolar bone defects were prepared intermittently to prevent alveolar bone necrosis caused by excessive heat. Animals were sacrificed 8 weeks after surgery, and specimens were fixed with 4% paraformaldehyde. MicroCT was used to observe the condition of each bone component.

[0019] The present invention has the following beneficial technical effects: 1) This invention has discovered that periodontal ligament stem cell-derived ECM and jawbone bone marrow mesenchymal stem cell-derived ECM have different effects on osteogenic differentiation of periodontal ligament stem cells in an inflammatory microenvironment.

[0020] 2) This invention discovered that B-ECM significantly promotes osteogenic differentiation of PDLSCs in an inflammatory environment, while P-ECM exhibits an inhibitory effect on PDLSC osteogenic differentiation. In vivo experiments verified that the B-ECM-PDLSC complex has a superior repair effect in a periodontitis bone defect model. This invention contributes to the study of the influence of the microenvironment on stem cells and also facilitates the future translation of periodontal ligament stem cell research into clinical applications. Attached Figure Description

[0021] Figure 1(a) shows the microscopic morphology of BMMSCs and PDLSCs of the present invention.

[0022] Figure 1(b) shows the identification of cell surface molecules CD90, CD90, CD105, CD73, Stro-1, CD34, and CD45 in BMMSCs and PDLSCs of the present invention.

[0023] Figure 1(c) shows the osteogenic induction differentiation of BMMSCs and PDLSCs of the present invention.

[0024] Figure 1(d) shows the adipogenic differentiation of BMMSCs and PDLSCs of the present invention.

[0025] Figure 2(a) shows the morphology of PDLSCs and BMMSCs of the present invention before and after decellularization under an inverted microscope and a fluorescence microscope.

[0026] Figure 2(b) shows the SEM morphology of the B-ECM and P-ECM of the present invention.

[0027] Figure 2(c) shows the Live / Dead staining of PDLSCs cultured by B-ECM and P-ECM according to the present invention.

[0028] Figure 2(d) shows the 24-hour survival rate of PDLSCs cultured by B-ECM and P-ECM according to the present invention.

[0029] Figure 3(a) shows the expression levels of inflammatory-related mRNAs of PDLSCs at different concentrations of Pg.-LPS when screening the LPS concentration used to construct the inflammatory microenvironment in this invention.

[0030] Figure 3(b) shows the expression levels of osteogenic-related mRNAs of PDLSCs at different concentrations of Pg.-LPS when screening the LPS concentration used to construct the inflammatory microenvironment in this invention.

[0031] Figure 4(a) shows the ALP staining of B-ECM, P-ECM and TCP after 7 days of osteogenic induction by PDLSCs inoculated in the inflammatory microenvironment.

[0032] Figure 4(b) shows the expression levels of osteogenic-related mRNAs of B-ECM, P-ECM and TCP after 7 days of osteogenic induction by inoculating PDLSCs in the inflammatory microenvironment.

[0033] Figure 4(c) shows the expression levels of osteogenic-related proteins of B-ECM, P-ECM and TCP after 14 days of osteogenic induction by inoculating PDLSCs in an inflammatory microenvironment.

[0034] Figure 5(a) shows the Micro-CT images of the P-ECM, B-ECM, and TCP of the present invention after being inoculated with PDLSCs and mixed with bone powder and implanted into the alveolar bone defects of SD rats for 8 weeks.

[0035] Figure 5(b) shows the bone volume fraction and trabecular thickness of new bone formed 8 weeks after P-ECM, B-ECM, and TCP of the present invention were inoculated with PDLSCs and bone powder and implanted into the alveolar bone defects of SD rats. Detailed Implementation

[0036] The present invention will be further described in detail below with reference to specific embodiments. These descriptions are for explanation purposes only and are not intended to limit the scope of the invention. Example

[0037] Taking the regulation of osteogenic differentiation of human periodontal ligament stem cells in an inflammatory environment as an example, the specific steps include the isolation and culture of human periodontal ligament cells and human jawbone bone marrow cells, the preparation and detection of P-ECM and B-ECM, the establishment of LPS inflammation model, the effects of P-ECM and B-ECM on osteogenic differentiation of PDLSCs in an inflammatory environment, and animal experiments.

[0038] 1) Isolation and identification of bone marrow stem cells (BMSCs) and periodontal ligament stem cells (PDLSCs); In this study, extracted teeth were obtained from healthy individuals aged 18-25 years (orthodontic or impacted tooth extraction) who had signed informed consent forms. The extracted teeth were placed in α-MEM containing 10% penicillin and antibiotics, thoroughly washed with PBS, and then the periodontal ligament tissue of the root was aseptically scraped and minced to approximately 1 mm². These were then seeded into 25T culture flasks and cultured in α-MEM containing 10% fetal bovine serum, 2 mmol / L glutamine, 100 U / mL penicillin, and 100 mg / L streptomycin at 37°C and 5% CO₂. The medium was replaced at half capacity every 7 days. After 12-20 days of culture, fibroblast-like cell migration was observed. Cells were passaged when 80% confluence was achieved. Simultaneously, cancellous bone was obtained from the jawbone of patients undergoing orthognathic surgery, aseptically minced, and cultured adherentally in 10 cm culture dishes containing α-MEM until 80% confluence. Subsequently, limiting dilution was used to isolate and purify PDLSCs and BMSCs: primary PDLSCs and BMSCs were diluted to a concentration of 10 cells / mL and seeded into 96-well plates (100 μL / well). Single clones were screened under a microscope, and after digestion, the cells were mixed and amplified to obtain PDLSCs and BMSCs. The third-generation cells were identified: flow cytometry showed that both cells highly expressed CD73, CD90, CD105, and Stro-1, and lowly expressed CD34 and CD45. Osteogenesis induction (containing 10% fetal bovine serum, 10 mmol·L⁻¹ sodium β-glycerophosphate, 50 mg·L⁻¹ ascorbic acid, 10⁻¹... 7 After 3 weeks of Alizarin Red staining with α-MEM containing mol·L⁻¹ dexamethasone, calcium nodule formation was observed; after 14 days of adipogenic induction (alternating between solution A and solution B), Oil Red O staining confirmed lipid droplet accumulation, demonstrating that both PDLSCs and BMSCs have multi-directional differentiation potential.

[0039] 2) Preparation of decellularized extracellular matrix (B-ECM) derived from bone marrow mesenchymal stem cells and decellularized extracellular matrix (P-ECM) derived from periodontal ligament stem cells; Third-generation BMMSCs and PDLSCs were resuscitated and passaged until 80%-90% confluence. After digestion with 0.25% trypsin, they were seeded in six-well plates at a density of 1 × 10⁶ cells / well. When the confluence reached 70%-80%, the culture medium was replaced with a film-forming medium containing 50 mg / L ascorbic acid. The medium was changed halfway every 3 days. After approximately 10 days of culture, a milky white, semi-transparent membrane-like substance could be observed at the bottom of the culture dish. Subsequently, decellularization was performed. The steps were as follows: the supernatant was discarded, and the samples were washed twice with PBS. Then, the samples were decellularized using a prepared sterile decellularization solution (1% Triton X-100 solution containing 20 mM NH₄OH). The decellularization solution was added at a constant temperature of 37°C and allowed to stand for 5 minutes, after which the solution was removed. The samples were then carefully washed three times with PBS to obtain P-ECM and B-ECM. Add 1 mL of PBS solution (containing 0.25 mg / L amphotericin B, 100 U / mL penicillin, and 100 mg / L streptomycin) to each culture well, and store the ECM samples at 4°C. The samples are valid for 2 months. Morphological characteristics and biosafety were then assessed. The morphological characteristics were assessed using fluorescence microscopy and scanning electron microscopy (SEM), specifically including the following steps: The detection procedure under a fluorescence microscope is as follows: After inducing BMMSCs and PDLSCs in the film-forming culture medium for 10 days, wash them three times with PBS for 5 minutes each time to remove the culture medium and non-adherent cells. Then, add 4% paraformaldehyde solution and fix the samples at room temperature for 10 minutes. After fixation, aspirate the paraformaldehyde solution and wash three more times with PBS to ensure complete removal of the fixative. Next, add DAPI (4',6-diamidindole-2-phenylindole) staining solution and incubate for 5 minutes in the dark to stain the cell nuclei. After staining, observe the samples carefully under a fluorescence microscope and take photographs to record the results. Similarly, the fixation and staining procedures described above are used to process the decellularized ECM samples.

[0040] The SEM detection steps are as follows: First, the ECM sample was washed three times with double-distilled water and fixed with 1.25% glutaraldehyde at 4°C. After fixation, it was washed three more times with double-distilled water to remove glutaraldehyde residue. Then, it was dehydrated in gradient ethanol solutions of 50%, 70%, 80%, 90%, 95%, and 100% for 15 minutes each. Subsequently, it was stained with 1% OsO4 solution for 15 minutes to enhance contrast, and the aforementioned gradient ethanol dehydration was performed again to ensure that the sample was fully dried. After dehydration, critical point drying was performed using hexamethyldisiloxane (HMDS). The dried sample was mounted on a stud and sputtered. Finally, the microstructure and surface morphology of B-ECM and P-ECM were observed and recorded using a scanning electron microscope (SEM, Hitachi S-4800, Japan).

[0041] The aforementioned biosafety testing, employing Live / Dead staining, specifically includes the following steps: Third-generation PDLSCs were seeded at a density of 1×10⁵ cells / well in B-ECM, P-ECM, and standard TCP six-well plates for 24 h. Afterward, the culture medium was removed from the wells, and the cells were collected after digestion with 0.25% trypsin. The cells were then washed twice with 1xAssayBuffer and centrifuged (450 g, 5 min) to thoroughly remove trypsin and residual esterase. The resulting cell pellet was then resuspended in 1xAssayBuffer, and the cell concentration was adjusted to 1×10⁶ cells / mL. Then, 1–2 μL of Calcein-AM solution was added to each mL of cell suspension, and after thorough mixing by pipetting, the cells were incubated at 37°C in the dark for 20–25 min. After incubation, 3–5 μL of PI solution was added to the cell suspension, followed by staining at room temperature in the dark for 5 min. After staining, the staining solution was removed by centrifugation. The cells were then washed with PBS and centrifuged at the same speed, and then resuspended in PBS. Finally, a small amount of cell suspension was dropped onto a clean glass slide, and gently pressed down with a clean coverslip. The slide could then be observed and detected under a fluorescence microscope using a suitable filter. Statistical analysis and graphing were performed using GraphPad Prism 9.0. Survival rates for each group were quantitative data, expressed as mean ± standard deviation (Mean ± SD), and the values ​​were considered normal and homogeneous in variance. One-way ANOVA was used for inter-group difference analysis; a p-value less than 0.05 was considered statistically significant.

[0042] 3) Establishment of an inflammation model; Several commonly used Pg-LPS concentrations for constructing inflammation models were tested, and the concentration that best met the requirements of this experiment was selected. Third-generation PDLSCs were passaged and then seeded into six-well plates. When the cells reached 70%-80% confluence, the PDLSCs were treated with LPS at concentrations of 0, 1, 10, and 20 μg / mL, respectively. Total RNA was extracted from the cells after 24 hours, and the expression levels of inflammation-related mRNAs in each group were detected by qRT-PCR. On day 7, total RNA was extracted from the cells, and the expression levels of bone-related mRNAs in each group were detected by qRT-PCR. The medium was changed every other day.

[0043] 4) The effects of P-ECM and B-ECM on osteogenic differentiation of PDLSCs in an inflammatory environment; Third-generation PDLSCs were passaged and then seeded into different six-well plates, divided into four groups: ① TCP group; ② TCP + 10 μg / mL. P.g -LPS group; ③P-ECM + 10 μg / mL P.g -LPS group; ④B-ECM + 10 μg / mL P.g - In the LPS group, after cells reached 70%-80% confluence, the medium was replaced with PDLSC osteogenic differentiation induction medium. Groups ②, ③, and ④ were treated with LPS simultaneously, with the medium changed every 2 days. Samples from the three groups were collected on days 7 and 14 of culture, and analyzed using alkaline phosphatase activity assays, qPCR, and Western blotting. Alkaline phosphatase (ALP) activity was tested on day 7 of osteogenic induction using BCIP / NBT alkaline phosphatase chromogenic buffer (Beyotime, China). RNA extraction, reverse transcriptase polymerase chain reaction (RT-PCR), and real-time quantitative polymerase chain reaction (qPCR) were performed on day 7 of osteogenic induction to extract total RNA from cells, involving the following genes: ALP CCAAAGGCTTCTTCTCTGCTG CCACCAAATGTGAAGACGTG COL1A1TCTGCGACAACGGCAAGGTGT CGACGCCGGTGGTTTCTTGGT RUNX2 TCGCCAGGCTTCATAGCAAA GGCCTTGGGTAAGGCAGATT OCNGGCGCTACCTGTATCAATGG GTGGTCAGCCAACTCGTCA GAPDH TGCACCACCAACTGCTTAGC ATGGACTGTGGTCATGAG Protein extraction in this experiment was performed using a protein extraction kit (Beyotime, China). Total protein was extracted on day 14 of osteogenic induction via RIPA buffer lysis. The main antibodies used in the Western blot assay included: Fluor 488-goat anti-rabbit secondary antibody (Beyotime, China), ALP monoclonal antibody (Abcam, UK), Col-I antibody (Abcam, USA), and GAPDH (Abcam, USA).

[0044] 5) Animal experiments; All experimental methods and animal care were conducted in accordance with guidelines and approved by the Ethics Committee of the Fourth Military Medical University. All surgeries were performed under sodium pentobarbital anesthesia, and every effort was made to minimize animal suffering. Twenty-four 7-week-old female SD rats (weighing 200–250 g) were provided by the Animal Center of the Fourth Military Medical University. The rats were randomly divided into four groups: ① Experimental group (B-ECM): PDLSCs composite bone powder and B-ECM derived from PDLCs; ② Experimental group (P-ECM): PDLSCs composite bone powder and P-ECM derived from PDLCs; ③ Control group (No-ECM): PDLSCs composite bone powder; ④ Blank group: No material was implanted. Periodontitis was induced by ligation of silk sutures at the maxillary first molar of the rats, and then each group was transplanted to the defect site.

[0045] This invention utilizes a previously reported rat periodontitis model. Mesial defects of the rat maxillary first molar are created using a 3mm diameter ball bur, ensuring each defect is the same size as the bur. Maxillary alveolar bone defects should be created intermittently to prevent alveolar bone necrosis due to excessive heat. Animals are sacrificed 8 weeks post-surgery, specimens are fixed in 4% paraformaldehyde, and the condition of each bone component is observed using MicroCT.

[0046] According to the above implementation, Figures 1(a) to 1(d) show the culture and identification of BMMSCs and PDLSCs of the present invention; After approximately 7 days of primary culture, periodontal ligament tissue blocks began to emerge from PDLCs, exhibiting a typical elongated spindle-shaped morphology. Around 10 days of culture, some BMCs were observed to begin adhering to the culture wall, displaying a spindle-shaped or polygonal shape. Subsequent passages yielded homogeneous and viable PDLCs and BMCs, as shown in Figure 1(a).

[0047] Flow cytometry analysis showed that both PDLSCs and BMMSCs highly expressed stem cell surface markers. PDLSCs showed strong positivity for CD90 (99.9%), CD105 (99.5%), and Stro-1 (14.6%), while BMMSCs showed strong positivity for CD90 (99.6%), CD105 (99.4%), and CD73 (99.7%) (Figure 1(b)). Meanwhile, neither PDLSCs nor BMMSCs expressed almost no epithelial surface markers CD34 and CD45 (Figure 1(b)).

[0048] After osteogenic and adipogenic induction, the osteogenic capacity of PDLSCs and BMMSCs was assessed using Alizarin Red mineralized nodule staining, and their ability to form lipid droplets was detected using Oil Red staining. After 21 days of osteogenic differentiation induction, significant fusion growth of cells was observed under a microscope, with the cells gradually evolving from an initial spindle-shaped structure to a cubic conformation. After Alizarin Red staining, microscopic imaging revealed highly compacted cell arrangement and the formation of mineralized deposits of varying sizes (Figure 1(c)).

[0049] After 14 days of adipogenic differentiation induction, Oil Red O staining revealed lipid droplets of varying sizes between cells, which stained strongly red (Figure 1(d)).

[0050] Figures 2(a) to 2(d) show the morphological detection and biosafety detection of B-ECM and P-ECM of the present invention. PDLSCs and BMMSCs were seeded at a density of 1×10⁶ cells / well in six-well plates. After 8-12 days of culture, a membrane-like structure was observed at the bottom of the wells. Before and after decellularization, PDLSC membranes (before decellularization), P-ECMs (after decellularization), BMMSCs membranes (before decellularization), and B-ECMs (after decellularization) were observed under a microscope. Before decellularization, the cells were arranged in a straw mat-like pattern, and the nuclei were clearly visible under a fluorescence microscope. After decellularization, P-ECMs and B-ECMs showed no cellular structure, only the ECM structure remained, and no nuclei were visible under fluorescence, indicating that the nuclei were destroyed and the genetic material was degraded or removed, proving that the decellularization treatment was thorough (Figure 2(a)).

[0051] SEM revealed the surface morphology characteristics of the two periodontal tissue-specific extracellular matrices (P-ECM and B-ECM) after decellularization. No cellular remnants remained after decellularization, and the originally ordered fibrous structure within the ECM was preserved during this process. Furthermore, the fibrous structure of B-ECM was coarser than that of P-ECM, as shown in Figure 2(b).

[0052] To verify the biosafety of PDLSCs on B-ECM, a Live / Dead assay was used. Results showed that 24 h after inoculation, both the P-ECM and B-ECM groups had a large number of viable green cells and very few dead red cells (Figure 2(c)). Statistical results showed that the survival rate of PDLSCs in the P-ECM and B-ECM groups after chemical treatment and disinfection was not significantly different from the control TCP group (Figure 2(d)). This result confirms that P-ECM and B-ECM possess good biosafety.

[0053] Figures 3(a) and 3(b) show the LPS concentration used in this invention for screening and constructing an inflammatory microenvironment. The results demonstrate that 10 μg / mL is the optimal concentration. P.g -LPS can be used to construct inflammation models for subsequent experiments. This experiment compared the effects of four concentrations of Pg-LPS (0, 1, 10, and 20 μg / mL) on the expression levels of inflammation-related mRNAs and osteogenic differentiation-related mRNAs in PDLSCs. The results showed that IL-6 and IL-1β expression was highest at 20 μg / mL, exhibiting a concentration-dependent relationship, while TNF-α expression was highest at 10 μg / mL (Figure 3(a)). The expression of osteogenic-related genes ALP, RUNX2, and OCN was highest at 10 μg / mL and 20 μg / mL. P.g -LPS levels showed a significant decrease, as shown in Figure 3(b). Combining the two experiments, 10 μg / mL P.g -LPS can both increase the expression of inflammatory factors in PDLSCs and impair their osteogenic differentiation ability; therefore, a concentration of 10 μg / mL was selected. P.g -LPS was used to construct the inflammation model for subsequent experiments.

[0054] Figures 4(a) to 4(c) explore the effects of P-ECM and B-ECM on osteogenic differentiation of PDLSCs in the inflammatory microenvironment. The results suggest that B-ECM can still promote osteogenic differentiation of PDLSCs in the inflammatory environment, while P-ECM inhibits osteogenic differentiation of PDLSCs.

[0055] To understand the effects of P-ECM and B-ECM on osteogenic differentiation of PDLSCs in a periodontal environment, this experiment used 10 μg / mL P.g - An inflammation model was constructed using LPS to simulate the periodontal microenvironment. ALP staining was used to compare the degree of osteogenic differentiation in the four groups. qRT-PCR analysis was used to compare the expression levels of ALP, COL1, and OCN genes in the TCP group, TCP + LPS, P-ECM + LPS, and B-ECM + LPS groups. Western blot was used to determine the expression levels of COL1 and ALP proteins in the four groups.

[0056] The ALP staining results were consistent with the experimental results above. The B-ECM+LPS group had the most and deepest blue-purple precipitate, followed by the TCP+LPS group, while the P-ECM+LPS group had the lightest staining (Figure 4(a)).

[0057] qRT-PCR results showed that, compared with the TCP group, the expression of bone-related genes COL1, ALP, and OCN decreased in the TCP+LPS group; compared with the TCP+LPS group, the expression of osteogenic genes decreased in the P-ECM+LPS group and increased in the B-ECM+LPS group (P<0.05), Figure 4(b).

[0058] Western blot results showed that the B-ECM+LPS group expressed more osteogenic-related proteins COL-1 and ALP than the TCP+LPS group, while the P-ECM+LPS group expressed less, and the difference was statistically significant (Figure 4(c)).

[0059] The above results suggest that in an inflammatory environment, B-ECM can still promote osteogenic differentiation of PDLSCs, while P-ECM inhibits osteogenic differentiation of PDLSCs.

[0060] Figures 5(a) to 5(b) show the repair of bone defects in a rat periodontitis environment using PDLSCs mixed with P-ECM and B-ECM, and the repair effects of the four groups are compared.

[0061] Twenty-four 7-week-old female SD rats (weighing 200–250 g) were randomly divided into four groups: ① Experimental group (B-ECM): PDLSCs composite bone powder and B-ECM derived from PDLCs; ② Experimental group (P-ECM): PDLSCs composite bone powder and P-ECM derived from PDLCs; ③ Control group (No-ECM): PDLSCs composite bone powder; ④ Blank group: No material was implanted. Periodontitis was induced by ligation of silk sutures at the maxillary first molar of the rats, and then each group was transplanted to the defect site.

[0062] This invention used a previously reported rat periodontitis model, and then created mesial defects in the rat maxillary first molar using a 3mm diameter ball bur, ensuring that the size of each defect was the same as the ball bur. Animals were sacrificed 8 weeks post-surgery, and specimens were fixed with 4% paraformaldehyde. Micro-CT was used to observe the bone composition. Micro-CT analysis showed that the B-ECM group was superior to the P-ECM and No-ECM groups in repairing alveolar bone defects caused by periodontitis (Figure 5(a)). Micro-CT histomorphometric analysis of bone tissue showed that the B-ECM group had increased bone volume fraction (BV / TV) and trabecular bone thickness (Tb.Th) compared to the P-ECM and No-ECM groups (Figure 5(b)).

Claims

1. A method for regulating osteogenic differentiation of periodontal ligament stem cells in an inflammatory microenvironment based on stem cell-derived extracellular matrix, characterized in that, Includes the following steps: 1) Isolation and identification of bone marrow stem cells (BMSCs) and periodontal ligament stem cells (PDLSCs): 1.1) Extracted teeth from healthy individuals aged 18-25 years (orthodontic or impacted tooth extraction) were placed in α-MEM containing 10% double antibiotics. After thorough washing with PBS, the periodontal ligament tissue of 1 / 3 of the root was aseptically scraped and cut into small pieces of about 1 mm². The pieces were then inoculated into 25T culture flasks containing α-MEM culture medium and cultured at 37°C and 5% CO2 for about 7 days. Half of the α-MEM culture medium was replaced. After 12-20 days of culture, fibroblast-like cells were observed to migrate out. When the confluence reached 80%, the cells were digested and passaged. 1.2) Cancellous bone was obtained from the jawbone of patients undergoing orthognathic surgery, aseptically minced, and cultured in a 10 cm culture dish containing α-MEM until 80% fusion was achieved. 1.3) Primary PDLCs and BMCs were diluted to a concentration of 10 cells / mL and seeded into 96-well plates (100 μL / well). Single clone wells were screened under a microscope, digested, mixed and amplified to obtain PDLSCs and BMSCs. 1.4) Third-generation PDLSCs and BMSCs were extracted and identified. Flow cytometry showed that both highly expressed CD73, CD90, CD105, and Stro-1, and lowly expressed CD34 and CD45. After 3 weeks of osteogenic induction, Alizarin Red staining showed the formation of calcium nodules. After 14 days of adipogenic induction, Oil Red O staining confirmed the accumulation of lipid droplets, proving that both PDLSCs and BMSCs have multi-lineage differentiation potential. 2) Preparation of decellularized extracellular matrix (B-ECM) derived from bone marrow mesenchymal stem cells and decellularized extracellular matrix (P-ECM) derived from periodontal ligament stem cells; 2.1) Resuscitate and passage third-generation BMMSCs and PDLSCs until 80%-90% confluence, digest with 0.25% trypsin, and then feed at 1 × 10⁻⁶ ppm. 6 Seeds were placed in six-well plates at a density of 10 cells / well. When the cells proliferated to a confluence of 70%-80%, the culture medium was replaced with a film-forming culture medium containing 50 mg / L ascorbic acid. The medium was changed halfway every 3 days. After about 10 days of culture, a milky white and translucent film-like substance could be observed at the bottom of the culture dish. 2.2) Subsequently, decellularization was performed as follows: the supernatant was discarded, the sample was washed twice with PBS, and then the sample was decellularized using a sterile decellularization solution containing 20 mM NH4OH in 1% Triton X-100 solution. The decellularization solution was added and allowed to stand for 5 minutes at a constant temperature of 37°C, after which the solution was removed. Subsequently, the sample was carefully washed three times with PBS to obtain P-ECM and B-ECM. 2.3) Add 1 mL of PBS solution to each culture well and store the ECM samples at 4°C. The samples are valid for 2 months and their morphological characteristics and biosafety are tested. 3) An inflammatory microenvironment was constructed using lipopolysaccharide derived from Porphyromonas gingivalis at a concentration of 10 μg / mL. The B-ECM and P-ECM obtained in step 2) were used to intervene in PDLSCs in the inflammatory microenvironment. 4) Based on step 3), B-ECM and P-ECM were used to intervene in the inflammatory microenvironment of PDLSCs. After passage culture of the third-generation PDLSCs, they were implanted into different six-well plates and divided into four groups: ① TCP group; ② TCP + 10 μg / mL Pg -LPS group; ③P-ECM + 10 μg / mL Pg -LPS group; ④B-ECM + 10 μg / mL Pg - In the LPS group, after the cells reached 70%-80% confluence, the medium was replaced with PDLSC osteogenic differentiation induction medium. Groups ②, ③, and ④ were treated with LPS simultaneously, with the medium changed every 2 days. Samples from the three groups were collected on days 7 and 14 of culture. The effects of P-ECM and B-ECM on PDLSC osteogenic differentiation in an inflammatory environment were analyzed using alkaline phosphatase activity assay, qPCR, and Western blotting.

2. The method for regulating osteogenic differentiation of periodontal ligament stem cells in an inflammatory microenvironment based on stem cell-derived extracellular matrix according to claim 1, characterized in that, The α-MEM culture medium contained 10% fetal bovine serum, 2 mmol / L glutamine, 100 U / mL penicillin, and 100 mg / L streptomycin.

3. The method for regulating osteogenic differentiation of periodontal ligament stem cells in an inflammatory microenvironment based on stem cell-derived extracellular matrix according to claim 1, characterized in that, The PBS solution contained 0.25 mg / L amphotericin B, 100 U / mL penicillin, and 100 mg / L streptomycin.

4. The method for regulating osteogenic differentiation of periodontal ligament stem cells in an inflammatory microenvironment based on stem cell-derived extracellular matrix according to claim 1, characterized in that, The osteogenic induction formula contains 10% fetal bovine serum, 10 mmol·L⁻¹ sodium β-glycerophosphate, 50 mg·L⁻¹ ascorbic acid, and 10⁻¹... 7 α-MEM of dexamethasone at mol·L⁻¹ 5. The method for regulating osteogenic differentiation of periodontal ligament stem cells in an inflammatory microenvironment based on stem cell-derived extracellular matrix according to claim 1, characterized in that, The nonionic surfactant used is Triton X-100.

6. The method for regulating osteogenic differentiation of periodontal ligament stem cells in an inflammatory microenvironment based on stem cell-derived extracellular matrix according to claim 1, characterized in that, Step 2) describes the morphological feature detection, which employs fluorescence microscopy and scanning electron microscopy (SEM). The specific steps include: The detection steps under a fluorescence microscope are as follows: After inducing BMMSCs and PDLSCs in the film-forming culture medium for 10 days, wash them three times with PBS for 5 minutes each time to remove the culture medium and non-adherent cells; then, add 4% paraformaldehyde solution and fix the samples at room temperature for 10 minutes; after fixation, aspirate the paraformaldehyde solution and wash three more times with PBS to ensure complete removal of the fixative; then, add DAPI (4',6-diamidinyl-2-phenylindole) staining solution under light-protected conditions and incubate for 5 minutes to stain the cell nuclei; after staining, observe in detail under a fluorescence microscope and take photographs to record the results; similarly, use the fixation and staining procedures described above to process the decellularized ECM samples; The SEM detection steps are as follows: First, the ECM sample was washed three times with double-distilled water and fixed with 1.25% glutaraldehyde at 4°C. After fixation, it was washed three more times with double-distilled water to remove glutaraldehyde residue. Then, it was dehydrated in gradient ethanol solutions of 50%, 70%, 80%, 90%, 95%, and 100% for 15 minutes each. Subsequently, it was stained with 1% OsO4 solution for 15 minutes to enhance contrast, and the aforementioned gradient ethanol dehydration was performed again to ensure that the sample was fully dried. After dehydration, critical point drying was performed using hexamethyldisiloxane (HMDS). The dried sample was mounted on a stud and sputtered. Finally, the microstructure and surface morphology of B-ECM and P-ECM were observed and recorded using a scanning electron microscope.

7. The method for regulating osteogenic differentiation of periodontal ligament stem cells in an inflammatory microenvironment based on stem cell-derived extracellular matrix according to claim 1, characterized in that, Step 2) describes a biosafety test using Live / Dead staining, which specifically includes the following steps: Third-generation PDLSCs were seeded at a density of 1×10⁵ cells / well in B-ECM, P-ECM, and standard TCP six-well plates for 24 h. Afterward, the culture medium was removed from the wells, and the cells were collected after digestion with 0.25% trypsin. The cells were then washed twice with 1xAssayBuffer and centrifuged (450 g, 5 min) to thoroughly remove trypsin and residual esterase. The resulting cell pellet was then resuspended in 1xAssayBuffer, and the cell concentration was adjusted to 1×10⁶ cells / mL. Then, 1-2 μL of Calcein-AM solution was added to each mL of the cell suspension, and after thorough mixing by pipetting, the cells were incubated at 37°C in the dark for 20-25 min. After incubation, 3-5 μL of Calcein-AM solution was added to the cell suspension. μL of PI solution was added, and then staining was performed at room temperature in the dark for 5 minutes. After staining, the staining solution was removed by centrifugation. Next, the cells were washed with PBS and centrifuged again with the same centrifugal force. The cells were then resuspended in PBS. Finally, a small amount of cell suspension was dropped onto a clean glass slide and gently pressed with a clean coverslip. The cells could then be observed and detected under a fluorescence microscope using a suitable filter. Statistical analysis and graphing were performed using GraphPad Prism 9.

0. The survival rate of each group was a quantitative data, expressed as mean ± standard deviation (Mean ± SD), and the values ​​were normal and homogeneous in variance. One-way ANOVA was used to analyze differences between groups. A p-value less than 0.05 was considered statistically significant.

8. The method for regulating osteogenic differentiation of periodontal ligament stem cells in an inflammatory microenvironment based on stem cell-derived extracellular matrix according to claim 1, characterized in that, Step 3) describes the establishment of the inflammation model, which specifically includes the following steps: Several commonly used Pg-LPS concentrations for constructing inflammation models were detected, and the concentration that best met the requirements of this experiment was selected. Third-generation PDLSCs were passaged and then seeded into six-well plates. When the cells reached 70%-80% confluence, the PDLSCs were treated with LPS at concentrations of 0, 1, 10, and 20 μg / mL, respectively. Total RNA was extracted from the cells after 24 hours, and the expression levels of inflammation-related mRNAs in each group were detected by qRT-PCR. On day 7, total RNA was extracted from the cells, and the expression levels of bone-related mRNAs in each group were detected by qRT-PCR. The medium was changed every other day.

9. The method for regulating osteogenic differentiation of periodontal ligament stem cells in an inflammatory microenvironment based on stem cell-derived extracellular matrix according to claim 1, characterized in that, Step 4) describes the effects of P-ECM and B-ECM on osteogenic differentiation of PDLSCs in an inflammatory environment, specifically including the following steps: 1) Alkaline phosphatase activity assay: Alkaline phosphatase (ALP) activity was tested on day 7 of osteogenic induction using BCIP / NBT alkaline phosphatase chromogenic buffer (Beyotime, China). BCIP / NBT staining working solution was prepared, ensuring thorough mixing. Cells were washed three times with PBS for 3 minutes each time. Then, BCIP / NBT substrate solution was added, controlling the volume to ensure the reaction solution fully wetted the cell growth surface. The chromogenic reaction was carried out in a constant temperature environment (25℃±2℃) in the dark for 30 minutes. After the chromogenic process was complete, residual reaction solution was thoroughly removed, and pre-cooled distilled water at 4℃ was injected to terminate the chromogenic process. Finally, observation and photography were performed to record the ALP staining results. 2) RNA extraction, reverse transcriptase polymerase chain reaction (RT-PCR), and quantitative real-time polymerase chain reaction (qPCR): 3) Total RNA extraction was performed on day 7 of osteogenic induction. Cells were first washed three times with pre-chilled PBS. 1 mL of RNAiso Plus lysis buffer was added to each well, and the cells were thoroughly lysed by pipetting. The lysis buffer was transferred to a 1.5 mL EP tube. The tube was centrifuged at 12000 g for 15 minutes at 4°C. The supernatant was transferred to a new tube, and 200 μL of chloroform was added. The tube was quickly sealed and inverted to mix. The tube was allowed to stand at room temperature for 5 minutes until the layers separated. The tube was then centrifuged again at 12000 g for 15 minutes at 4°C. After the solution separated into three layers, 300-400 μL of the clear upper aqueous phase was precisely transferred to a new EP tube. An equal volume of isopropanol was added and mixed. The tube was allowed to stand at room temperature for 10 minutes (or overnight at -20°C) to precipitate RNA. The tube was then centrifuged at 12000 g for 10 minutes at 4°C, and the supernatant was discarded. 500 μL of pre-chilled 75% ethanol was added to wash the precipitate. The washing and centrifugation were repeated twice. After removing any residual liquid, the precipitate was dried by inverting the tube. 20 μL of ethanol was added to the precipitate. The RNA precipitate was fully dissolved in DEPC water, and its purity and concentration were determined using a spectrophotometer. Reverse transcription was then performed: based on the RNA concentration, the volume was calculated at 1000 ng per system. Working solution was prepared using the Takara reverse transcription kit, incubated at 37°C for 15 minutes, and then terminated at 85°C for 5 seconds. The obtained cDNA was stored at -20°C. Finally, a qPCR system was prepared: using the cDNA as a template, a 20 μL reaction system was constructed according to the TB Green Premix Ex Taq™ II manual. The program was run on a real-time quantitative PCR instrument (95°C pre-denaturation for 30 seconds, followed by cyclic amplification at 95°C for 5 seconds → 60°C for 30 seconds). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the housekeeping gene for real-time quantitative polymerase chain reaction (qPCR), and the average value was derived using formula 2-ΔΔCt. Primer design and synthesis are as follows: ALP CCAAAGGCTTCTTCTCTGCTGCCACCAAATGTGAAGACGTG COL1A1TCTGCGACAACGGCAAGGTGTCGACGCCGGTGGTTTCTTGGT RUNX2 TCGCCAGGCTTCATAGCAAAGGCCTTGGGTAAGGCAGATT OCNGGCGCTACCTGTATCAATGGGTGGTCAGCCAACTCGTCA GAPDH TGCACCACCAACTGCTTAGCATGGACTGTGGTCATGAG 4) Western blotting: Western blotting involves staining gel electrophoresis-treated cell or tissue samples with specific antibodies. Analysis of the staining location and depth reveals the expression of specific proteins in the analyzed cells or tissues. Protein extraction was performed using a protein extraction kit. Total protein was extracted on day 14 of osteogenic induction using RIPA buffer. Cells were washed three times with pre-cooled PBS at 4°C. 80 μL of freshly prepared RIPA lysis buffer (containing the protease inhibitor PMSF, 100:1 ratio) was added to each well. The cell mixture was scraped and transferred to 1.5 mL EP tubes. The cells were then subjected to intermittent sonication (10 seconds / time × 3, 10-second intervals), followed by centrifugation at 12000 rpm for 10 minutes at 4°C to separate the supernatant. The protein concentration in the supernatant was determined using the BCA method, and the protein was extracted according to a standard of 20 μg / well using Loading... After the buffer was standardized to the same concentration, it was stored at -20℃ for later use. SDS-PAGE electrophoresis was then performed: Glass plates were aligned and installed, separating gel was injected, and water was used to remove bubbles. After solidification, a comb was inserted to prepare a stacking gel. Samples were adjusted to the same concentration, and 20 μL were loaded. Electrophoresis was performed at 100V until the bromophenol blue indicator was reached, at which point the gel was removed and trimmed. During the transfer stage, a sponge-filter paper-gel-filter paper-sponge sequence was stacked sequentially, and air bubbles were removed. The transfer tank was placed in an ice bath for cooling. After transfer, the membrane was blocked with 5% skim milk for 120 minutes, incubated with primary antibody at 4℃ overnight, washed three times with TBST (10 minutes each time), and incubated with secondary antibody at room temperature for 90 minutes before another TBST wash. ECL chemiluminescence was used for development, and a gel imaging system was used to capture the signal. The main antibodies included: Fluor 488-goat anti-rabbit secondary antibody (Beyotime, China), ALP monoclonal antibody (Abcam, UK), Col-I antibody (Abcam, USA), and GAPDH (Abcam, USA). The final image was obtained using ImageJ. 1.53k quantitative strip gray values ​​(after background correction and internal reference standardization) were plotted using GraphPad Prism 9.0 and analyzed using SPSS 22.0 for Shapiro-Wilk normality test, Levene homogeneity of variance test, and ANOVA-LSD post-hoc statistical analysis.

10. The method for regulating osteogenic differentiation of periodontal ligament stem cells in an inflammatory microenvironment based on stem cell-derived extracellular matrix according to claim 1, characterized in that, The adipogenic induction process alternates between solution A and solution B, wherein the culture medium for solutions A and B is α-mem; solution A contains IBMX 0.5mM, indomethacin 0.2mM, dexamethasone 10uM, and insulin 10ug / ml; and solution B contains insulin 10ug / ml.

Images