Biosynthesis process of creatine monohydrate
By catalyzing the reaction of chloroacetic acid and monomethylamine with sarcosine convertase and creatine convertase, and combining biotransformation and chloroform extraction, the high energy consumption and environmental pollution problems of existing chemical methods for synthesizing creatine monohydrate have been solved, realizing a highly efficient and economical biosynthesis process that is applicable to the fields of sports nutrition, medicine and health products.
Patent Information
- Application Number
- CN202511315802.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-15
- Publication Date
- 2025-12-05
AI Technical Summary
Existing chemical methods for synthesizing creatine monohydrate suffer from problems such as expensive raw materials, complex processes, environmental pollution, high energy consumption, and high costs. Furthermore, traditional extraction methods are unsanitary and costly.
The N-alkylation reaction of chloroacetic acid and monomethylamine was catalyzed by sarcosine convertase and creatine convertase at room temperature and pressure, and creatine monohydrate was generated through bioconversion. After chloroform extraction and washing with pure water, the mixture was dried under low temperature and negative pressure to form creatine monohydrate.
It achieves efficient production of creatine monohydrate with low energy consumption, environmental protection, and economy, with an annual output of 1,000 to 2,000 tons and a yield of 53% to 66%, providing a sustainable industrial production solution.
Smart Images

Figure CN121065283A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to a biosynthesis process of creatine monohydrate, belonging to the field of bioengineering technology. BACKGROUND
[0002] Creatine monohydrate is a naturally occurring nitrogen-containing organic acid in vertebrates, mainly distributed in skeletal muscle and brain tissue, which can accelerate ATP regeneration by increasing phosphocreatine levels, thereby enhancing muscle explosive strength, delaying fatigue, and promoting muscle growth. It is widely used in sports nutrition, medicine, health products, food additives, etc. fields, especially for high-intensity sports groups (such as weightlifting, sprint athletes) and muscle atrophy in the elderly. The traditional preparation method of creatine is to extract from biological raw materials such as meat scraps, which is not only expensive but also unhygienic. Chemical synthesis has become the mainstream approach, that is, by reacting aminocarbonitrile with sarcosine (patent CN1140707A) and using methylamine aqueous solution, chloroacetic acid aqueous solution (CN115772100A) or sodium sarcosine and monocyanoamine (CN115636772B) as raw materials to synthesize creatine monohydrate under high temperature, acid, and alkaline environment. Although these methods significantly reduce the cost and health problems compared to the traditional extraction method, they still have problems such as expensive raw materials, poor raw material stability, high energy consumption, complex process, and environmental pollution. SUMMARY
[0003] In view of the deficiencies of the prior art, the present application provides a new biosynthesis process of creatine monohydrate, aiming to use inexpensive raw materials to produce creatine monohydrate on a large scale at room temperature, normal pressure, and neutral pH environment, solving the problems of expensive raw materials, poor raw material stability, high energy consumption, complex process, and environmental pollution in existing chemical synthesis.
[0004] The present application provides a biosynthesis method of creatine monohydrate, comprising the following steps:
[0005] (1) Add chloroacetic acid aqueous solution (80%) into a biochemical kettle, and adjust the pH value to 6-8 with ammonia solution (9%);
[0006] (2) Add methylamine solution (40%), and maintain the pH value of the system at 7-8;
[0007] (3) Add sarcosine conversion enzyme, adjust the pH value to 5-7.5 with ammonia solution (9%), control the temperature at 35-40℃, and the biological conversion time is about 8h;
[0008] (4) Cool to below 10℃ and centrifuge to separate the sarcosine conversion enzyme and other impurities;
[0009] (5) adding creatine converting enzyme to the centrifugal supernatant of step (4) and controlling the temperature at 35-37℃;
[0010] (6) slowly adding aqueous monomethylamine solution (30-40%) and reacting for 10h;
[0011] (7) adding chloroform to the above converting solution to extract creatine converting enzyme and impurities, removing chloroform, concentrating the upper product and cooling to below 5℃ to precipitate the product;
[0012] (8) filtering the above material to obtain a crude product, slurrying the crude product with purified water, centrifuging and washing twice with purified water to obtain a fine product;
[0013] (9) placing the fine product into an oven and drying at below 60℃ under negative pressure (-0.09MPa) for 6h, with the residual moisture content being 11-12%.
[0014] The application further discloses a creatine monohydrate biosynthesis method, which comprises the following steps:
[0015] (1) adding monomethylamine solution to a chloroacetic acid solution to obtain a reaction system;
[0016] adding creatine converting enzyme with an amino acid sequence as shown in SEQ ID NO. 1 to the reaction system to react, centrifuging and collecting the supernatant;
[0017] (2) adding creatine converting enzyme with an amino acid sequence as shown in SEQ ID NO. 3 and aqueous monomethylamine solution to the supernatant obtained in step (1) to react, to prepare a converting solution;
[0018] (3) adding chloroform to the converting solution prepared in step (2), centrifuging, separating the water phase, concentrating and cooling the water phase to obtain creatine monohydrate.
[0019] In an embodiment of the application, in step (1), the creatine converting enzyme has an enzyme activity of 20528.21U / mg, and the adding amount of the creatine converting enzyme is 29-30kg.
[0020] In an embodiment of the application, in step (1), the mass fraction of the chloroacetic acid solution is 75-85%, and the mass fraction of the monomethylamine solution is 35-45%.
[0021] In an embodiment of the application, the adding amount of the chloroacetic acid solution is 950-1050kg, and the adding amount of the monomethylamine solution is 700-750kg.
[0022] In an embodiment of the present application, in step (2), the enzyme activity of the creatine-converting enzyme is 17208.05 U / mg, and the adding amount of the creatine-converting enzyme is 49-50 kg.
[0023] In an embodiment of the present application, in step (2), the mass fraction of the monosodium cyanamide solution is 25-35%, and the adding amount of the monosodium cyanamide solution is 1100-1150 kg.
[0024] In an embodiment of the present application, in step (1), after adding the monomethylamine solution to the solution containing chloroacetic acid and adjusting the pH to 7-8, the sarcosine-converting enzyme is added to the system, and the reaction is carried out at a temperature of 35-40°C, a pH of 5-7.5, and a reaction time of 7.5-8.5 h.
[0025] In an embodiment of the present application, in step (2), the reaction conditions are a pH of 7-8, a temperature of 35-40°C, and a reaction time of 9.5-10.5 h.
[0026] In an embodiment of the present application, in step (3), the concentration is carried out for 1.5-2.5 h, and the temperature is lowered to 4-6°C.
[0027] In an embodiment of the present application, in step (1), after adding the sarcosine-converting enzyme to the reaction system and carrying out the reaction, the system is cooled to below 10°C, centrifuged, and the sarcosine-converting enzyme and other impurities are separated, and the supernatant is taken.
[0028] In an embodiment of the present application, 4000-4500 kg of chloroform is added to the conversion solution prepared in step (2), and the organic phase chloroform layer is removed after centrifugation at 8000 x g for 15 min, and the water phase is collected, concentrated, and the monohydrate creatine is precipitated.
[0029] In an embodiment of the present application, the monohydrate creatine precipitated above is extracted by filtration to obtain a crude product, the crude product is slurried with 4000 kg of purified water (40-60 r / min), centrifuged (8000 x g, 15 min), and then washed twice with purified water to obtain a fine product.
[0030] In an embodiment of the present application, the fine product is placed in an oven and dried at a temperature below 60°C under negative pressure (-0.09 MPa) for 6 h, and the residual water content is 11-12%, and finally about 960 kg of monohydrate creatine is obtained with a yield of 53%.
[0031] The present application also provides the use of the above method in the preparation of monohydrate creatine or a product containing monohydrate creatine.
[0032] Advantages
[0033] The application discloses a biosynthesis method of creatine monohydrate, i.e. N-alkylation reaction of chloroacetic acid and monomethylamine is catalyzed by sarcosine conversion enzyme to prepare sarcosine, and then creatine monohydrate is generated under the catalysis of creatine conversion enzyme. The process has mild reaction conditions (temperature 25-37℃, pH 6.0-8.0, which is more mild than the high-temperature alkaline condition in patent CN 118955333 A and the high-temperature acidic condition in patent CN 118993942 A, and has lower energy consumption), high conversion efficiency (the yield is 53%-66%, and the annual output of creatine monohydrate can be up to 1000-2000 tons), environmental protection and high economic efficiency (the green synthesis method of enzyme catalysis is adopted, and relatively cheap compounds such as chloroacetic acid, monomethylamine and monocyanoamine are used as raw materials, which shows higher economic efficiency than glycine used in CN 118993942 A and dimethyl sulfate and urea used in CN 119306637 A). The application provides a new synthesis method for sustainable synthesis of creatine monohydrate, and provides a new idea for industrialized production of creatine monohydrate. BRIEF DESCRIPTION OF DRAWINGS
[0034] Figure 1 It is a reaction path diagram.
[0035] Figure 2 It is a process flow diagram. DETAILED DESCRIPTION
[0036] In order to make the technical means, creative features, purposes and effects realized by the application easy to understand, the application is further described below in combination with specific embodiments.
[0037] The detection method involved in the following examples is as follows (for specific steps, see the literature “Zhou YH. Reconstruction of Escherichia coli central metabolism to synthesize sarcosine [D]. Tianjin University of Science and Technology, 2023.”): Derivative reagent configuration: add 20ml 2,4-dinitrofluorobenzene to acetonitrile, and then dilute to 2000ml in a brown volumetric flask, and store in the dark.
[0038] The sample was sequentially added with 200 μL of 50 mM NaHCO3 solution and 300 μL of pre-derivative agent, placed on a sponge float, and incubated in a constant temperature water bath at 65°C for 60 min. After cooling and centrifuging the sample at room temperature, 690 μL of 50 mM KH2PO4 solution was added. After removing impurities through a 0.45 μM organic membrane, the sample was filtered into a brown liquid chromatography bottle for detection. The chromatographic column used for measurement was Acclaim 120 C18 (150 x 4.6 mM 3 μm), P / N: 059133, S / N: 002689. The mobile phase C was 20 mM sodium acetate solution, the mobile phase D was 20 mM ammonium acetate solution: methanol: acetonitrile = 1:2:2, a binary gradient elution analysis method was used, the total flow rate of the mobile phase was set to 1 mL / min, the detection temperature was set to 33°C, the detection wavelength was set to 310 nm, and the mobile phase was set as shown in Table 1.
[0039] Table 1: Gradient elution program
[0040]
[0041] The detection method involved in the following examples can refer to the method disclosed in the literature “Zhou YH. Reconstruction of Escherichia coli central metabolism to synthesize sarcosine[D]. Tianjin University of Science and Technology, 2023.”
[0042] The yield calculation formula of monohydrate creatine involved in the following examples is as follows:
[0043]
[0044] Example 1: Preparation of sarcosine conversion enzyme and creatine conversion enzyme and detection of enzyme activity
[0045] The specific steps are as follows:
[0046] 1. Preparation of sarcosine conversion enzyme and detection of enzyme activity
[0047] The sarcosine conversion enzyme sequence involved in the present application is as follows:
[0048] Amino acid sequence (SEQ ID NO. 1):
[0049] MAVQQYGVLKGIVLDMKRETDDDSPHFQVKMLGEENTYYRCAINVMSSSEESEVLYLADDQFDSGSITILPNMPYGYTRINEANREVALDYVRGNLFDPREMKPLPHEITGPDNDLNDFIETYMKKAQDEKTPVYIFGSKFGPEQAADKIFGFTPTNGMHNIHMNQGNAMDTRWKKDNGSWHDGGILIQFADQWAAVFLAFLSQSWCTDENGNPVRDCDHTQTSA
[0050] Nucleotide sequence (SEQ ID NO. 2):
[0051] atggctgttcagcaatatggcgtgttaaaaggcatagtattagacatgaagcgggaaacagatgatgacagtcctcatttccaagtcaaaatgctcggtgaagagaatacgtattacaggtgcgccatcaatgtgatgtccagttctgaggaatctgaagtattgtatttggctgacgatcagtttgattcgggctcaattaccatccttccgaacatgccgtatggatatacaaggatcaatgaagcaaaccgtgaagtggcactggattatgtgcggggcaatttgtttgacccgcgggaaatgaagcctttgcctcatgaaatcacgggacctgataatgatttaaatgattttattgaaacctatatgaagaaagcacaagatgagaaaacgccggtttatatattcggttcaaaattcggccctgaacaggctgcagataaaatattcggctttaccccgactaacggaatgcacaatatccatatgaatcaagggaatgcaatggatacccgctggaaaaaagacaacggctcttggcatgacgggggtattctgattcagtttgcagatcagtgggccgctgtgtttttagcgtttttatcccaatcttggtgtaccgatgaaaacggaaaccctgtcagagattgtgatcatacccaaacgtctgcgtaa
[0052] (1) Preparation of enzyme
[0053] The pET-28a(+) plasmid was purchased from Novagen (Madison, WI, U.S.A.), the host used was E.coli BL21(DE3), and the vector was pET-28a(+).
[0054] The sarcosine transaminase gene was connected to pET-28a(+) and transformed into E.coli BL21(DE3) to prepare a recombinant strain, which was inoculated into LB culture medium and cultured at 37℃ for 8h to prepare a seed liquid; the prepared seed liquid was inoculated into LB liquid culture medium at an inoculation amount of 10%(v / v) and cultured at 25℃, 200rpm for 16h to prepare a fermentation liquid, and the fermentation liquid was centrifuged to obtain the recombinant strain;
[0055] The recombinant strain cells containing the recombinant sarcosine transaminase were broken, the supernatant was taken, and the cell broken liquid was obtained, and the freeze-dried enzyme powder of the recombinant sarcosine transaminase cell broken liquid was obtained by freeze-drying.
[0056] (2) Detection of enzyme activity
[0057] Sarcosine transaminase enzyme activity determination: 10mL of a chloroacetic acid aqueous solution (80%) was added to a reaction bottle, then 7mL of a monomethylamine solution (40%) was added, the pH value was adjusted to 7.5 with an ammonia solution (9%), 0.3mg of sarcosine transaminase was added, the pH value was adjusted to 7.0 with an ammonia solution (9%), the temperature was 37℃, and the reaction was carried out for 0.5h. After the reaction was completed, 50mM HCl was added to terminate the reaction,
[0058] Definition of sarcosine transaminase enzyme activity: 1μmol·L -1 Enzyme amount of sarcosine.
[0059] The results show that the enzyme activity of sarcosine transaminase is 20528.21U / mg.
[0060] 2. Preparation of creatine transaminase and detection of enzyme activity
[0061] The sequence of the creatine transaminase gene involved in the present application is as follows:
[0062] Amino acid sequence (SEQ ID NO.3):
[0063] MQMPKTLRIRNGDKVRSTFSAQEYANRQARLRAHLAAENIDAAIFTSYHNINYYSDFLYCSFGRPYALVVTEDDVISISANIDGGQPWRRTVGTDNIVYTDWQRDNYFAAIQQALPKARRIGIEHDHLNLQNRDKLAARYPDAELVDVAAACMRMRMIKSAEEHVMIRHGARIADIGGAAVVEALGDQVPEYEVALHATQAMVRAIADTFEDVELMDTWTWFQSGINTDGAHNPVTTRKVNKGDILSLNCFPMIAGYYTALERTLFLDHCSDDHLRLWQVNVEVHEAGLKLIKPGARCSDIARELNEIFLKHDVLQYRTFGYGHSFGTLSHYYGREAGLELREDIDTVLEPGMVVSMEPMIMLPEGLPGAGGYREHDILIVNENGAENITKFPYGPEKNIIRK
[0064] Nucleotide sequence (SEQ ID NO. 4):
[0065]
[0066] (1) Preparation of enzyme
[0067] The pET-28a(+) plasmid was purchased from Novagen (Madison, WI, U.S.A.), the host used was E. coli BL21(DE3), and the vector was pET-28a(+).
[0068] The creatine transferase gene was connected to pET-28a(+) and introduced into E. coli BL21(DE3) to prepare a recombinant strain. The recombinant strain was inoculated into LB medium and cultured at 37°C for 8 h to prepare a seed liquid. The prepared seed liquid was inoculated into LB liquid medium at an inoculation amount of 10% (v / v) and cultured at 25°C, 200 rpm for 16 h to prepare a fermentation liquid. The fermentation liquid was centrifuged to obtain the recombinant strain. The transformant cells containing the recombinant creatine transferase were broken, the supernatant was taken, and the cell broken liquid was obtained. The freeze-dried enzyme powder was obtained by freeze-drying the recombinant creatine transferase cell broken liquid.
[0069] (2) Detection of enzyme activity
[0070] Creatine transferase enzyme activity determination: 10 mL of creatine aqueous solution (30% by mass) was added to a reaction bottle, then 10 mL of monomethylamine aqueous solution (30% by mass) was added, the pH value was adjusted to 7.5 with an aqueous ammonia solution (9%), 0.3 mg of creatine transferase was added, the pH value was adjusted to 7.0 with an aqueous ammonia solution (9%), the temperature was 37°C, and the reaction was carried out for 0.5 h. After the reaction was completed, 50 mM HCl was added to terminate the reaction.
[0071] Definition of creatine transferase enzyme activity: 1 μmol·L -1 of creatine consumed per minute.
[0072] The results showed that the enzyme activity of creatine transferase was 17208.05 U / mg.
[0073] The prepared enzyme was used for subsequent experiments.
[0074] Example 2: Preparation of monohydrate creatine
[0075] The specific steps are as follows:
[0076] (1) 1000 kg of chloroacetic acid aqueous solution (80% by mass) was added to a biochemical kettle, and 740 kg of aqueous ammonia solution (9% by mass) was added to adjust the pH value to 6-8;
[0077] (2) 700 kg of monomethylamine solution (40% by mass) was added to the system of step (1), and the pH value of the system was maintained at 7.5.
[0078] (3) To the system of step (2), add 30 kg sarcosine converting enzyme (prepared in Example 1), adjust the pH value to 5.0 with ammonia solution (9% by mass), and control the temperature at 37°C, and react for 8 h;
[0079] (4) Cool the system of step (3) to below 10°C, centrifuge (8000 x g, 15 min) to separate the sarcosine converting enzyme and other impurities, and take the supernatant;
[0080] (5) To the supernatant obtained by centrifuging in step (4), add 50 kg sarcosine converting enzyme (prepared in Example 1), control the temperature at 37°C, and slowly add 1130 kg monocyamide aqueous solution (30% by mass) dropwise, and react for 10 h to obtain a conversion solution;
[0081] (6) To the conversion solution of step (5), add 4000 kg chloroform (since the chloroform precipitates by changing the solubility of the sarcosine converting enzyme, the impurities in the solution dissolve in the chloroform and are removed together with the chloroform, and the chloroform and water are immiscible and can be separated), centrifuge (8000 x g, 15 min) to remove the sarcosine converting enzyme and impurities and separate the chloroform; concentrate the upper monohydrate sarcosine mixture for 2 h, cool to below 5°C to precipitate the product monohydrate sarcosine;
[0082] (7) Filter the above material of step (6) to obtain a crude product, and then pulp the crude product with 4000 kg purified water (40-60 r / min), centrifuge (8000 x g, 15 min), and then wash twice with purified water to obtain a fine product;
[0083] (8) Place the fine product in an oven, and dry at below 60°C under a negative pressure (-0.09 MPa) for 6 h, and the remaining water content is between 11-12%, and finally obtain about 960 kg monohydrate sarcosine at a yield of 53%.
[0084] Example 3: Preparation of monohydrate sarcosine
[0085] Compared with Example 2, the difference is that the pH value of step (3) is adjusted to 9.0;
[0086] The specific steps are as follows:
[0087] (1) Add 1000 kg chloroacetic acid aqueous solution (80%) to a biochemical kettle, and adjust the pH value to between 6-8 with about 740 kg ammonia solution (9%) ;
[0088] (2) To the system of step (1), add 700 kg monomethylamine solution (40%), and maintain the pH value of the system at 7.5;
[0089] (3) To the system of step (2), add 30 kg sarcosine conversion enzyme (prepared in Example 1), adjust the pH value to 9.0 with ammonia solution (9%), and control the temperature at 37°C, and react for 8 h;
[0090] (4) Cool the system of step (3) to below 10°C, centrifuge (8000 x g, 15 min) to separate the sarcosine conversion enzyme and other impurities, and take the supernatant;
[0091] (5) To the supernatant obtained after centrifugation in step (4), add 50 kg sarcosine conversion enzyme (prepared in Example 1), control the temperature at 37°C, and slowly add 1130 kg monocyanoamine aqueous solution (30% by mass) dropwise, and react for 10 h to obtain a conversion solution;
[0092] (6) To the conversion solution of step (5), add 4000 kg chloroform (since the chloroform precipitates by changing the solubility of the sarcosine conversion enzyme, the impurities in the solution dissolve in the chloroform and are removed together with the chloroform, and the chloroform and water are immiscible and can be separated), centrifuge (8000 x g, 15 min) to remove the sarcosine conversion enzyme and impurities, and separate the chloroform; concentrate the upper monohydrate sarcosine mixture for 2 h, cool to below 5°C, and precipitate the product monohydrate sarcosine;
[0093] (7) Filter the crude product obtained in step (6), and then pulp the crude product with 4000 kg purified water (40-60 r / min), centrifuge (8000 x g, 15 min), and then wash twice with purified water to obtain a fine product;
[0094] (8) Place the fine product in an oven, and dry at below 60°C under a negative pressure (-0.09 MPa) for 6 h, and the remaining water content is between 11-12%, and finally obtain about 700 kg of dry product, with a yield of 39%.
[0095] Example 4: Preparation of monohydrate sarcosine
[0096] Compared with Example 2, the difference is that the pH value of step (3) is adjusted to 7.0;
[0097] The specific steps are as follows:
[0098] (1) Add 1000 kg chloroacetic acid aqueous solution (80%) to a biochemical kettle, and adjust the pH value to between 6-8 with about 740 kg ammonia solution (9%) ;
[0099] (2) Add 700 kg monomethylamine solution (40%) to the system of step (1), and maintain the pH value of the system at 7.5;
[0100] (3) to the system of step (2) adjusted pH, add 30 kg of sarcosine conversion enzyme (preparation of example 1), with ammonia solution (9%) to adjust pH to 7.0, temperature control at 37 ℃, reaction 8 h;
[0101] (4) the system obtained in step (3) is cooled to below 10 ℃, centrifuged (8000xg, 15 min), and the sarcosine conversion enzyme and other impurities are separated out, and the supernatant is taken;
[0102] (5) 50 kg of sarcosine conversion enzyme (prepared in example 1) is added to the supernatant obtained after centrifugation in step (4), and the temperature is controlled at 37 ℃; 1130 kg of monocyanoamine aqueous solution (mass fraction of 30%) is slowly added dropwise, and the reaction is carried out for 10 h to obtain a conversion solution; the specific synthesis route is shown in Figure 1 and Figure 2 .
[0103] (6) 4000 kg of chloroform is added to the above conversion solution obtained in step (5), and the chloroform is precipitated due to the change of the solubility of the sarcosine conversion enzyme, and the impurities in the solution are dissolved in the chloroform and removed together with the chloroform, and the chloroform and water are not miscible and can be separated, and the chloroform is separated out; the upper monohydrate sarcosine mixture is concentrated for 2 h, cooled to below 5 ℃, and the product monohydrate sarcosine is precipitated;
[0104] (7) the above material obtained in step (6) is filtered to obtain a crude product, the crude product is slurried with 4000 kg of pure water (40-60 r / min), and the product is obtained by centrifugation (8000xg, 15 min) and washing with pure water twice;
[0105] (8) the product is placed in an oven and dried at a temperature below 60 ℃ under a negative pressure of-0.09 MPa for 6 h, and the residual moisture content is between 11-12%, and finally about 1200 kg of dry product is obtained, with a yield of 66%.
[0106] The product separation and purification route is shown in Figure 2 .
[0107] Although the present application has been disclosed with the above preferred embodiments, it is not intended to limit the present application, and any person skilled in the art can make various modifications and modifications without departing from the spirit and scope of the present application, therefore the protection scope of the present application should be defined by the claims.
Claims
1. A method for creatine monohydrate biosynthesis, characterized by, The method comprises the following steps: (1) adding monomethylamine solution to a chloroacetic acid solution to obtain a reaction system; After adding sarcosine conversion enzyme with an amino acid sequence as shown in SEQ ID NO. 1 to the reaction system for reaction, centrifugation is performed, and the supernatant is collected; (2) adding creatine conversion enzyme with an amino acid sequence as shown in SEQ ID NO. 3 and monomethyl cyanamide solution to the supernatant obtained in step (1) to perform reaction to prepare a conversion liquid; (3) adding chloroform to the conversion liquid prepared in step (2), performing centrifugation, and separating the water phase, and then concentrating and cooling the water phase to obtain creatine monohydrate.
2. The method of claim 1, wherein, In step (1), the enzyme activity of the sarcosine conversion enzyme is 20528.21 U / mg, and the addition amount of the sarcosine conversion enzyme is 29-30 kg. Preferably, the nucleotide sequence encoding the sarcosine conversion enzyme is shown in SEQ ID NO.
2.
3. The method of claim 2, wherein, In step (1), the mass fraction of the chloroacetic acid solution is 75-85%, the mass fraction of the monomethylamine solution is 35-45%, the addition amount of the chloroacetic acid solution is 950-1050 kg, and the addition amount of the monomethylamine solution is 700-750 kg.
4. The method of claim 3, wherein, In step (2), the enzyme activity of the creatine conversion enzyme is 17208.05 U / mg, and the addition amount of the creatine conversion enzyme is 49-50 kg. Preferably, the nucleotide sequence encoding the creatine conversion enzyme is shown in SEQ ID NO.
4.
5. The method of claim 4, wherein, In step (2), the mass fraction of the monomethyl cyanamide solution is 25-35%, and the addition amount of the monomethyl cyanamide solution is 1100-1150 kg.
6. The method of claim 5, wherein, In step (1), after adding the monomethylamine solution to the chloroacetic acid solution with pH adjusted to 6-8, the pH of the system is adjusted to 7-8, and then the sarcosine conversion enzyme is added to the system with pH adjusted, and the reaction is performed under the conditions of a temperature of 35-40°C, a pH of 5-7.5, and a reaction time of 7.5-8.5 h. Preferably, the pH of the solution is adjusted by using an ammonia solution.
7. The method of claim 6, wherein, In step (2), the reaction conditions are a pH of 7-8, a temperature of 35-40°C, and a reaction time of 9.5-10.5 h.
8. The method of claim 7, wherein, In step (3), the concentration is performed for 1.5-2.5 h, and the temperature is cooled to 4-6°C.
9. The method of claim 8, wherein, In step (1), after adding the sarcosine conversion enzyme to the reaction system for reaction, the reaction system is cooled to below 10°C, centrifugation is performed, the sarcosine conversion enzyme and other impurities are separated, and the supernatant is taken. Preferably, 4000-4500 kg of chloroform is added to the conversion liquid prepared in step (2), and then centrifugation is performed under the conditions of 8000 x g and 15 min, the organic phase chloroform layer is removed, the water phase is collected, and the water phase is concentrated to precipitate creatine monohydrate.
10. The method according to any one of claims 1-9 for use in preparing creatine monohydrate or a product containing creatine monohydrate.
Citation Information
Patent Citations
A preparation method of high-purity creatine monohydrate
CN115636772B
Method for continuously producing creatine monohydrate through microchannel reaction device
CN115772100A
Method for synthesizing creatine monohydrate from glycine
CN118993942A
High-purity creatine monohydrate and preparation method thereof
CN119306637A