Fluorescent microsphere coding method for regulating and controlling FRET efficiency based on nucleic acid and application
A fluorescent microsphere coding method that regulates FRET efficiency through nucleic acid hybridization on the surface of microspheres solves the problems of complexity and high cost in existing microsphere coding techniques, realizing a simple and low-cost microsphere coding process suitable for multiplex DNA detection.
Patent Information
- Application Number
- CN202511276899.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-08
- Publication Date
- 2025-12-05
AI Technical Summary
Existing microsphere coding methods suffer from problems such as complex coding processes, high costs, and insufficient stability, especially in terms of environmental sensitivity and preparation difficulty.
By performing nucleic acid hybridization on the surface of microspheres, and using DNA-encoding probes of different lengths and fluorescent probes labeled with different fluorescent groups, the FRET efficiency of the fluorescent groups can be controlled, thereby achieving regulation of fluorescence intensity, simplifying the encoding process and improving stability.
It achieves a simple and low-cost microsphere coding process, with accurate measurement results, good repeatability, and is suitable for multiplex DNA detection, featuring high throughput and high signal stability.
Smart Images
Figure CN121065311A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of DNA detection, and particularly relates to a fluorescent microsphere coding method based on nucleic acid regulation of FRET efficiency and application. BACKGROUND
[0002] In recent decades, liquid suspension chip technology has gradually developed into one of the most application potential platforms in the field of high-throughput detection. Compared with solid-phase chips, liquid suspension chips exhibit significant advantages in scenarios requiring continuous analysis of hundreds to thousands of biological samples, and can efficiently meet the needs of precision and high-throughput detection. The core lies in that microspheres are uniformly dispersed in a liquid system, and the combination with target molecules follows the solution reaction kinetics principle, and the reaction rate is significantly higher than that of solid-phase carriers.
[0003] Microspheres, as the key elements for recognizing and capturing target molecules, constitute the signal output unit of multiplex detection technology after coding, and belong to the most application prospective multiplex detection technology. This technology has been widely applied in clinical testing, diagnosis, gene research and other aspects. There are many ways of microsphere coding at present, for example, up-conversion coding, which is an optical coding technology based on rare earth doped nanomaterials. However, it is extremely sensitive to the environment and will be affected by temperature and pH, and needs to be continuously optimized in efficiency, stability and other aspects. Therefore, people proposed quantum dot coding, which is a multiplex labeling technology based on semiconductor nanocrystals. However, the preparation of quantum dot coding also needs to consider the problems of toxicity, cost and preparation difficulty, and there is still a certain distance from clinical practice.
[0004] The above existing mainstream coding methods mainly design for the internal structure of microspheres, and have limitations such as complex coding process and high cost. SUMMARY
[0005] The present application aims to at least solve one of the above-mentioned technical problems in the related art to some extent.
[0006] To this end, the present application aims to provide a fluorescent microsphere coding method based on nucleic acid regulation of FRET efficiency and application, which codes on the surface of microspheres with consistent size and uniform surface properties, controls the distance of two fluorescent groups by using nucleic acid hybridization, thereby controlling the intensity of two fluorescent signals on the magnetic beads, and realizes coding in two dimensions of wavelength and intensity.
[0007] To solve the above technical problems, the present application is implemented as follows:
[0008] The embodiment of the present application provides a fluorescent microsphere coding method based on nucleic acid regulation of FRET efficiency, wherein different lengths of DNA coding probes and two fluorescent probes labeled with different fluorescent groups are combined to the surface of magnetic beads through nucleic acid hybridization; the FRET efficiency of the two fluorescent groups is changed, so that the fluorescent intensity on the carboxyl magnetic beads is changed.
[0009] In addition, the fluorescent microsphere coding method based on nucleic acid regulation of FRET efficiency according to the present application can also have the following additional technical features:
[0010] In some embodiments, the steps of the method include:
[0011] S1, coupling probe and microsphere combination: the first coupling probe is coupled to the surface of the carboxylated magnetic bead through carboxyl-amino covalent reaction;
[0012] S2, hybridization reaction: taking the magnetic beads obtained through coupling, adding DNA coding probes, first fluorescent probes and second fluorescent probes, avoiding light for a period of time, and obtaining coding microspheres after washing;
[0013] S3, decoding: the fluorescent intensity of FAM and Cy3 is detected through a flow cytometer, and decoding is realized according to the position difference of the microspheres in the two-dimensional scatter diagram.
[0014] In some embodiments, the two fluorescent probes are fixed sequences; the first fluorescent probe is labeled with a fluorescent group FAM at a specific position in the middle, and the second fluorescent probe is labeled with a fluorescent group Cy3 at the 5' end.
[0015] In some embodiments, the DNA coding probe is a programmable sequence, and the sequence length can be changed to adjust the FRET efficiency.
[0016] In some embodiments, the 5' end of the first coupling probe is modified with an amino group.
[0017] In some embodiments, the content of step S1 includes:
[0018] The first coupling probe and the carboxyl magnetic bead are reacted through a metal shock instrument, the supernatant is collected after the reaction is completed, the magnetic beads are washed with MES solution, and finally the modified magnetic beads are dispersed in a certain amount of reaction buffer for standby.
[0019] In some embodiments, the content of step S2 includes:
[0020] The magnetic bead suspension modified by the first coupling probe is shaken uniformly, and a certain amount of the magnetic bead suspension is placed in a reaction tube, and the coding probe, the first fluorescent probe and the second fluorescent probe are sequentially added, and finally the reaction buffer is added; then it is placed in a metal shaker for a period of time in the dark, and after the reaction is completed, the obtained coding magnetic beads are washed with the reaction buffer and then dispersed in the buffer for standby.
[0021] The embodiment of the present application also provides an application of the fluorescent microsphere coding method based on nucleic acid regulation of FRET efficiency according to any one of the above, which is applied to DNA detection.
[0022] S11, capture probe fixing: the magnetic beads are modified by the second coupling probe, and the magnetic beads modified by the coupling probe are reacted with the capture probe to fix the capture probe; and the magnetic beads fixed with the capture probe are washed and standby;
[0023] S12, annealing and hybridization: the fluorescent probe and the coding probe are mixed, annealed at a specific temperature for a period of time, and naturally cooled; the mixed probes after cooling are mixed with the target probe and the magnetic beads fixed with the capture probe, and the buffer is added for hybridization reaction for a period of time; and the magnetic beads after reaction are washed and standby;
[0024] S13, detection: the fluorescent signal is analyzed by using a flow cytometer, and different target DNAs are distinguished by the position of the scatter diagram.
[0025] In addition, the application of the fluorescent microsphere coding method based on nucleic acid regulation of FRET efficiency according to the present application can also have the following additional technical features:
[0026] In some embodiments, the final concentration of the coding probe and the target probe is 0.05 μM, and the final concentration of the fluorescent probe is greater than 0.05 μM.
[0027] In some embodiments, the washing liquid for washing the magnetic beads in steps S11 and S12 satisfies the conditions that the pH is 7.5 and the Tween-20 surfactant is contained.
[0028] Compared with the prior art, the present application has at least the following beneficial effects:
[0029] In the embodiment of the present application, the fluorescent microsphere coding method based on nucleic acid regulation of FRET efficiency can control the distance between the two fluorescent groups by only changing the length of the coding probe sequence, so as to realize different ratios of FAM and Cy3, achieve the purpose of regulating FRET efficiency, and has the advantages of simple coding process, strong operability, accurate measurement result, good repeatability, low cost and universality of microspheres.
[0030] In the embodiment of the present application, the fluorescence microsphere coding method based on nucleic acid regulation of FRET efficiency is provided, the efficiency of FRET is adjusted by changing the sequence length of the coding probe, so that the microspheres load different fluorescence intensities, then through flow cytometry analysis, the scatter plot of the microspheres distributed in different positions can be observed, and 8 kinds of ratio fluorescent microspheres that can be obviously distinguished are screened out. From the screening of 8 kinds of codes, 5 kinds with high discrimination and stable signal are selected for nucleic acid molecule detection; the microspheres have universality, the coding process is simpler, the cost is low, the DNA sequence design is simple, and the chains are completely hybridized, good stability, good repeatability, and accurate measurement results.
[0031] Additional aspects and advantages of the present application will be in part apparent and in part pointed out hereinafter. BRIEF DESCRIPTION OF DRAWINGS
[0032] Figure 1 The design principle of the FRET-based fluorescent microsphere coding strategy disclosed for an embodiment of the present application is disclosed;
[0033] Figure 2 The absorbance change column chart of the magnetic bead modified coupling probe before and after the experiment one disclosed by the present application is disclosed;
[0034] Figure 3 The incubation temperature optimization column chart of the coding probe 3 on the microsphere and the fluorescent probe 1 and 2 in the experiment two disclosed by the present application is disclosed, the abscissa represents the temperature, and the ordinate represents the fluorescence intensity of FL1 and FL2;
[0035] Figure 4 The probe concentration optimization result chart in the experiment two disclosed by the present application is disclosed;
[0036] Figure 5 The DNA sequence screening chart of the 8 kinds of coding probes in the experiment three disclosed by the present application is disclosed, the coding microsphere position before screening is shown in figure A, and the coding microsphere position after screening is shown in figure B;
[0037] Figure 6 The fluorescence intensity chart of the 8 kinds of coding magnetic beads after screening in the experiment three disclosed by the present application is disclosed, the fluorescence intensity of FAM is shown in figure A, and the fluorescence intensity of Cy3 is shown in figure B;
[0038] Figure 7 The two-dimensional scatter plot of the coding microsphere position in the experiment four disclosed by the present application is disclosed, the position distribution of 5 kinds of target DNA detected alone is shown in figure A, and the position distribution of 5 kinds of target DNA detected simultaneously is shown in figure B. DETAILED DESCRIPTION
[0039] With reference to the drawings of the embodiments of the present application, the technical solutions in the embodiments of the present application will be clearly and completely described. Obviously, the described embodiments are only some of the embodiments of the present application, rather than all the embodiments of the present application. Based on the embodiments of the present application, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the scope of the present application.
[0040] The embodiments of the present application will be described in detail below with reference to the drawings and specific examples and application scenarios.
[0041] In some embodiments of the present application, a fluorescent microsphere coding method based on nucleic acid regulation of FRET efficiency is provided. The programmability of the coding probe DNA sequence is used to change the distance between the two fluorescent groups to achieve the purpose of regulating the FRET efficiency. The covalent binding of carboxyl and amino is used to load the coding probe and fluorescent signal to the magnetic beads, ensuring stable hybridization and repeatability of nucleic acids, and the fluorescent coding method is applied to DNA detection.
[0042] In some embodiments of the present application, the fluorescent microsphere coding method based on nucleic acid regulation of FRET efficiency comprises the following steps:
[0043] Step 1, coupling of the coupling probe and the microsphere.
[0044] The coupling probe 1 is coupled to the carboxyl magnetic bead surface by covalent bonding of carboxyl and amino. The supernatant is collected after reaction in a metal shaker (25℃, 1200rpm), and the magnetic beads are washed with MES solution three times. Finally, the modified magnetic beads are dispersed in 1000μL of reaction buffer and stored in the upper layer of the refrigerator for standby. The sequence of the coupling probe 1 is: H2N-TACTTCTTTACTACA.
[0045] Step 2, incubation of the coupling completed microsphere with the coding probe and two fluorescent probes.
[0046] The magnetic bead suspension modified with the coupling probe 1 is shaken uniformly, 10μL of which is taken in an EP tube, and the coding probe (the sequence of the coding probe is shown in Table 1), FAM fluorescent probe and Cy3 fluorescent probe are added in turn, and finally the reaction buffer is added. It is placed in a metal shaker (35℃, 1200rpm) to avoid light reaction for 4h. After the reaction, the coding magnetic beads are washed with reaction buffer three times, and finally dispersed in buffer for subsequent experiments.
[0047] Step 3, analysis of the modified microspheres using a flow cytometer.
[0048] The microspheres obtained in step 2 are detected for fluorescence signal intensity using a flow cytometer. Since the number of bases hybridized between the encoding probe sequence and the FAM fluorescent probe is different, the distance between the FAM group and the Cy3 group is also changed, and different FRET efficiencies result in different fluorescence intensities of the magnetic beads, and these magnetic beads are located at different positions in the two-dimensional scatter plot of the flow analysis software.
[0049] Step 4: DNA detection using a specific encoding method, including the following specific steps:
[0050] 4.1: The coupled microspheres are reacted with the capture probe. The coupling method is the same as that in step 1, but the probe is the sequence of the coupled probe 2: H2N-AAGAAGAAGAAGAAGT. The magnetic bead suspension modified with the coupled probe 2 is shaken uniformly, 10 μL of which is taken into an EP tube, the capture probe is added, and finally the reaction buffer is added. The mixture is placed in a metal shaker (35°C, 1200 rpm) for 2.5 h. After the reaction, the encoding magnetic beads are washed with the reaction buffer three times, and finally dispersed in the buffer for subsequent experiments.
[0051] 4.2: Then incubated with the annealed two fluorescent probes and the encoding probe, and the target probe. The optimized concentrations of the fluorescent probe 1, the fluorescent probe 2, and the encoding probe (the sequence of the encoding probe is shown in Table 3) are mixed, annealed at 95°C for 5 minutes, and then naturally cooled to room temperature. Finally, the products of the two steps are mixed, and the target DNA molecules at a final concentration of 50 nM are added to the respective EP tubes. Similarly, the reaction is carried out in 200 μL of buffer for 2.5 h, and the magnetic beads are washed twice after the reaction.
[0052] 4.3: The microspheres after incubation are analyzed using a flow cytometer. The magnetic beads obtained in 4.2 are dispersed in 200 μL of buffer for flow cytometry determination, and 3 x 10 3 magnetic beads are collected for each experiment.
[0053] In some embodiments of the present application, the final concentration of the encoding probe used in the DNA detection process is 0.05 μM, the final concentration of the target probe is also 0.05 μM, and the final concentration of the fluorescent probe is greater than 0.05 μM.
[0054] The pH of the washing solution used for washing the microspheres is 7.5, and the surfactant in the washing solution is Tween-20.
[0055] The two fluorescent probes are fixed sequences, each containing 15 and 45 bases. The fluorescent probe 1 is labeled with a fluorescent group with an excitation wavelength of 488 nm, and the fluorescent probe 2 is labeled with a fluorescent group with an excitation wavelength of 550 nm. The selection of the fluorescent molecules is limited by the conditions of the two fluorescence channels of the flow cytometer.
[0056] The materials and instruments used in the following examples are commercially available.
[0057] The FRET-based fluorescent microspheres of the present application have two fixed sequences of fluorescent probes, and the coding probe comprises a coding region. The coding probe, the fluorescent probe, and the coupling probe are sequentially connected to the microspheres.
[0058] The DNA sequence of the fluorescent probe 1 is shown in Table 2, specifically: ATTTACAACCAAAC / i6FAMdT / AACATTCAAATATCAATCATTCAATACTAT, and the middle is labeled with the fluorescent group FAM.
[0059] The DNA sequence of the fluorescent probe 2 is shown in Table 2, specifically: Cy3-CTAACACTTACTATC, and the 5' end is labeled with the fluorescent group Cy3.
[0060] The DNA sequence of the coding probe is shown in Table 1, and the coding probe 3 is taken as an example: GATAGTAAGTGTTAGTATTTGAATGTTAGTTTGGTTGTAAATTGTAGTAAA GAAGTA. The coding probe is completely complementary to the fluorescent probe 1 and the fluorescent probe 2. The italicized region is the number of bases between the fluorescent probe 1 and the fluorescent probe 2: 15 bases.
[0061] In an embodiment of the present application, a coding technique for FRET-based fluorescent microspheres is described in Figure 1 , which comprises the following steps:
[0062] 1. Coupling of the coupling probe and the microspheres.
[0063] 2. Incubation of the coupled microspheres with the coding probe and the two fluorescent probes.
[0064] 3. Position and fluorescence intensity analysis of the modified microspheres using a flow cytometer.
[0065] Experiment 1: Coupling of the coupling probe and the microspheres
[0066] The 5mg / mL carboxyl magnetic beads stock solution was mixed well by vortexing. 10 μL of the magnetic beads stock solution was taken in a 1.5 mL EP tube, 1000 μL of MES solution was added, the magnetic beads were washed by vortexing and centrifugation, and the supernatant was removed with the help of a magnetic stand. The washing process was repeated three times. After the last washing, 80 μL of freshly prepared EDC solution and 40 μL of 10 μM amino chain 1 were added. The total reaction volume was controlled at 1000 μL by adding MES solution. The reaction was carried out in a metal shaker (25°C, 1200 rpm) overnight. After the reaction was completed, the supernatant was collected and its absorbance was measured by UV spectrophotometry and compared with the absorbance value of the initial amount of coupling probe solution. After each modification, the measurement was repeated to ensure that the magnetic beads successfully bound the coupling probe 1.
[0067] The experimental results are shown in Figure 2 From the absorbance values, it can be seen that the absorbance of the DNA in the solution is close to 0.5, and after the modification reaction is completed, the absorbance is significantly reduced, with a value of about 0.2. This indicates that the coupling probe 1 has indeed successfully bound to the magnetic beads and there is a remaining amount in the supernatant, indicating that the magnetic beads have been saturated with modification.
[0068] Experiment two: optimization of incubation conditions for fluorescent probes and coupled microspheres
[0069] Optimization of incubation temperature: The magnetic beads suspension modified with coupling probes were shaken evenly, 10 μL was taken in an EP tube, 10 μL of coding probe 3, 15 μL of FAM fluorescent probe and 15 μL of Cy3 fluorescent probe were added in turn, and finally the reaction buffer was added to a volume of 200 μL. The reaction was carried out in a metal shaker (1200 rpm) for 4 h at 15°C, 25°C, 35°C and 45°C, respectively. After the reaction was completed, the coding magnetic beads were washed three times with 200 μL of reaction buffer, and finally dispersed in 200 μL of buffer for standby. Flow cytometry was used for decoding. Three repeated experiments were performed to ensure the accuracy of the experimental results. The results are shown in Figure 3 As the incubation temperature increases, the fluorescence intensity of channels one and two shows a trend of first decreasing and then increasing and then decreasing, and the optimal incubation temperature is 35°C.
[0070] Optimization of fluorescent probe concentration: The magnetic beads suspension modified with coupling probe 1 was shaken evenly, 10 μL was taken in an EP tube, and coding probe 7 and fluorescent probes 1 and 2 were added (final concentration 20, 40, 60, 80 nM) in turn. Finally, the reaction buffer was added to make the total reaction volume 200 μL. After mixing, the reaction was carried out in a metal shaker (35°C, 1200 rpm) for 4 h at constant temperature and in the dark. The fluorescence intensity on the magnetic beads was measured by flow cytometry. Three repeated experiments were performed to ensure the accuracy of the experimental results. The results are shown in Figure 4The fluorescence signal was increased with the probe concentration of 20, 40, 60 nM, but no obvious increase was observed when the concentration was increased to 80 nM. Therefore, 60 nM was selected as the concentration of the encoding probe and the fluorescent probe in the subsequent experiments.
[0071] Experiment three: screening of the DNA sequence of the encoding probe
[0072] Ten different encoding probes were designed to adjust the distance between the two fluorescent groups (0, 5, 8, 10, 12, 15, 17, 20, 25, 30 nt) to regulate the FRET efficiency. 10 μL of the magnetic bead suspension modified with the coupling probe 1 was taken into an EP tube, and the optimized concentration of the encoding probe, the fluorescent probe 1 and 2 were added in turn. The reaction buffer was added to a volume of 200 μL, and the mixture was placed in a metal shaker (35°C, 1200 rpm) for 4 h in the dark. After the reaction, the encoding magnetic beads were washed with 200 μL of the reaction buffer for three times, and finally dispersed in 200 μL of the buffer for subsequent experiments. The flow cytometry was used to detect the two fluorescent signals on the microspheres. The FL1 channel was opened to collect the fluorescence signal of FAM (Em = 525 nm), and the FL2 channel was opened to collect the fluorescence signal of Cy3 (Em = 570 nm). 3 x 105 magnetic beads were collected in each experiment, and the experiment was stopped. 3
[0073] The experimental results are shown in Figure 5 Figure 5 (A) is the two-dimensional scatter plot of 11 encoding magnetic beads. It can be seen that the positions of some encoding magnetic beads cannot be distinguished. Therefore, 8 encoding magnetic beads (the sequences of 7 encoding probes are shown in Table 1, and another magnetic bead is hybridized with only one FAM fluorescent probe) were selected from the 11 encoding magnetic beads. The position distribution of the two-dimensional scatter plot is shown in Figure 5 (B). The positions of the 8 encoding magnetic beads can be distinguished, and there is no interference between them. The fluorescence intensities of the 8 encoding magnetic beads were analyzed, and the results are shown in Figure 6 As the distance between the fluorescent groups increases, the fluorescence intensity of the FAM probe gradually increases as shown in Figure 6 (A), and the fluorescence intensity of the Cy3 probe gradually decreases as shown in Figure 6 (B), which is consistent with the FRET effect. Therefore, the strategy of the fluorescent encoding magnetic bead analysis platform for regulating the FRET efficiency by controlling the distance between the fluorescent groups through nucleic acids is feasible.
[0074] Experiment four: application of the fluorescent encoding microspheres in nucleic acid detection
[0075] From the screening of eight encoding in the third experiment, five kinds of large, stable signal (encoding probe 1, 4, 6, 7, including only hybridization of a FAM fluorescent probe magnetic beads) were selected for the qualitative detection of five nucleic acid molecules. Take T1 as an example, the first step reaction: according to the method of experiment one, covalently bind to the magnetic beads coupled probe 2, take 10 μL of modified magnetic beads in 5 EP tubes, add corresponding encoding probe T1A to each EP tube, add reaction buffer to make the reaction system final volume of 200 μL, shake and mix, then react under the condition of metal shocker (35℃, 1200 rpm) for 2.5 h, after reaction, wash 3 times, and disperse in microsphere washing solution. The second step reaction: mix the optimized concentration of fluorescent probe 1, fluorescent probe 2 and encoding probe T1B, then anneal at 95℃ for 5 min, and then cool to room temperature naturally. Finally, mix the products of the first and second steps, add target DNA molecule T1 with a final concentration of 50 nM in each corresponding EP tube, and react in 200 μL buffer for 2.5 h. After reaction, wash the magnetic beads twice and disperse them in 200 μL buffer for flow measurement. Collect 3 x 10 3
[0076] When detecting five target DNA T1-T5 at the same time, first add 10 uL of modified magnetic beads coupled with probe 2 to five EP tubes, respectively, and react with T1A-T5A encoding probes for 2.5 h. Then mix the five tubes, wash, and add five annealed solutions (steps same as above). Finally, add five target DNA molecules with a final concentration of 50 nM, react in 1000 μL buffer for 2.5 h, wash the magnetic beads twice, disperse them in 200 μL buffer, and detect by flow cytometry. Collect 1 x 10 4
[0077] The experimental results are shown in Figure 7 Figure 7 (A) is the corresponding encoding magnetic bead two-dimensional scatter plot when five target DNA is detected separately. It can be seen that the five encoding point groups can be completely distinguished in the two-dimensional scatter plot and correspond to Figure 7 (B) the two-dimensional scatter plot of simultaneous detection has a slight shift, but does not affect the identification and distinction of five target DNA molecules. Therefore, the five nucleic acid detection scheme using this fluorescent encoding method is feasible.
[0078] In some embodiments of the present application, a nucleic acid-based FRET efficiency fluorescence microsphere coding technology is designed, 7 DNA coding probes, a fluorescence probe 1 (intermediate specific position labeled fluorescent group FAM), a fluorescence probe 2 (5' end labeled fluorescent group Cy3), 2 coupling probes (5' end modified amino), 5 target probes, and 5 corresponding coding probes and 5 capture probes are designed, a total of 26 DNA sequences. The main principle is that the fluorescence probe 1 and the coding probe sequence of different lengths are base complementary pairing, the distance between the two fluorescent groups is changed, different FRET efficiencies are achieved, different intensities of fluorescence are obtained, ratio coding is achieved, and finally flow cytometry is used for analysis. This kind of fluorescence coding method can be applied to DNA detection.
[0079] In some embodiments of the present application, the sequence of the coding probe is shown in Table 1.
[0080] Table 1
[0081]
[0082] Note: The above sequences are listed, but not limited to the above sequences. Here, 7 coding probes are selected as coding sequences (which can not be limited to 6 coding sequences), and the underlined part is the base sequence length between the fluorescence probe 1 and the fluorescence probe 2.
[0083] In some embodiments of the present application, the sequence of the target probe is shown in Table 2.
[0084] Table 2
[0085]
[0086]
[0087] Note: The above sequences are listed, but not limited to the above sequences. Here, 5 target probes are selected as target DNA molecule sequences, the underlined part is the sequence of the target and the coding probe in Table 3, and the non-underlined part is the sequence of the target and the capture probe in Table 3.
[0088] In some embodiments of the present application, the sequence of the application part of the coding probe is shown in Table 3.
[0089] Table 3
[0090]
[0091] Note: The above sequences are listed, but not limited to the above sequences. Here, 5 capture probes and 5 coding probes are selected to correspond to five target DNA molecules respectively.
[0092] In some embodiments of the present application, the sequence of the fluorescence probe is shown in Table 4.
[0093] Table 4
[0094]
[0095]
[0096] Note: The above sequences are listed, but not limited to the above sequences. Here, the number of bases of fluorescent probe 2 is selected as 15 as the appropriate number of bases for stable hybridization (not limited to 15 bases). The number of bases of fluorescent probe 1 is 15+30 (when two fluorescent groups are close to each other to a certain distance (1-10 nm), that is, (3-30 nt) marked fluorescent groups are not limited to the above listed two (FAM and Cy3).
[0097] The parts of the present application not described in detail can refer to the prior art or be the known technology of those skilled in the art, and the present embodiment is not limited thereto, and will not be described in detail here.
[0098] The embodiments of the present application are described above in combination with the drawings, but the present application is not limited to the above specific embodiments, and the above specific embodiments are only illustrative, but not limiting. Those skilled in the art can make many forms under the inspiration of the present application without departing from the purpose of the present application and the scope protected by the claims, which all belong to the protection of the present application.
Claims
1. A fluorescent microsphere encoding method based on the regulation of FRET efficiency of nucleic acid, characterized in that, The method combines DNA coding probes of different lengths and two fluorescent probes labeled with different fluorescent groups to the surface of magnetic beads by nucleic acid hybridization; and changes the FRET efficiency of the two fluorescent groups to achieve the change in the fluorescence intensity on the carboxyl magnetic beads.
2. The method of claim 1, wherein the nucleic acid-based fluorescent microsphere coding method is characterized by, The steps of the method include: S1, coupling the probe to the microspheres: coupling the first coupling probe to the surface of the carboxylated magnetic beads through a carboxyl-amino covalent reaction; S2, hybridization reaction: taking the coupled magnetic beads, adding the DNA coding probe, the first fluorescent probe and the second fluorescent probe, and avoiding light for a period of time, and then washing to obtain the coding microspheres; S3, decoding: detecting the fluorescence intensity of FAM and Cy3 by a flow cytometer, and realizing decoding according to the position difference of the microspheres in the two-dimensional scatter diagram.
3. The method of claim 1, wherein the nucleic acid-based FRET efficiency- regulated fluorescent microsphere encoding method is characterized by, The two fluorescent probes are fixed sequences; the first fluorescent probe is labeled with a fluorescent group FAM at a specific position in the middle, and the second fluorescent probe is labeled with a fluorescent group Cy3 at the 5' end.
4. The method of claim 1, wherein the nucleic acid-based FRET efficiency- regulated fluorescent microsphere encoding method is characterized by, The DNA coding probe is a programmable sequence, which can change the sequence length to adjust the FRET efficiency.
5. The method of claim 2, wherein the nucleic acid-based fluorescent microsphere coding method is characterized by, The 5' end of the first coupling probe is modified with an amino group.
6. The method of claim 2, wherein the nucleic acid-based fluorescent microsphere coding method is characterized by, The content of step S1 includes: The first coupling probe and the carboxyl magnetic beads are reacted by liquid reaction through a metal shaker, the supernatant is collected after the reaction, the magnetic beads are washed with MES solution, and finally the modified magnetic beads are dispersed in a certain amount of reaction buffer for standby.
7. The method of claim 2, wherein the nucleic acid-based fluorescent microsphere coding method is characterized by, The content of step S2 includes: The magnetic bead suspension modified with the first coupling probe is shaken uniformly, a certain amount of magnetic bead suspension is taken into a reaction tube, the coding probe, the first fluorescent probe and the second fluorescent probe are added in sequence, and finally the reaction buffer is added; then it is placed in a metal shaker for light-avoiding reaction for a period of time, the obtained coding magnetic beads are washed with the reaction buffer after the reaction, and then dispersed in the buffer for standby.
8. Use of the fluorescent microsphere coding method based on the regulation of FRET efficiency by nucleic acid according to any one of claims 1 to 7, characterized in that, It is applied to DNA detection; the DNA detection steps include: S11, capture probe fixation: modifying the magnetic beads with the second coupling probe, and reacting the coupling probe modified magnetic beads with the capture probe to fix the capture probe; the magnetic beads with the fixed capture probe are washed for standby; S12, annealing and hybridization: mixing the fluorescent probe and the coding probe, annealing for a period of time at a specific temperature, and naturally cooling; mixing the cooled mixed probes with the target probe and the magnetic beads with the fixed capture probe, adding the buffer for hybridization reaction for a period of time; washing the reacted magnetic beads for standby; S13, detection: analyzing the fluorescence signal by a flow cytometer, and distinguishing different target DNAs by the position of the scatter diagram.
9. The application of claim 8, wherein The final concentration of the coding probe and the target probe is 0.05 μM, and the final concentration of the fluorescent probe is greater than 0.05 μM.
10. The application of claim 8, wherein The washing liquid for washing the magnetic beads in steps S11 and S12 satisfies the conditions that the pH is 7.5 and the washing liquid contains Tween-20 surfactant.