Modified guide RNA

By chemically modifying the guide RNA, especially by introducing chemically modified nucleotides in the upper stem region and hairpin structure, the stability and targeting specificity issues of the guide RNA in the CRISPR-Cas9 system were resolved, resulting in more efficient gene editing.

CN121079412APending Publication Date: 2025-12-05BEAM THERAPEUTICS INC
View PDF 15 Cites 0 Cited by

Patent Information

Application Number
CN202480027660.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2023-04-28
Filing Date
2024-04-26
Publication Date
2025-12-05

AI Technical Summary

Technical Problem

Existing guide RNAs tend to form unnecessary secondary structures in the CRISPR-Cas9 system, leading to reduced stability and target specificity, and affecting the effectiveness of gene editing.

Method used

The modified guide RNA (gRNA) contains a long upper stem region and a hairpin structure. The structure is stabilized by chemically modifying nucleotides, which enhances the specificity of the target DNA.

Benefits of technology

It improves the accuracy and stability of genome editing, reduces off-target activity, and enhances the effect of gene modification, making it suitable for gene editing in various cell types.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121079412A_ABST
    Figure CN121079412A_ABST
Patent Text Reader

Abstract

The present invention relates to modified gRNA molecules, compositions and methods for site-specific gene editing and genome modification, such as DNA cleavage and gene activation or inhibition. In some embodiments, the modified guide RNAs have modified secondary structures (e.g., long upper stems and modified hairpin structures) that specifically target a target DNA sequence with reduced off-target activity.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Cross-Reference to Related Applications This application claims priority to U.S. Provisional Application No. 63 / 462,873, filed April 28, 2023, entitled “Modified guide RNA”; the contents of which are incorporated by reference in their entirety.

[0002] Cross-Reference to Sequence Listing The instant application is being filed along with an electronic submission of the sequence listing in XML format. The sequence listing file, entitled “BEM_020WO1 SL .xml” was created on April 26, 2024, and is 63,829 bytes in size; the information contained in the electronic format of the sequence listing is incorporated herein by reference in its entirety. BACKGROUND

[0003] The nuclease Cas9 is guided to specific DNA sequences (i.e., target sequences) for genetic modification by a small RNA molecule called a guide RNA (gRNA). CRISPR-Cas9 activity depends on the sequence and structure of the gRNA. A complete guide RNA comprises a tracrRNA (trRNA) and a crisprRNA (crRNA). The crRNA comprises a guide region that, when covalently or non-covalently associated with the trRNA, can form a complete gRNA. The trRNA and crRNA can be contained within a single guide RNA (sgRNA) or contained within two separate RNA molecules.

[0004] The guide RNA (single guide RNA (sgRNA) or as two separate crRNA and tracRNA molecules) forms common secondary structures, particularly in the scaffold sequence of the guide RNA. However, the formation of unwanted secondary structures within the guide RNA (gRNA) can inhibit the CRISPR-Cas9 system.

[0005] It would be useful to modify guide RNAs to increase their stability and on-target specificity. SUMMARY

[0006] The present application provides, inter alia, modified gRNA molecules, compositions, and methods for site-specific gene editing and genome modification, such as DNA cleavage, as well as gene activation or repression. The modified guide RNAs of the present invention have modified secondary structures (a long stem and modified hairpin structure). The modified guide RNAs provided herein result in a reduction of off-target activity while maintaining the ability to specifically target DNA sequences. For example

[0007] ​In one aspect, the present invention includes the use of modified single guide RNA (sgRNA) to enhance the effect in primary cells (e.g., In vitro culture This invention provides methods for treating diseases in subjects by correcting mutations in disease-related target genes through enhanced, precise genome editing (for use in ex vivo therapies) or in the cells of subjects (such as humans). The invention can be used with any cell type and at any locus suitable for nuclease-mediated genome editing techniques.

[0008] In one aspect, the present invention provides a modified guide RNA (gRNA) comprising a long (or extended) upper stem containing more than four base pairs formed by complementary nucleotides, wherein one or more or all nucleotides of the upper stem are chemically modified nucleotides. In some embodiments, the long (or extended) upper stem comprises four to eight base pairs formed by complementary nucleotides, wherein one or more or all nucleotides of the upper stem are modified nucleotides. In one embodiment, all nucleotides of the extended upper stem are chemically modified.

[0009] In some embodiments, the modified gRNA comprises a long upper stem region comprising 5 to 15 base pairs formed by complementary nucleotides. In one embodiment, the long upper stem region comprises 5 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 6 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 7 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 8 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 9 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 10 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 11 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 12 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 13 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 14 base pairs formed by complementary nucleotides. In one embodiment, the long upper stem region comprises 15 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 15 to 20 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 20 to 200 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 20 to 40, 40 to 80, 80 to 120, 120 to 160, or 160 to 200 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides).

[0010] In some embodiments, all of the nucleotides of the upper stem of the modified gRNA described herein are chemically modified nucleotides. In other embodiments, at least 80%, at least 85%, at least 90%, or at least 95% of the nucleotides of the upper stem of the modified gRNA are chemically modified nucleotides.

[0011] In some embodiments, the modified gRNA described herein further comprises one or more modified nucleotides within the hairpin 1 region and the hairpin 2 region. In some embodiments, all of the nucleotides within the hairpin 1 region and the hairpin 2 region are modified nucleotides. In other embodiments, at least 80%, at least 85%, at least 90%, or at least 95% of the nucleotides within the hairpin 1 region and the hairpin 2 region of the modified gRNA are modified nucleotides.

[0012] In some embodiments, the modified gRNA described herein further comprises a modified stable hairpin 1 region, wherein the modified stable hairpin 1 region comprises an extended stem region comprising more than 4 base pairs and wherein the loop of hairpin 1 comprises a locked nucleic acid. In some embodiments, the extended stem region of the modified stable hairpin comprises 8 base pairs.

[0013] In one embodiment, the present application provides a single guide RNA (sgRNA) comprising the sequence of GUUUUAGAN xn GAAA Ny n AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 23) wherein N xn and N yn have the same number of nucleotides and are complementary nucleotides to form base pairs, and wherein N xn and N yn are nucleotides that are backbone-modified nucleotides, and wherein n is an integer from 5 to 15. In some embodiments, GAAA is a GNRA tetraloop for locking the structure of a hairpin. Other GNRA tetraloops include, but are not limited to, GUGA, GCAA, GAGA, GUAA, GGGA, GCGA, and GGAA. In some embodiments, another RNA tetraloop UNCG is incorporated into the sgRNA to lock the structure of a hairpin. Exemplary UNCG tetraloops include, but are not limited to, UUCG, UACG, UCCG, and UGCG. In some embodiments, the 5' and 3' end nucleotides of the sgRNA are backbone-modified nucleotides. By way of non-limiting example, the sgRNA comprises the sequence of GUUUUAGAm(N xn )mGmAmAmA m(Nyn)AAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmUmU (SEQ ID NO: 24) wherein "m" denotes a 2'-OMe modification.

[0014] In some examples, Nxand Nycomprise 5 nucleotides, respectively, that are complementary nucleotides and form an upper stem region of the sgRNA, and wherein the sgRNA comprises the sequence of GUUUUAGAN x N x N x N x N x GAAAN y N yN y N y N y AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 2) of the sequence. In some examples, each of the Nxand Ny nucleotides is backbone modified. As a non-limiting example, the sgRNA comprises the sequence of GUUUUAGAmNxmNxmNxmNxmNxmGmAmAmAmNymNymNymNymNyAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmUmU (SEQ ID NO: 25), where “m” represents a 2’-OMe modification.

[0015] In some examples, Nxand Ny each comprise 6 nucleotides that are complementary nucleotides and form an upper stem region of the sgRNA, and wherein the sgRNA comprises GUUUUAGAN x N x N x N x N x N x GAAAN y N y N y N y N y N y AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 3) of the sequence. In some examples, each of the Nxand Ny nucleotides is backbone modified. As a non-limiting example, the sgRNA comprises the sequence of GUUUUAGAmN x mN x mN x mN x mN x mN x mGmAmAmAmN y mN y mN y mN y mN y mN ythe sequence of AAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmUmU (SEQ ID NO: 27), where "m" represents a 2'-OMe modification.

[0016] In some examples, Nxand Nycomprise 7 nucleotides, which are complementary nucleotides and form an upper stem region of the sgRNA, and wherein the sgRNA comprises GUUUUAGAN x N x N x N x N x N x N x GAAAN y N y N y N y N y N y N y the sequence of AAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmUmU (SEQ ID NO: 27), where "m" represents a 2'-OMe modification. x mN x mN x mN x mN x mN x mN x mGmAmAmAmN y mN y mN y mN y mN y mN y mN y the sequence of AAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmUmU (SEQ ID NO: 27), where "m" represents a 2'-OMe modification.

[0017] In some examples, Nxand Nycomprise 8 nucleotides, which are complementary nucleotides and form an upper stem region of the sgRNA, and wherein the sgRNA comprises GUUUUAGAN xN x N x N x N x N x N x N x GAAAN y N y N y N y N y N y N y N y AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 5) of the sequence. In some examples, each of the Nxand Ny nucleotides is backbone modified. As non-limiting examples, the sgRNA comprises GUUUUAGAmN x mN x mN x mN x mN x mN x mN x mN x mGmAmAmAmN y mN y mN y mN y mN y mN y mN y mN y AAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCUmUmUmU (SEQ ID NO: 28) of the sequence, wherein “m” represents a 2’-OMe modification.

[0018] In some examples, Nxand Ny each comprise 9 nucleotides that are complementary nucleotides and form an upper stem region of the sgRNA, and wherein the sgRNA comprises GUUUUAGAN x N x N x N x N x N x N x N x N x GAAAN y N y N y N y Ny N y N y N y N y AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 6). In some examples, each of the Nxand Ny nucleotides is backbone modified. As non-limiting examples, the sgRNA comprises the sequence of GUUUUAGAmN x mN x mN x mN x mN x mN x mN x mN x mN x mGmAmAmAmN y mN y mN y mN y mN y mN y mN y mN y mN y AAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmUmU (SEQ ID NO: 29), where "m" represents a 2'-OMe modification.

[0019] In some examples, Nxand Ny each comprise 10 nucleotides that are complementary nucleotides and form an upper stem region of the sgRNA, and wherein the sgRNA comprises the sequence of GUUUUAGAN x N x N x N x N x N x N x N x N x N x GAAAN y N y N y N y N y N y N y N y N y N yAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 7). In some examples, each of the Nxand Ny nucleotides is backbone modified. As non-limiting examples, the sgRNA comprises GUUUUAGAmN x mN x mN x mN x mN x mN x mN x mN x mN x mN x mGmAmAmAmN y mN y mN y mN y mN y mN y mN y mN y mN y mN y AAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmUmU (SEQ ID NO: 30), wherein "m" represents a 2'-OMe modification.

[0020] In one embodiment, the present application provides an sgRNA comprising the sequence of GUUUUAGAGCGCGGAAACGCGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 8). In one embodiment, the present application provides an sgRNA comprising the sequence of GUUUUAGAmGmCmGmCmGmGmAmAmAmCmGmCmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmUmU (SEQ ID NO: 31), wherein "m" represents a 2'-OMe modification.

[0021] In another embodiment, the sgRNA of the application comprises the sequence of GUUUUAGAGCCGGCGGAAACGCCGGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 9). In another embodiment, the sgRNA of the application comprises the sequence of GUUUUAGAmGmCmCmGmGmCmGmGmAmAmAmCmGmCmCmGmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmUmU (SEQ ID NO: 32), wherein "m" represents a 2'-OMe modification.

[0022] In some embodiments, one or more nucleotides within the hairpin 1 region and the hairpin 2 region of the sgRNAs described herein are modified nucleotides. In other embodiments, all of the nucleotides within the hairpin 1 region and the hairpin 2 region of the sgRNAs described herein are modified nucleotides. In some embodiments, the loop of hairpin 1 of the sgRNAs described herein comprises 2'-O-methyl modified nucleotides (e.g., 2'-O-methyl 3'-thiophosphonate (MS) nucleotides, 2'-O-methyl 3'-thioPACE (MSP) nucleotides), 2'-F modified nucleotides, locked nucleic acids, MOE (methoxyethyl), DNA nucleotides functionalized for conjugation, and combinations thereof.

[0023] In some embodiments, the application provides a single guide RNA (sgRNA) comprising GUUUUAGAN xn GAAAN yn AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGACUUUGGUCCAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 10), wherein N xn and N yn have the same number of nucleotides and are complementary nucleotides to form base pairs, and wherein N xn and N yn are modified nucleotides and wherein n is an integer from 5 to 15, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, and 15. In some embodiments, the nucleotides of N xn and N yn are 2'-O-methyl modified nucleotides. In one example, the sgRNA comprises GUUUUAGAm(Nxn ) the sequence of AAGUUAAAAUAAGGCUAGUCCGUUAUCmAmAmCmUmUmGmGmAmCmUmUmUmGmGmUmCmCmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmUmU (SEQ ID NO: 34), where "m" represents a 2'-0-methyl modification.

[0024] In some examples, the Nxand Nycomprise 5 nucleotides, which are complementary nucleotides and form an upper stem region of the sgRNA, and wherein the sgRNA comprises GUUUUAGAN x N x N x N x N x GAAAN y N y N y N y N y AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGACUUUGGUCCAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 11). In some embodiments, each of the Nxand Ny nucleotides is modified. As non-limiting examples, the sgRNA comprises GUUUUAGAmN x mN x mN x mN x mN x mGmAmAmAmN y mN y mN y mN y mN y AAGUUAAAAUAAGGCUAGUCCGUUAUCmAmAmCmUmUmGmGmAmCmUmUmUmGmGmUmCmCmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmUmU (SEQ ID NO: 34), where "m" represents a 2'-0-methyl modification.

[0025] In some examples, the Nxand Nycomprise 6 nucleotides, which are complementary nucleotides and form an upper stem region of the sgRNA, and wherein the sgRNA comprises GUUUUAGAN x N x N x Nx N x N x GAAAN y N y N y N y N y N y AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGACUUUGGUCCAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO.12) of the sequence. In some embodiments, each of the Nxand Ny nucleotides is backbone modified. As non-limiting examples, the sgRNA comprises GUUUUAGAmN x mN x mN x mN x mN x mN x mGmAmAmAmN y mN y mN y mN y mN y mN y AAGUUAAAAUAAGGCUAGUCCGUUAUCmAmAmCmUmUmGmGmAmCmUmUmUmGmGmUmCmCmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmUmU (SEQ ID NO: 35) of the sequence, wherein “m” represents a 2’-OMe modification.

[0026] In some examples, the Nxand Ny comprise 7 nucleotides, respectively, which are complementary nucleotides and form an upper stem region of the sgRNA, and wherein the sgRNA comprises GUUUUAGAN x N x N x N x N x N x N x GAAAN y N y N y N y N y N y N ythe sequence of AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGACUUUGGUCCAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 13). In some embodiments, each of the Nxand Ny nucleotides is backbone modified. As non-limiting examples, the sgRNA comprises GUUUUAGAmN x mN x mN x mN x mN x mN x mN x mGmAmAmAmN y mN y mN y mN y mN y mN y mN y the sequence of AAGUUAAAAUAAGGCUAGUCCGUUAUCmAmAmCmUmUmGmGmAmCmUmUmUmGmGmUmCmCmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmUmU (SEQ ID NO: 36), where “m” represents a 2’-OMe modification.

[0027] In some examples, the Nxand Ny comprise 8 nucleotides, which are complementary nucleotides and form an upper stem region of an sgRNA, where the sgRNA comprises GUUUUAGAN x N x N x N x N x N x N x N x GAAAN y N y N y N y N y N y N y N y the sequence of AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGACUUUGGUCCAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 14). In some embodiments, each of the Nxand Ny nucleotides is backbone modified. As non-limiting examples, the sgRNA comprises GUUUUAGAmN x mN x mNx mN x mN x mN x mN x mN x mGmAmAmAmN y mN y mN y mN y mN y mN y mN y mN y AAGUUAAAAUAAGGCUAGUCCGUUAUCmAmAmCmUmUmGmGmAmCmUmUmUmGmGmUmCmCmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmUmU (SEQ ID NO: 37) of the sequence, wherein "m" represents a 2'-OMe modification.

[0028] In some examples, the Nxand Nycomprise 9 nucleotides, which are complementary nucleotides and form an upper stem region of the sgRNA, and wherein the sgRNA comprises GUUUUAGAN x N x N x N x N x N x N x N x N x GAAAN y N y N y N y N y N y N y N y N y AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGACUUUGGUCCAAGUGGCACCGAGUCGGUGCUUUU (SEQ IDNO: 15) of the sequence. In some embodiments, each of the Nxand Ny nucleotides is modified by a backbone modification. As non-limiting examples, the sgRNA comprises GUUUUAGAmN x mN x mN x mN x mN x mN x mN x mN x mN x mGmAmAmAmNy mN y mN y mN y mN y mN y mN y mN y mN y AAGUUAAAAUAAGGCUAGUCCGUUAUCmAmAmCmUmUmGmGmAmCmUmUmUmGmGmUmCmCmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmUmU (SEQ ID NO: 38) of the sequence, wherein "m" represents a 2'-OMe modification.

[0029] In some examples, the Nxand Nycomprise 10 nucleotides, which are complementary nucleotides and form an upper stem region of the sgRNA, and wherein the sgRNA comprises GUUUUAGAN x N x N x N x N x N x N x N x N x N x GAAAN y N y N y N y N y N y N y N y N y N y AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGACUUUGGUCCAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 16). In some embodiments, each of the Nxand Ny nucleotides is modified by a backbone modification. As non-limiting examples, the sgRNA comprises GUUUUAGAmN x mN x mN x mN x mN x mN x mN x mN x mN x mN x mGmAmAmAmN y mN y mN y mNy mN y mN y mN y mN y mN y AAGUUAAAAUAAGGCUAGUCCGUUAUCmAmmN y AmCmUmUmGmGmAmCmUmUmUmGmGmUmCmCmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmUmU (SEQ ID NO: 39) of the sequence, wherein "m" represents a 2'-OMe modification.

[0030] In one embodiment, the sgRNA described herein comprises the sequence of GUUUUAGAGCCGGCGGAAACGCCGGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGACUUUGGUCCAAGUUUUU (SEQ ID NO: 17). In some embodiments, the sgRNA comprises a backbone-modified nucleotide. As a non-limiting example, the sgRNA comprises GUUUUAGAmGmCmCmGmGmCmGmGmAmAmAmCmGmCmCmGmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCmAmAmCmUmUmGmGmAmCmUmUmUmGmGmUmCmCmAmAmGmUmUmUmUmU (SEQ ID NO: 40) (m = 2'-OMe modification).

[0031] In some embodiments, the present application provides a single guide RNA (sgRNA) comprising the sequence of GUUUUAGAN xn GAAAN yn AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGACN z N z N z N z GUCCAAGUGGCACCGAGUCGGUGCUUUU(SEQ ID NO: 41) of the sequence, wherein N xn and N yn have the same number of nucleotides and are complementary nucleotides to form base pairs, and wherein N xn and N yn the nucleotides of N and N are modified nucleotides and wherein n is an integer from 5 to 15, and wherein the 4 nucleotides (N z N z N z Nz ) a sequence comprising UUCG, CUUG, or GCAA.

[0032] In some embodiments, the sgRNAs comprising a longer upper stem and a stabilized hairpin include one or more modified nucleotides within the hairpin 1 region and the hairpin 2 region. In other examples, the sgRNAs comprising a longer upper stem and a stabilized hairpin include modified nucleotides within the hairpin 1 region and the hairpin 2 region. The modifications include 2'-O-methyl modified nucleotides (e.g., 2'-O-methyl 3'-thiophosphonate (MS) nucleotides, 2'-O-methyl 3'-thioPACE (MSP) nucleotides), 2'-F modified nucleotides, and combinations thereof.

[0033] In one example, the at least one modification comprises a 2'-O' methyl (2'-O-Me) modified nucleotide.

[0034] In some embodiments, the loop of hairpin 1 comprises a locked nucleic acid.

[0035] In some embodiments, the gRNAs described herein further comprise a spacer sequence at the 5''' end of the sgRNA; the spacer sequence comprises a sequence that is complementary to a target sequence of interest. In some embodiments, the spacer sequence comprises about 18 to 25, or 18 to 30, or 20 to 25, 20 to 30, 15 to 50, 20 to 50, or 20 to 40 nucleotides. As non-limiting examples, the spacer sequence comprises 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, or 50 nucleotides.

[0036] In some embodiments, the 3' end of the sgRNAs described herein is modified.

[0037] In some embodiments, the 5' end of the sgRNAs described herein is modified.

[0038] In some embodiments, the 3' and 5' ends of the sgRNAs described herein are modified.

[0039] In some embodiments, at least the first three nucleotides at the 5' end of the sgRNAs described herein are modified nucleotides.

[0040] In one embodiment, the sgRNAs described herein comprise a modification at the 5' end of the sequence and a modification at the 3' end of the sequence.

[0041] In some embodiments, about 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 75%, 80%, 90%, or 100% of the nucleotides of the sgRNAs described herein are modified nucleotides.

[0042] In one example, the gRNA described herein comprises a sequence as set forth in SEQ ID NO: 20. In one example, the gRNA described herein comprises a sequence as set forth in SEQ ID NO: 21. In one example, the gRNA described herein comprises a sequence as set forth in SEQ ID NO: 51. In one example, the gRNA described herein comprises a sequence as set forth in SEQ ID NO: 52.

[0043] In some embodiments, the sgRNA described herein further comprises a nuclear localization sequence (NLS).

[0044] In some embodiments, the sgRNA described herein comprises about 102 to 150 nucleotides, about 102 to 120 nucleotides, or about 100 to 180 nucleotides.

[0045] In some embodiments, the sgRNA of the present application increases gene modification efficacy by about 2 to 1000 fold, or about 2 to 100 fold, or about 2 to 10 fold. As non-limiting examples, the sgRNA described herein increases gene modification efficacy by about 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 550, 600, 650, 700, 750, 800, 900, or 1000 fold.

[0046] In another aspect of the present application, provided is a gene modification system comprising (a) a CRISPR-associated protein (Cas) polypeptide or a variant thereof; and (b) a single guide RNA (sgRNA) described herein.

[0047] In some embodiments, the Cas polypeptide is a Cas9 protein, including but not limited to Streptococcus pyogenes Cas9 and Pyogenic Streptococcus Cas9.

[0048] In some embodiments, the Cas9 polypeptide is a nickase or a dCas9.

[0049] In some embodiments, provided is also a composition comprising a single guide RNA described herein. The composition can further comprise a Cas9 polypeptide or a variant thereof. In some examples, the Cas polypeptide is a Cas9 protein, a dCas9, or a nickase.

[0050] In some embodiments, the composition described herein is formulated in a lipid nanoparticle.

[0051] In another aspect, the present application provides a method for modifying a target gene in a cell, the method comprising introducing into the cell a gene editing system comprising a single guide RNA (sgRNA) of the present application.

[0052] In some embodiments, the method comprises introducing into the cell a modified single guide RNA (sgRNA) comprising a first nucleotide sequence complementary to a target nucleic acid and a second nucleotide sequence that interacts with a CRISPR-associated protein (Cas) polypeptide, wherein one or more nucleotides in the first nucleotide sequence and / or the second nucleotide sequence are modified nucleotides; and a Cas polypeptide, an mRNA encoding the Cas polypeptide, and / or a recombinant expression vector comprising a nucleotide sequence encoding the Cas polypeptide. BRIEF DESCRIPTION OF DRAWINGS

[0053] Figure 1A Exemplary end-modified sgRNAs, standard heavy modification of sgRNAs, and hairpin structure of LONGEST gRNA design including 5 base pairs in the upper stem of the gRNA are shown. Chemically modified sgRNAs (end-modification and heavy modification) include only 4 base pairs in the upper stem.

[0054] Figure 1B Exemplary ALAS1 targeted editing in the liver is shown, demonstrating that editing potency decreases when the hairpin of the gRNA is extended without nucleotide modification. Editing potency increases when the extension is combined with nucleotide modification. gRNA 9 includes an extended upper stem (LONGEST 1) that does not include internal modification in the upper stem of the extended hairpin. sgRNA 10 includes another extended upper stem (LONGEST 2) that does not include internal modification in the upper stem of the extended hairpin. sgRNA 3 is LONGEST 1 including 2’OMe modified nucleotides (sequence shown as SEQ ID NO: 51). ALAS1 editing was performed with base editor ABE8.8.

[0055] Figure 2A Hairpin structure of ALAS1 targeting gRNAs with end modification (gRNA 1), or standard heavy modification (gRNA 2), or LONGEST 1 with nucleotide modification (gRNA 3) is shown.

[0056] Figure 2B ALAS1 targeting gRNA editing potency in Lipid 1 at different doses is shown.

[0057] Figure 2C ALAS1 targeting gRNA editing potency in Lipid 2 at different doses is shown.

[0058] Figure 3A Hairpin structures of gRNAs with end modification (EM), LONGEST modification, GOLD modification, or LONGEST_GOLD combination modification are shown.

[0059] Figure 3B Hairpin structures of different gRNA modifications at three different target sites (TSBTx3228, TSBTx3215, and TSBTx3222) are shown. In vitro Editing potency.

[0060] Figure 4A Hairpin structures of gRNA 4 (standard end modification), gRNA 5 (GOLD modification), and gRNA 6 (LONGEST-GOLD modification) are shown.

[0061] Figure 4B Editing potency of gRNA 4, gRNA 5, and gRNA 6 after 5 days is shown.

[0062] Figure 5 Editing potency of the following three new hairpin extensions in ALAS1 targeting gRNAs: LONGEST 3, LONGEST 4, and unmodified LONGEST 4, as compared to the same gRNAs with standard severe modification (severe modification), end modification, or LONGEST modification is shown. DETAILED DESCRIPTION

[0063] Definitions To facilitate a better understanding of the present application, certain terms are defined below. Additional definitions for the following terms and other terms are set forth throughout this specification.

[0064] The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to one or That is , at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.

[0065] As used herein, the term "about" or "approximately," when applied to one or more of a purpose value, means a value similar to the stated reference value. In certain embodiments, the term "about" or "approximately" means falling within 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less in either direction (greater than or less than) of the stated reference value, unless otherwise stated or otherwise clear from the context (unless such number would exceed 100% of a possible value).

[0066] For recitations of numerical ranges including endpoints, each intervening value between the recited minimum and maximum values is expressly contemplated. For example, for the range 6 to 9, it is contemplated that the numbers 7 and 8 are included in addition to the numbers 6 and 9; and for the range 6.0 to 7.0, it is contemplated that the numbers 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are included.

[0067] As used herein, the term "comprising" when used in defining products, compositions and methods, is intended to mean that the products, compositions and methods include the recited components or steps, but do not exclude other components or steps. As used herein, the terms "comprising", "including", "containing", "having" "may" and "including" and variants thereof, are intended to be open-ended transitional phrases, terms or words that do not preclude the possibility of additional acts or structures. The term "consisting essentially of shall mean excluding any other components or steps essential to the basic and novel use of the compositions. Thus, a composition consisting essentially of the recited components does not exclude trace contaminants and pharmaceutically acceptable carriers. "Consisting of shall mean excluding any components or steps other than those recited.

[0068] Administration As used herein, the term "administering" includes oral administration, topical contact, administration as a suppository, intravenous, intraperitoneal, intramuscular, intralesional, intrathecal, intranasal, or subcutaneous administration to a subject. Administration is by any route, including parenteral and transmucosal administration (e.g., buccal, sublingual, palatine, gingival, nasal, vaginal, rectal, or transdermal administration). Parenteral administration includes, for example, intravenous, intramuscular, intraarterial, intradermal, subcutaneous, intraperitoneal, intraventricular, and intracranial administration. Other modes of delivery include, but are not limited to, the use of liposomal formulations, intravenous infusion, transdermal patches, and the like.

[0069] Binding region As used herein, the term "binding region" refers to a region within a nuclease target region that is recognized and bound by a nuclease, such as Cas9.

[0070] ComplementaryAs used herein, the term “complementary” refers to the ability of a nucleic acid to form one or more hydrogen bonds with another nucleic acid sequence by traditional Watson-Crick or other non-traditional types. The percent complementarity indicates the percent of residues in a nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5 of 10, 6 of 10, 7 of 10, 8 of 10, 9 of 10, 10 of 10 are 50%, 60%, 70%, 80%, 90%, and 100% complementary). “Perfectly complementary” refers to all consecutive residues of a nucleic acid sequence will hydrogen bond with the same number of consecutive residues in a second nucleic acid sequence. As used herein, “substantially complementary” refers to a degree of complementarity of at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, or more nucleotides; or refers to two nucleic acids that hybridize under stringent conditions.

[0071] Effective amount As used herein, the term “effective amount” refers to the amount of an agent (e.g., a Cas nuclease, a modified single guide RNA, etc.) that is sufficient to achieve a beneficial or intended result. A therapeutically effective amount can vary depending on one or more of the following: the subject and disease condition being treated, the subject’s body mass and age, the severity of the disease condition, the manner of administration, and the like, as can be readily determined by one of ordinary skill in the art. The specific amount can vary depending on one or more of the following: the particular agent selected, the target cell type, the location of the target cell in the subject, the dosing regimen followed, whether it is administered in combination with other agents, the timing of administration, and the physical delivery system it is carried on.

[0072] Efficiency As used herein, the term “efficiency” refers to the editing efficiency or percent editing; i.e., the ratio of the total number of sequence reads that insert or delete nucleotides in the target region of interest to the total number of sequence reads that are cleaved by the gene editing system of the disclosure.

[0073] Genome As used herein, the term “genome” refers to the complete set of genes or genetic material present in a cell or organism. Genomes include RNA in DNA or RNA viruses. Genomes include genes (coding regions), non-coding DNA, and the genomes of mitochondria and chloroplasts.

[0074] Genome editingAs used herein, the term "genome editing" refers to altering a gene. Genome editing can include correcting or repairing a mutated gene. Genome editing can include knocking out a gene, such as a mutated gene or a normal gene. Genome editing can treat a disease or enhance muscle repair by altering a gene of interest.

[0075] Guide RNA or gRNA As used herein, the terms "guide RNA" and "gRNA" are used interchangeably. "Guide RNA," "gRNA," "single gRNA," and "sgRNA" as used interchangeably herein refer to a short synthetic RNA composed of a "scaffold" sequence necessary for Cas9 binding or Cpfl binding and a user-defined "spacer" or "targeting sequence" (also referred to herein as a protospacer-targeting sequence or segment) that defines the genomic target to be modified. "Modified gRNA" as used herein refers to a gRNA with additional nucleotides or nucleotide modifications.

[0076] Hybridization As used herein, "hybridization" means the pairing or annealing of complementary oligonucleotides and / or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding between complementary nucleobases, which can be Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonding.

[0077] crRNA As used herein, the term "crRNA" refers to a RNA sequence comprising a sequence that is complementary to and recognizes a target nucleic acid sequence, and a tracrRNA recognition sequence that binds or is capable of binding to a tracrRNA. The tracRNA recognition portion of the crRNA can bind to the tracrRNA via hybridization or covalent attachment.

[0078] tracRNA As used herein, the term "tracrRNA" means a nucleic acid sequence that can non- covalently bind to a Cas9 protein and can bind to a crRNA sequence via hybridization or covalent attachment. In some embodiments, the tracrRNA and crRNA sequences can form a single guide RNA.

[0079] Hairpin: As used herein, the term "hairpin" describes a duplex of nucleic acid that results when a strand of nucleic acid is folded and forms base pairs with another portion of the same strand. A hairpin can form a structure that includes a loop or a U-shape. In some embodiments, a hairpin can consist of an RNA loop. A hairpin can be formed by two complementary sequences in a single nucleic acid molecule coming together in the context of folding or crumpling of the molecule. In some embodiments, a hairpin comprises a stem or a stem-loop structure. In the context of the modified gRNAs described herein, "hairpin region" refers to hairpin 1 and hairpin 2 from the 5' end to the 3' end of the gRNA. The conserved portion of the gRNA is between hairpin 1 and hairpin 2 of the gRNA.

[0080] Stem loop : As used herein, "stem loop" describes a secondary structure of nucleotides that form a "stem" of base pairs, the ends of which are in a loop of unpaired nucleic acid. A stem can be formed when two regions of the same nucleic acid strand are at least partially complementary in sequence when read in opposite directions.

[0081] Loop : As used herein, the term "loop" describes a region of nucleotides that are not base pairs (i.e., not complementary) that can overlie a stem. For example, "four loop" describes a loop of 4 nucleotides. In some embodiments, the upper stem of the modified gRNA can comprise a four loop. In some embodiments, GAAA is a GNRA four loop used to lock the hairpin structure. In some embodiments, the four loop is ANYA, CUYG, GNRA, UNAC, or UNCG.

[0082] Pharmaceutically acceptable carrier : The term "pharmaceutically acceptable carrier" refers to a substance that helps to administer a pharmaceutical agent (e.g., a Cas nuclease, a modified single guide RNA, etc.) to a cell, organism, or subject. A "pharmaceutically acceptable carrier" refers to a carrier or excipient that can be included in a composition or formulation and that does not cause a significant adverse toxicological effect to the patient. Non-limiting examples of pharmaceutically acceptable carriers include water, NaCl, physiological saline solutions, lactated Ringer's solution, standard sucrose, standard dextrose, binders, fillers, disintegrants, lubricants, coating agents, sweeteners, flavorings, and colorants, etc. Those of skill in the art will recognize that other pharmaceutical excipients are useful in the present application.

[0083] Modified or modification : As used herein, the term "modified" or "modification" refers to various modifications in the context of guide RNA, such as 2'-O-methyl modified nucleotides (e.g., 2'-O-methyl 3'-thiophosphate (MS) nucleotides, 2'-O-methyl 3'-thioPACE (MSP) nucleotides), 2'-F modified nucleotides, locked nucleic acids, MOE (methoxyethyl), DNA nucleotides functionalized for conjugation, and combinations thereof.

[0084] Nucleic acid As used herein, the term "nucleic acid" or "oligonucleotide" or "polynucleotide" as used herein means at least two nucleotides covalently linked together. The description of a single strand also defines the sequence of the complementary strand. Thus, a nucleic acid also includes the complementary strand of a described single strand. Many variants of a nucleic acid can serve the same purpose as a given nucleic acid. Thus, a nucleic acid also includes substantially identical nucleic acids and their complements. A single strand provides a probe that can hybridize to a target sequence under stringent hybridization conditions. Thus, a nucleic acid also includes a probe that hybridizes under stringent hybridization conditions. A nucleic acid can be single-stranded or double-stranded, or can contain portions of both double-stranded and single-stranded sequences. A nucleic acid can be DNA (both genomic and cDNA), RNA, or a hybrid, where the nucleic acid can contain combinations of deoxyribo- and ribo-nucleotides, as well as combinations of bases, including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine, hypoxanthine, isocytosine, and isoguanine. A nucleic acid can be produced by chemical synthesis methods or recombinant methods.

[0085] On-target site As used herein, the term "on-target site" refers to a target region or sequence in the genome that a gRNA is intended to target. Ideally, the on-target site has perfect homology (100% identity or homology) to the target DNA sequence and has no homology to other locations in the genome.

[0086] Off-target site As used herein, the term "off-target site" refers to a region in the genome that has partial homology or partial identity to the on-target site or target region of a gRNA, but the gRNA is not intended or designed to target.

[0087] Subject The terms "subject," "patient," and "individual" are used interchangeably herein and include humans or animals. For example, an animal subject can be a mammal, a primate (e.g., a monkey), a livestock animal (e.g., a horse, a cow, a sheep, a pig, or a goat), a companion animal (e.g., a dog, a cat), a laboratory test animal (e.g., a mouse, a rat, a guinea pig, a bird), a veterinary important animal, or an economically important animal.

[0088] Treatment As used herein, the term "treatment" refers to an approach for obtaining beneficial or desired results, including but not limited to therapeutic benefit and / or prophylactic benefit. By therapeutic benefit is meant any therapeutically relevant improvement or effect on one or more diseases, conditions, or symptoms in therapy. For prophylactic benefit, a composition can be administered to a subject at risk of developing a particular disease, condition, or symptom, or to a subject reporting one or more of the physiological symptoms of a disease, even though the disease, condition, or symptom can not yet be present.

[0089] Modified guide RNA (gRNA) Provided herein are modified guide RNAs (gRNAs) for use in gene editing methods. According to the present disclosure, the modified gRNAs provided herein comprise a long or extended upper stem. The modified guide RNAs provided herein can comprise an extended upper stem and a stabilized padlock hairpin structure. In some aspects, the modified guide RNAs provided herein are single guide RNAs (sgRNAs). The modified sgRNAs of the present disclosure are more stable and show improved efficacy in gene editing compared to unmodified sgRNAs.

[0090] Long / extended upper stem In one aspect, the modified gRNAs provided herein are modified single guide RNAs (sgRNAs) comprising a long (or extended) upper stem comprising more than 4 base pairs formed by complementary nucleotides, wherein one or more nucleotides of the upper stem are chemically modified. Exemplary modifications include 2'OMe modifications, such as 2'-O-methyl (M) nucleotides, 2'-O-methyl 3'-phosphorothioate (MS) nucleotides, 2'-O-methyl 3'-thioPACE (MSP) nucleotides, or combinations thereof.

[0091] In some embodiments, the modified sgRNAs described herein comprise a long upper stem region comprising 5 to 15 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 5 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 6 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 7 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 8 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 9 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 10 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 11 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 12 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 13 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 14 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 15 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides).

[0092] In some embodiments, all of the nucleotides of the upper stem of the modified sgRNAs described herein are chemically modified nucleotides. In other embodiments, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of the nucleotides of the upper stem of the modified sgRNAs are chemically modified nucleotides.

[0093] In some embodiments, the sgRNAs described herein comprise an upper stem modification, wherein the upper stem modification comprises a modification to any one or more nucleotides in the upper stem region.

[0094] In some embodiments, the sgRNAs comprise an upper stem modification, wherein the upper stem modification comprises a modification to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in the upper stem region.

[0095] In some embodiments, the gRNA comprises an upper stem modification, wherein the upper stem modification comprises a modification of about 1 to 4, 1 to 5, 1 to 6, 1 to 7, 1 to 8, 1 to 9, 1 to 10, 1 to 12, 1 to 14, 1 to 16, 2 to 4, 2 to 6, 2 to 8, 2 to 10, 2 to 12, 2 to 16, 2 to 18, 2 to 20, 4 to 8, 4 to 10, 6 to 12, 6 to 18, 6 to 20, 8 to 10, 8 to 18, 8 to 20, or 10 to 20 nucleotides in the upper stem region.

[0096] In some embodiments, the modified nucleotides within the upper stem region of the sgRNA comprise the same chemical modification. In other embodiments, the modified nucleotides within the upper stem region of the sgRNA comprise different chemical modifications.

[0097] In some embodiments, the sgRNA comprises an upper stem modification, wherein the upper stem modification comprises a 2’-OMe modified nucleotide. In some embodiments, the upper stem modification comprises a 2’-O-MOE modified nucleotide. In some embodiments, the upper stem modification comprises a 2’-F modified nucleotide. In some embodiments, the upper stem modification comprises a 2’-Ome modified nucleotide, a 2’-O-MOE modified nucleotide, a 2’-F modified nucleotide, and / or combinations thereof.

[0098] Stabilizing hairpin In some embodiments, the sgRNAs described herein are further modified to comprise a highly stable hairpin structure. The modified sgRNAs described herein further comprise one or more modified nucleotides within the hairpin 1 region and the hairpin 2 region. In some embodiments, all of the nucleotides within the hairpin 1 region and the hairpin 2 region are modified nucleotides. In other embodiments, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the nucleotides within the hairpin 1 region and the hairpin 2 region of the modified sgRNA are chemically modified nucleotides. In some embodiments, all of the nucleotides within the hairpin 1 and the hairpin 2 are chemically modified.

[0099] In some embodiments, the modified sgRNAs described herein further comprise a modified stable hairpin 1 region, wherein the modified stable hairpin 1 region comprises an extended stem region comprising more than 4 base pairs and wherein the loop of the hairpin 1 comprises a locked nucleic acid. In some embodiments, the extended stem region of the modified stable hairpin comprises 8 base pairs. In some embodiments, the extended stem region of the modified stable hairpin comprises 8 base pairs formed by chemically modified nucleotides. As a non-limiting example, all of the nucleotides of the hairpin comprise a 2’-O-methyl modification.

[0100] A highly stable hairpin of an sgRNA is a "locked" hairpin. A locked hairpin comprises a locked backbone, for example, by incorporation of one or more locked nucleic acids. As used herein, the term "locked nucleic acid" refers to a bicyclic RNA analog in which the ribose is locked in the C3'-endo conformation by the introduction of a 2'-0,4'-C methylene bridge. Ideal LNA monomers and methods of their synthesis are also disclosed in U.S. Patent Nos. 6,043,060, 6,268,490, PCT publications WO 01 / 07455, WO 01 / 00641, WO 98 / 39352, WO 00 / 56746, WO 00 / 56748, and WO 00 / 66604, as well as in the following articles: Morita et al., Bioorg. Med. Chem. Lett. 12(1):73-76, 2002; Hakansson et al., Bioorg. Med. Chem. Lett. 11(7):935-938, 2001; Koshkin et al., J. Org. Chem. 66(25):8504-8512, 2001; Kvaerno et al., J. Org. Chem. 66(16):5498-5503, 2001; Hakansson et al., J. Org. Chem. 65(17):5161-5166, 2000; Kvaerno et al., J. Org. Chem. 65(17):5167-5176, 2000; Pfundheller et al., Nucleosides Nucleotides 18(9):2017-2030, 1999; and Kumar et al., Bioorg. Med. Chem. Lett. 8(16):2219-2222, 1998.

[0101] In some examples, the hairpin region comprises a locked nucleic acid or LNA, which contains a 2'-0,4'-C-methylene-ribo-nucleoside (Structure A) in which the ribose sugar moiety is in the "locked" conformation. The hairpin region comprises at least one 2',4'-C-bridged 2' deoxyribonucleoside (CDNA, Structure B). See, e.g., U.S. Patent No. 6,403,566 and Wang et al. (1999) Bioorganic and Medicinal Chemistry Letters, Vol. 9: 1147-1150, both of which are incorporated by reference herein in their entireties. Locked nucleic acids (LNAs™) are a class of high affinity RNA analogs in which the ribose ring is "locked" in the ideal conformation for Watson-Crick binding. When hybridized to a complementary DNA or RNA strand, LNA™ oligonucleotides exhibit high thermal stability. In addition, LNA™ oligonucleotides can be shorter than traditional DNA or RNA oligonucleotides and still maintain a high Tm. LNA™ oligonucleotides can consist of a mixture of LNAs™ and DNA or RNA. Incorporation of LNAs™ into oligonucleotides has been shown to improve the sensitivity and specificity of many hybridization-based techniques, including PCR, microarrays, and in situ hybridization.

[0102] J. Org. Chem In some embodiments, the modified gRNA further comprises one or more chemically modified nucleotides. In some embodiments, such modified nucleotides comprise a modified sugar moiety or a modified nucleobase or both a modified sugar moiety and a modified nucleobase.

[0103] In some embodiments, the modified sgRNA comprises one or more modified nucleosides comprising a modified sugar moiety. Such modified sgRNAs comprising one or more sugar-modified nucleosides can have desirable properties, such as increased nuclease stability or increased binding affinity to a target nucleic acid relative to a guide RNA lacking such sugar-modified nucleosides. In certain embodiments, the modified sugar moiety is a linearly modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic sugar moiety or a tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar surrogate. Such sugar surrogates can comprise one or more substitutions corresponding to substitutions of the modified sugar moiety.

[0104] In certain embodiments, the modified sugar moiety is a linearly modified sugar moiety comprising a furanosyl ring having one or more acyclic substituents, including but not limited to substituents at the 2' and / or 5' position. Examples of 2'-substituent groups suitable for linearly modified sugar moieties include, but are not limited to: 2'-F, 2'-OCH3("Ome" or "O-methyl"), and 2'-O(CH2)2OCH3("MOE"). In certain embodiments, the 2'-substituent group is selected from the group consisting of: halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O—C1-C 10 alkoxy, O—C1-C 10 substituted alkoxy, O—C1-C 10 alkyl, O—C1-C 10 substituted alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkalkenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ), or OCH2C(=O)—N(R m )(R n ), wherein each R m and R n is independently H, an amino protecting group, or a substituted or unsubstituted C1-C 10 alkyl. Certain embodiments of these 2'-substituent groups can be further substituted with one or more substituent groups independently selected from the group consisting of: hydroxyl, amino, alkoxy, carboxyl, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. Examples of 5'-substituent groups suitable for linearly modified sugar moieties include, but are not limited to: 5'-methyl (R or S), 5'-vinyl, and 5'-methoxy. In certain embodiments, the linearly modified sugar comprises more than one non-bridging sugar substituent, for example, a 2'-F-5'-methyl sugar moiety (for additional 2',5'-disubstituted sugar moieties and nucleosides, see, e.g., PCT International Application WO 2008 / 101157).

[0105] In certain embodiments, the 2’-substituted nucleoside or 2’-linearly modified nucleoside comprises a sugar moiety comprising a linear 2’-substitution group selected from F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamide (OCH2C(=0)—N(R m )(R n ), wherein each R m and R n is independently H, an amino protecting group, or substituted or unsubstituted C1-C 10 alkyl.

[0106] In certain embodiments, the 2’-substituted nucleoside or 2’-linearly modified nucleoside comprises a sugar moiety comprising a linear 2’-substitution group selected from F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2) 20 N(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=0)—N(H)CH3 (“NMA”).

[0107] In certain embodiments, the 2’-substituted nucleoside or 2’-linearly modified nucleoside comprises a sugar moiety comprising a linear 2’-substitution group selected from F, OCH3, and OCH2CH2OCH3.

[0108] Certain modified sugar moieties contain bridging sugar substituents that form a second ring, thereby forming a bicyclic sugar moiety. In some such embodiments, the bicyclic sugar moieties contain a bridge between a 4' furanose ring atom and a 2' furanose ring atom. Examples of such 4' to 2' bridging sugar substituents include, but are not limited to: 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2—O-2' (“LNA”), 4'-CH2—S-2', and 4'-(CH2)2—O-2'. (“ENA”), 4'-CH(CH3)-O-2' (when in the S configuration, referred to as “restricted ethyl” or “cEt”), 4'-CH2-O-CH2-2', 4'-CH2-NI-2', 4'-CH(CH2OCH3)-O-2' (“restricted MOE” or “cMOE”) and their analogues (see, for example, U.S. Patent No. 7,399,845), 4'-C(CH3)(CH3)-O-2' and their analogues (see, for example, WO2009 / 006478), 4'-CH2-N(OCH3)-2' and their analogues (see, for example, WO2008 / 150729), 4'-CH2-O-N(CH3)-2' (see, for example, US2004 / 0171570), 4'-CH2-C(H)(CH3)-2' (see, for example, Chattopadhyaya, et al.), Carbohydrate Modifications in Antisense Research ., 2009, 74, 118-134), 4'-CH2—C(═CH2)-2' and its analogues (see published PCT international application WO 2008 / 154401), 4'-C(R a R b I(R)—O-2'、4'-C(R a R I O—N(R)-2', 4IH2—O—N(R)-2', I 4'-CH2—N(R)—O-2', where each R, R a and R b Independently H, protecting group or C1-C 12 Alkyl (see, for example, U.S. Patent No. 7,427,672).

[0109] In some embodiments, such 4' to 2' bridges independently comprise 1 to 4 linked groups independently selected from: — [C(R a (R) b )] n —、—[C(R a (R) b )] n —O—、—C(R a )═C(R b )—、—C(Ra )═N—, —C(=NR a )—, —C(=O)—, —C(=S)—, —O—, —Si(R a )2—, —S(=O) x — and —N(R a )—; wherein X is 0, 1 or 2, and n is 1, 2, 3 or 4.

[0110] In some embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, LNA nucleosides (described above) can be in the alpha-L configuration or in the beta-D configuration. In other embodiments, the modified sugar moiety is a sugar surrogate. In certain such embodiments, an oxygen atom of the sugar moiety is replaced by, for example, a sulfur, carbon or nitrogen atom. In certain such embodiments, such modified sugar moieties further comprise bridging and / or non-bridging substituents as described above. For example, certain sugar surrogates comprise a 4'-sulfur atom and a 2' position (see, e.g., US 2005 / 0130923) and / or a 5' position substitution.

[0111] In some embodiments, the modification of the sugar group can be a modification at the 2' position of the ribose sugar group. In some cases, the modification at the 2' position of the ribose sugar group is selected from the group consisting of 2'-O-methyl, 2'-fluoro, 2'-deoxy, and 2'-O-(2-methoxyethyl).

[0112] In one embodiment, one or more modifications in the modified gRNa comprise a 2'OMe modification, such as a 2'-O-methyl (M) nucleotide, a 2'-O-methyl 3'-phosphorothioate (MS) nucleotide, a 2'-O-methyl 3'-thioPACE (MSP) nucleotide, or a combination thereof.

[0113] In some embodiments, the modified sgRNA comprises one or more nucleosides comprising a modified nucleobase. In certain embodiments, the modified sgRNA comprises one or more nucleosides that do not comprise a nucleobase, referred to as abasic nucleosides.

[0114] In some embodiments, the modified nucleobase is selected from the group consisting of: 5-substituted pyrimidine, 6-azapyrimidine, alkyl- or alkynyl-substituted pyrimidine, alkyl-substituted purine, and N-2, N-6, and O-6 substituted purine. In certain embodiments, the modified nucleobase is selected from the group consisting of: 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2- aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2- thiouracil and 2-thiocytosine, 5-propynyl (— C≡C— CH3) uracil, 5-propynylcytosine, 6- azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8- halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza, and other 8-substituted purines, 5- halo (particularly 5-bromo), 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7- methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7- deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N- benzoyluracil, universal base, hydrophobic base, wobble base, size-expanded base, and fluorinated base. Additional modified nucleobases include tricyclic pyrimidines such as 1,3- diazaphenoxazin-2-one, 1,3-diazaphenothiazin-2-one, and 9-(2-aminoethoxy)-1,3- diazaphenoxazin-2-one (G-clamp). Modified nucleobases can also include nucleobases in which the purine or pyrimidine base is replaced with other heterocycles (e.g., 7-deazaadenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone).

[0115] In some embodiments, the nucleosides of the modified sgRNAs described herein can be linked together using any internucleoside linkage. Two major classes of internucleoside linkage groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphorothioates (also referred to as unmodified or naturally occurring linkages) containing phosphodiester (“P=0”), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates (“P=S”), and phosphorodithioates (“HS-P=S”). Representative non-phosphorus-containing internucleoside linkage groups include, but are not limited to, methylenemethylimino (—CH2—N(CH3)—O—CH2—), thiodiester (—O—C(=0)—S—), thiocarbamates (—0—C(=0)(NH)—S—); siloxane (—0—SiH2—0—); and N,N'-dimethylhydrazine (—CH2—N(CH3)—N(CH3)—). Modified internucleoside linkages can be used to alter, typically increase, the nuclease resistance of an oligonucleotide compared to naturally occurring phosphodiester linkages. In certain embodiments, internucleoside linkages having chiral atoms can be prepared as racemic mixtures, or as individual enantiomers. Representative chiral internucleoside linkages include, but are not limited to, alkylphosphonates and phosphorothioates. Methods of preparing phosphorus-containing and non-phosphorus-containing internucleoside linkages are well known to those skilled in the art.

[0116] Neutral internucleoside linkages include, but are not limited to, phosphotriesters, methylphosphonates, MMI (3'-CH2—N(CH3)—0-5'), Amide-3 (3'-CH2—C(=0)—N(H)-5'), Amide-4 (3'-CH2—N(H)—C(=0)-5'), methylformacetal (3'-0—CH2—0-5'), methoxypropyl, and thioformacetal (3'-S—CH2—0-5'). Additional neutral internucleoside linkages include nonionic linkages including siloxane (dialkylsiloxane), carboxylate, formamide, sulfide, sulfonate, and amide (see, e.g., Exemplary gRNA sequences ; Y. S. Sanghvi and P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Additional neutral internucleoside linkages include nonionic linkages including mixed N, O, S, and CH2moieties.

[0117] In some embodiments, one or more of the chemical modifications in the phosphate group can be a phosphorothioate modification.

[0118] In some embodiments, the modified sgRNA comprises one modified nucleotide at (e.g., the terminal nucleotide at) or near the 5' end of the modified gRNA nucleotide sequence (e.g., within 1, 2, 3, 4, or 5 nucleotides of the terminal nucleotide at the 5' end) and / or one modified nucleotide at (e.g., the terminal nucleotide at) or near the 3' end of the modified gRNA nucleotide sequence (e.g., within 1, 2, 3, 4, or 5 nucleotides of the terminal nucleotide at the 3' end).

[0119] In some embodiments, the modified sgRNA comprises two consecutive or non-consecutive modified nucleotides starting at (e.g., the terminal nucleotide at) or near the 5' end of the modified gRNA nucleotide sequence (e.g., within 1, 2, 3, 4, or 5 nucleotides of the terminal nucleotide at the 5' end) and / or two consecutive or non-consecutive modified nucleotides starting at (e.g., the terminal nucleotide at) or near the 3' end of the modified gRNA nucleotide sequence (e.g., within 1, 2, 3, 4, or 5 nucleotides of the terminal nucleotide at the 3' end).

[0120] Other regions and modifications In some embodiments, the modified gRNA comprises a modified nucleotide at the 5' end. In some embodiments, the 5' end of the sgRNA comprises a spacer or guide region, which functions to direct a Cas protein (e.g., a Cas9 protein) to a target nucleotide sequence. In some embodiments, the 5' end does not comprise a guide region. In some embodiments, the 5' end comprises a spacer and additional nucleotides that do not have the function of directing a Cas protein to a target nucleotide region.

[0121] The sgRNA has a 3' end, which is the last nucleotide of the sgRNA. The 3' end region includes the last 1 to 7 nucleotides of the 3' end. In some embodiments, the 3' end is the end of hairpin 2. In some embodiments, the sgRNA comprises one or more nucleotides after the one or more hairpin regions. In some embodiments, the sgRNA includes a 3' tail region, in which case the last nucleotide of the 3' tail is the 3' end. In some embodiments, the 3' tail comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 or more nucleotides, e.g., nucleotides that are not involved in the secondary structure of the hairpin. In some embodiments, the 3' tail region comprises 1, 2, 3, or 4 nucleotides that are not involved in the secondary structure of the hairpin. In some embodiments, the 3' tail region comprises 4 nucleotides that are not involved in the secondary structure of the hairpin. In some embodiments, the 3' tail region comprises 1, 2, or 3 nucleotides that are not involved in the secondary structure of the hairpin.

[0122] In some embodiments, the modified gRNA further comprises a targeting nucleic acid sequence that is complementary to a target nucleic acid sequence. The complementary sequence is about 20 nucleotides in length. In some embodiments, at least two, three, four, five, six, seven, eight, nine, ten, or more nucleotides in the complementary nucleotide sequence are modified nucleotides. In some cases, about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in the complementary nucleotide sequence (e.g., the first nucleotide sequence that is about 20 nucleotides in length) are modified nucleotides. In other cases, all of the nucleotides in the complementary nucleotide sequence (e.g., the complementary nucleotide sequence that is about 20 nucleotides in length) are modified nucleotides. In some cases, the modified nucleotides are at the 5’ end (e.g., the terminal nucleotide at the 5’ end) or near the 5’ end (e.g., within 1, 2, 3, 4, or 5 nucleotides of the terminal nucleotide at the 5’ end) and / or at an internal position of the complementary nucleotide sequence. In other cases, about 10% to about 30% of the nucleotides in the first nucleotide sequence are modified nucleotides.

[0123] Synthesis of modified guide RNA In some embodiments, the present disclosure provides LONGEST gRNAs. Table 1 includes some exemplary LONGEST gRNAs with chemical modifications.

[0124] Table 1. Exemplary LONGEST designs with chemically modified nucleotides

[0125] N = nucleotide; mN = 2’-OMe modified nucleotide; Ns = phosphorothioate nucleotide Table 2: Exemplary guide RNA sequences

[0126] N = nucleotide; mN = 2’-OMe modified nucleotide; Ns = phosphorothioate nucleotide Gene editing system Also described by the present disclosure are methods for synthesizing the modified gRNAs described herein. In some embodiments, a first RNA sequence that is a trans-activating RNA (tracrRNA) and a second RNA sequence comprising a Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) RNA (crRNA) comprising a sequence that is complementary to a target sequence are provided for synthesizing a modified sgRNA as described herein.

[0127] In some embodiments, the first RNA sequence and the second RNA sequence are ligated together. The ligation strategies described herein are different from previously reported chemical ligation strategies for synthesizing synthetic RNAs, including guide RNAs. An advantage of using the segmented synthesis method of the present application is that short segments of RNA can be produced with higher purity after purification compared to full-length gRNAs. In this approach, the 5' acceptor is the smallest RNA fragment (about 30-50 nts), and thus can be purified to a high level before ligation. The 3' donor is terminated with a phosphate ester as required for synthesis, and thus only the full-length fragment will be incorporated into the full-length product (i.e., truncations are not substrates).

[0128] In some embodiments, the modified gRNA of the present application is synthesized using a self-template method. The method for synthesizing the modified gRNA includes providing a first RNA sequence and a second RNA sequence having complementarity, wherein the complementarity allows for base pairing and creates a stem loop between the first RNA and the second RNA; ligating the first RNA and the second RNA within the stem loop with a ligase, thus producing the modified gRNA. This allows the use of the helix or other structure formed between the first RNA and the second RNA to template the enzymatic ligation of the two RNAs. In some embodiments, the length and sequence composition of the structure formed between the first RNA and the second RNA is modified to facilitate non-covalent assembly and create optimal ligation sites for enzymes compatible with RNA ligation.

[0129] The complementarity between the nucleotide stretches of the first and second RNA sequences can be partial or complete. The complementarity allows for base pairing between the complementary nucleotides. In regions where there is partial complementarity, mismatched nucleotides will result in the formation of a bulge or loop structure between the first RNA sequence and the second RNA sequence. Various structures of the modified gRNA can be formed between the first RNA sequence and the second RNA sequence based on the hybridization between the two RNA sequences, such as a longest upper stem, a stem loop, a lower stem, a hairpin, an overhang, a blunt end, or a bulge.

[0130] Various ligases can be used with the methods described herein. For example, one or more of T4 RNA ligase 1, T4 RNA ligase 2, RtcB ligase, thermostable 5' App DNA / RNA ligase, ElectroLigase, T4 DNA ligase, T3 DNA ligase, T7 DNA ligase, Taq DNA ligase, SplintR ligase, E. coli DNA ligase, 9°N DNA ligase, CircLigase, CircLigase II, DNA ligase I, DNA ligase III, and DNA ligase IV can be used. In some embodiments, T4 RNA ligase 1 is used to ligate the first RNA and the second RNA at the terminal loop. In some embodiments, T4 RNA ligase 2 is used to ligate the first RNA sequence and the second RNA sequence within the stem formed between the first RNA sequence and the second RNA sequence.

[0131] Various ligations can be performed using this method, such as a ligation within the terminal loop of a hairpin formed between the first RNA sequence and the second RNA sequence. Various ligases are suitable for ligation at the terminal loop of a hairpin formed, such as T4 RNA ligase 1. Another ligation that can be achieved with this method is a ligation within a duplex formed between the first RNA and the second RNA. Various ligases are suitable for ligation at a duplex formed between two RNAs, such as T4 RNA ligase 2 and DNA ligase.

[0132] In some embodiments, the modified gRNAs of the present disclosure can be synthesized using a splinted template method. In some embodiments, a splinted strand is used in the production of the synthesized RNA. Using a splinted strand allows one or more RNA molecules to be in close physical proximity to react using the splinted strand as a template. The use of a splint facilitates the production of a synthesized RNA, such as a modified sgRNA described herein, when more than two RNAs are to be ligated. In some embodiments, the splint can be any suitable polymer that is capable of bringing one or more RNA molecules in close proximity that can be used. For example, in some embodiments, the splinted strand is an RNA molecule or a DNA molecule.

[0133] In some embodiments, the splinted strand has complementarity to segments of the first and second RNAs. The complementarity can be partial or complete. Accordingly, in some embodiments, there is provided a method of producing a modified gRNA, the method comprising providing a first RNA comprising a 5' phosphate; providing a second RNA comprising a free 3'-hydroxyl; providing an oligonucleotide having partial complementarity to the first and second RNAs, wherein the complementarity of the oligonucleotide allows for base pairing to the first and second RNAs; and providing a ligase to catalyze a linkage between the first and second RNAs, thus producing the gRNA.

[0134] In some embodiments, a non-template method is used to produce the modified sgRNAs described herein. In some embodiments of the non-template method, a first RNA is provided having a 5' phosphate (such as a 5' monophosphate), and a second RNA is provided that includes a blocked 3' end (such as a blocked 3' OH). The purpose of blocking the 3' OH of the second RNA is to prevent the second RNA from being able to circularize by non-template mechanisms when ligation occurs. For example, using this non-template method can include a second RNA that includes a chemically blocked or removed 3' hydroxyl at the 3' end of the donor molecule (e.g., a dideoxynucleotide), and an enzyme (particularly by T4 RNA ligase 1) will catalyze the proper linkage between the first and second RNAs. In some embodiments, this ligation strategy is performed at high concentrations.

[0135] In some aspects, a non-template method of producing a synthetic RNA comprises: providing a first RNA comprising a 5'-monophosphate; providing a second RNA comprising a blocked 3' end; and providing a ligase to catalyze a linkage between the first and second RNAs, thus producing a modified sgRNA described herein.

[0136] Formulations and compositions According to the present disclosure, there is provided a gene editing system comprising one or more modified sgRNAs described herein. In some embodiments, the system comprises a CRISPR-Cas9 nuclease or a variant thereof.

[0137] Various Cas9 nuclease variants, whether naturally occurring or genetically engineered, can be included in the pre-set gene editing system.

[0138] In some embodiments, the present disclosure provides a gene editing system comprising one or more modified sgRNAs described herein and a CRISPR-Cas9 nuclease or a variant thereof.

[0139] In some embodiments, the present application provides a gene editing system comprising one or modified sgRNAs described herein and a base editor. The base editor can comprise an adenosine deaminase domain or a cytidine deaminase domain. For example, the one or more modified guide RNAs target a base editor to effect an A»T to G*C change in a target polynucleotide (e.g., a target gene). In one embodiment, the base editor is a fusion protein comprising one or more domains having base editing activity.

[0140] In another embodiment, a protein domain having base editing activity is linked to a guide RNA (e.g., by an RNA binding motif on the guide RNA and an RNA binding domain fused to the deaminase). In some embodiments, the domain having base editing activity is capable of deaminating a base within a nucleic acid molecule. In some embodiments, the base editor is capable of deaminating one or more bases within a DNA molecule. In some embodiments, the base editor is capable of deaminating a cytosine (C) or an adenosine (A) within DNA. In some embodiments, the base editor is capable of deaminating a cytosine (C) and an adenosine (A) within DNA. In some embodiments, the base editor is a cytidine base editor (CBE). In some embodiments, the base editor is an adenosine base editor (ABE). In some embodiments, the base editor is an adenosine base editor (ABE) or a variant thereof. For example, the ABE includes, but is not limited to, ABE8.8, editor variant ABEV1 (pNMG-B2000 (ABE8.20 w / F149Y “v1”) + S82T), or ABEV2 (pNMG-B2001 (ABE8.20 w / Y147D, F149Y, T166I, D167N “v2”) + S82T). In some embodiments, the base editor is a cytidine base editor (CBE). In some embodiments, the base editor is a nuclease inactive Cas9 (dCas9) fused to an adenosine deaminase. In some cases, the base editor can be fused to a base excision repair inhibitor (e.g., a UGI domain or a dISN domain). In other embodiments, the base editor is a baseless base editor.

[0141] Detailed descriptions of base editors can be found in PCT Patent Application Publications WO 2018 / 027078, WO 2017 / 070632, WO 2022 / 204268, and WO 2023 / 114953; the contents of each of which are incorporated herein by reference for all purposes.

[0142] Methods of use The modified sgRNAs and gene editing systems of the present disclosure can be formulated in a carrier for delivery and administration. In some embodiments, the pharmaceutical formulation comprises a lipid nanoparticle (LNP). In some embodiments, the pharmaceutical formulation comprises at least one modified gRNA of the present disclosure. In another embodiment, the pharmaceutical formulation comprises at least one modified gRNA and a Cas9 protein, a polynucleotide encoding a Cas9 protein, or an mRNA encoding a Cas9 protein.

[0143] Lipid nanoparticles (LNPs) are a well-known means of delivering nucleotide and protein cargo, and can be used to deliver the gRNAs, gene editing systems, compositions, or pharmaceutical formulations disclosed herein. In some embodiments, the LNP delivers a nucleic acid, a protein, or a nucleic acid together with a protein. Accordingly, the present disclosure provides a method for delivering any of the gRNAs, gene editing systems, compositions, or pharmaceutical formulations disclosed herein to a subject, wherein the gRNA is associated with an LNP. In some embodiments, the gRNA / LNP is further associated with a Cas9 or an mRNA encoding a Cas9. In some embodiments, the gRNA / LNP is further associated with a base editor or an mRNA encoding a base editor.

[0144] In some embodiments, the present invention includes a composition comprising any of the disclosed gRNAs and an LNP. In some embodiments, the composition further comprises a Cas9 protein or a variant thereof, or an mRNA encoding a Cas9 protein or a variant thereof.

[0145] In some embodiments, the LNP comprises one or more cationic lipids, one or more helper lipids, one or more PEGylated lipids, and one or more cholesterol- derived lipids.

[0146] In some embodiments, a composition comprising a modified gRNA, gene editing system described herein is provided. In some embodiments, the composition is a pharmaceutical composition. In some embodiments, the pharmaceutical composition comprises one or more modified sgRNAs described herein.

[0147] Compositions comprising any of the gRNAs and / or gene editing systems described herein, and carriers, excipients, diluents, and the like.

[0148] In some embodiments, the modified gRNAs, gene editing systems, compositions, and formulations disclosed herein are used in the preparation of a medicament for treating a disease or disorder.

[0149] In vitro The present disclosure further provides a modified gRNA described herein for In vitro altering a genome of a target nucleic acid (e.g.,In vivo other uses of cells cultured for ex vivo therapy or genetic editing) or for use in cells in a subject (such as a human) (e.g., for therapy). In vitro

[0150] In some embodiments, the application includes a method or use of modifying a target nucleic acid molecule comprising administering or delivering any one or more of the gRNA gene editing system compositions or pharmaceutical formulations described herein.

[0151] In some embodiments, the application includes a method or use for modulating a target gene comprising administering or delivering any one or more of the gRNAs, gene editing systems, compositions, or pharmaceutical formulations described herein. In some embodiments, the modulation is editing the target gene. In some embodiments, the modulation is a change in expression of a protein encoded by the target gene.

[0152] In some embodiments, the method or use results in gene editing. In some embodiments, the method or use results in a double-stranded break within the target gene. In some embodiments, the method or use results in an insertion or deletion of nucleotides in the target gene. In some embodiments, the insertion or deletion of nucleotides in the target gene results in a frameshift mutation or a premature stop codon, resulting in a non-functional protein. In some embodiments, the insertion or deletion of nucleotides in the target gene results in a knockdown or elimination of expression of the target gene. In some embodiments, the method or use further comprises delivering a template to the cell, wherein at least a portion of the template is incorporated into the target DNA at or near the site of the double-stranded break induced by the nuclease. In some embodiments, the method or use results in a substitution. In some embodiments, the gene modulation is an increase or decrease in gene expression, a change in methylation state of the DNA, or a modification of a histone subunit. In some embodiments, the method or use results in an increased or decreased expression of a protein encoded by the target gene.

[0153] The efficacy of a gRNA and / or gene editing system can be tested in In vivo and In vitro some embodiments. In some embodiments, the application comprises one or more of the gRNAs, gene editing systems, compositions, or pharmaceutical formulations described herein, wherein the gRNA results in gene modulation when the gRNA is provided to a cell with a Cas9 or a mRNA encoding a Cas9. In some embodiments, the efficacy of a gRNA can be measured in In vivo or In vivo some embodiments.

[0154] In some embodiments, the efficiency of a gRNA in increasing or decreasing expression of a target protein is determined by measuring the amount of the target protein.

[0155] ​In some embodiments, the efficiency of editing using a particular gRNA is determined by the presence of edits at the target location in the genome after delivery of the Cas9 and gRNA. In some embodiments, the efficiency of editing using a particular gRNA is measured by next generation sequencing. In some embodiments, the percent editing of a target region of interest is determined. In some embodiments, the ratio of the total number of sequence reads of an insertion or deletion of a nucleotide in the target region of interest to the total number of sequence reads is measured after delivery of a modified gRNA and / or a system or composition comprising a modified gRNA.

[0156] In some embodiments, the activity of a modified gRNA is measured after administration of an LNP comprising the modified gRNA. In vivo

[0157] In some embodiments, the efficacy of a gRNA or composition provided herein is determined by measuring editing efficacy in DNA extracted from tissue (e.g., liver tissue) after administration of the gRNA. Methods of therapeutic use

[0158] In some embodiments, a method for modulating a target nucleic acid sequence in a cell comprises contacting the cell with a composition comprising a modified sgRNA described herein.

[0159] Example 1: Editing potency of modified gRNA In some embodiments, any one or more of the gRNAs, gene editing systems, compositions, or pharmaceutical formulations described herein are used in the preparation of a medicament for treating or preventing a disease or disorder in a subject.

[0160] In some embodiments, the present disclosure includes a method of treating or preventing a disease or disorder in a subject, the method comprising administering any one or more of the gRNAs, gene editing systems, compositions, or pharmaceutical formulations described herein.

[0161] ​​In some embodiments, the gRNAs, gene editing systems, and compositions increase editing efficiency at the targeted site. In some embodiments, the editing efficiency is increased by about 10% to 100% compared to a gRNA without the modification. In some embodiments, the editing efficiency is increased by 2 to 1000-fold compared to a gRNA without the modification. In some embodiments, the sgRNAs of the present disclosure increase gene modification efficiency by about 2 to 1000-fold, or about 2 to 100-fold, or about 2 to 50-fold, or about 10 to 50-fold, or about 10 to 20-fold or about 2 to 10-fold, or about 2 to 5-fold, or about 3 to 8-fold, or about 2 to 5-fold. As non-limiting examples, the sgRNAs described herein increase gene modification efficiency by about 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 550, 600, 650, 700, 750, 800, 900, or 1000-fold.

[0162] Kit In another aspect of the disclosure, a kit comprising one or more gRNAs, compositions, or pharmaceutical formulations described herein is provided. In some embodiments, the kit further comprises one or more of a solvent, a solution, a buffer (each separate from the composition or pharmaceutical formulation), an instruction, or a desiccant.

[0163] Example The following example illustrates certain embodiments of the present disclosure and is not limiting.

[0164] In vivo In this example, the ALAS1 (δ-aminolevulinic acid synthase 1) gene site was used to assess the impact of different hairpin designs on editing efficiency of the guide RNA.

[0165] As in Figure 1A Liver editing measured as in Figure 2A ), editing efficiency decreased when the hairpin was extended without modification. However, editing efficiency increased when the hairpin was extended with modification, i.e., all nucleotides were heavily modified.

[0166] The following three different gRNAs targeting ALAS1 were synthesized: gRNA1 (terminal modification), gRNA2 (standard heavy modification), and gRNA3 (heavily modified LONGEST hairpin design) Figure 2B ). In Lipid 1 Figure 2C ) and Lipid 2 In vitroThe editing potency of each gRNA in the liver was measured in the study. It was found that gRNA3 with the LONGEST design has 2 to 5-fold higher potency on ALAS1 at sub-saturating doses (8% editing at 0.005 mpk) compared to gRNA2 designed with the standard heavy modification. The targeting sequence for ALAS1 used in this study was: CAGGATCCGCACAGACTCCAGGG (SEQ ID NO: 59) and the protospacer sequence was: CAGGAUCCGCACAGACUCCA (SEQ ID NO: 60).

[0167] Table 3: Examples of gRNA designs used in the study

[0168] N = nucleotide; mN = 2’-OMe modified nucleotide; Ns = phosphorothioate nucleotide The terminally modified gRNA is the standard design of gRNAs used in the prior art (Hendel, Ayal, et al. Nature biotechnology 33.9 (2015): 3289-3290). A standard heavy modified gRNA without the extension of the upper stem region was also used for comparison (Finn, Jonathan D., et al. Cell reports 22.9 (2018): 2227-2235). Both the terminally modified and the heavy modified gRNA have a length of 100 nucleotides. In the LONGEST1 design, the hairpin is extended with an additional 3 base pairs compared to the terminally modified gRNA. The unmodified LONGEST1 has the same sequence as LONGEST1 (SEQ ID NO: 51) but is not internally 2’OMe modified. It has a length of 106 nt.

[0169] Riesenberg et al. (Riesenberg et al., Improved gRNA secondary structures allow editing of target sites resistant to CRISPR-Cas9 cleavage. Nature Communications 13.1 (2022): 1-8) recently reported that engineered gRNAs with “locked” hairpins can improve the stability of engineered gRNAs and their editing potency. LONGEST hairpins and Riesenberg’s GOLDS (Genome Editing Locking Design) hairpins were compared. Editing potency of each gRNA design (regular end modification (EM), LONGEST, GOLDS, and a combination of LONGEST and GOLDS) was measured at three different target sites (TSBTx3288, TSBTx3215, and TSBTx3222) at 5 days, see Figure 3A Figure 3A Bolded nucleotides in each design indicate nucleotides that were modified in the backbone. Figure 3B Figure 3A It was shown that both LONGEST and GOLDS designs outperformed gRNAs with end modification (EM) shown in Figure 4A A ~7-fold increase was observed for GOLDS design compared to end modification design. A ~3-fold increase was observed for LONGEST design compared to end modification design.

[0170] gRNAs with both LONGEST and GOLDS designs were synthesized (LONGEST-GOLD), and their editing potency was evaluated (gRNA 6 in Figure 4B GOLD-LONGEST and GOLDS designs were evaluated with three different adenine base editors (ABEs) (ABE8.8, ABE9V1, and ABE9V2). As used herein, ABEV1 is editor variant pNMG-B2000 (ABE8.20 w / F149Y “v1”) + S82T. ABEV2 is editor variant pNMG-B2001 (ABE8.20 w / Y147D, F149Y, T166I, D167N “v2”) + S82T.

[0171] Editing efficacy at 5 days indicates that hairpin extensions increase overall editing of gRNAs under saturating conditions Example 2: New extended design .

[0172] Figure 5 ​​​This study further tested different hairpin extensions in the gRNA. Three new hairpin extensions with lower GC content than the LONGEST modification improved the stability of the hairpin. The sequences and modifications of the three gRNA designs are shown in Table 4. LONGEST 3 has 3 additional base pairs with full modification with upper stem loop. LONGEST 4 has 5 additional base pairs with full modification. Unmodified LONGEST 4 has the same extension as LONGEST 4 but is not modified.

[0173] Table 4

[0174] The in vivo editing potency of the three new hairpin designs compared to the standard heavy modification and end-modification design and the LONGEST design targeting ALAS1 was tested using the base editor ABE8.8. The results show that LONGEST 4 shows higher potency compared to the standard heavy modification and end-modification design ( ​ ). Unmodified LONGEST 4 shows lower potency, which indicates that just the extension is enough and modification is needed to improve the potency. Similar results were also observed in the LONGEST design.

[0175] Equivalents and scope Those of skill in the art would recognize or be able to ascertain using no more than routine experimentation many equivalents to the specific embodiments of the application described herein. The scope of the present application is not intended to be limited to the above description but is only limited as indicated in the following claims:

Claims

1. A single guide RNA (sgRNA) comprising a long (or extended) upper stem comprising more than 4 base pairs formed by complementary nucleotides, wherein one or more nucleotides of the upper stem are modified nucleotides.

2. The sgRNA of claim 1, wherein the long upper stem region comprises 5 to 15 base pairs formed by complementary nucleotides.

3. The sgRNA of claim 2, wherein the long upper stem region comprises 5 base pairs formed by complementary nucleotides.

4. The sgRNA of claim 2, wherein the long upper stem region comprises 6 base pairs formed by complementary nucleotides.

5. The sgRNA of claim 2, wherein the long upper stem region comprises 7 base pairs formed by complementary nucleotides.

6. The sgRNA of claim 2, wherein the long upper stem region comprises 8 base pairs formed by complementary nucleotides.

7. The sgRNA of claim 2, wherein the long upper stem region comprises 9 base pairs formed by complementary nucleotides.

8. The sgRNA of claim 2, wherein the long upper stem region comprises 10 base pairs formed by complementary nucleotides.

9. The sgRNA of any one of the preceding claims, wherein all of the nucleotides of the upper stem are modified nucleotides.

10. The sgRNA of any one of the preceding claims, wherein one or more nucleotides within the hairpin 1 region and the hairpin 2 region are modified nucleotides.

11. The sgRNA of claim 10, wherein all of the nucleotides within the hairpin 1 region and the hairpin 2 region are modified nucleotides.

12. The sgRNA of any one of the preceding claims, wherein the sgRNA further comprises a modified stabilizing hairpin 1 region.

13. The sgRNA of claim 12, wherein the modified stabilizing hairpin 1 region comprises an extended stem region comprising more than 4 base pairs and wherein the loop of hairpin 1 comprises a locked nucleic acid.

14. A guide RNA comprising an extended upper stem comprising more than 4 base pairs formed by complementary nucleotides, wherein the nucleotides within the upper stem comprise a 2'-0 methyl modification.

15. A single guide RNA (sgRNA) comprising GUUUUAGA N xn GAAA Ny n AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO. 1), Where N xn and N yn They have the same number of nucleotides and are complementary nucleotides to form base pairs, and where N xn and N yn The nucleotides are modified nucleotides, and n is an integer from 5 to 15.

16. The sgRNA of claim 15, wherein the Nx and Ny comprise 5 nucleotides each, which are complementary nucleotides and form the upper stem region of the sgRNA, and wherein the sgRNA comprises the sequence of GUUUUAGAN x N x N x N x N x GAAAN y N y N y N y N y AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 2).

17. The sgRNA of claim 15, wherein the Nxand Nycomprise 6 nucleotides each, which are complementary nucleotides and form the upper stem region of the sgRNA, and wherein the sgRNA comprises the sequence of GUUUUAGAN x N x N x N x N x N x GAAAN y N y N y N y N y N y AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 3).

18. The sgRNA of claim 15, wherein the Nxand Nycomprise 7 nucleotides each, which are complementary nucleotides and form the upper stem region of the sgRNA, and wherein the sgRNA comprises the sequence of GUUUUAGAN x N x N x N x N x N x N x GAAAN y N y N y N y N y N y N y AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO:4).

19. The sgRNA of claim 15, wherein the Nxand Nycomprise 8 nucleotides each, which are complementary nucleotides and form the upper stem region of the sgRNA, and wherein the sgRNA comprises the sequence of GUUUUAGAN x N x N x N x N x N x N x N x GAAAN y N y N y N y N y N y N y N y AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 5).

20. The sgRNA of claim 15, wherein the Nxand Nycomprise 9 nucleotides each, which are complementary nucleotides and form the upper stem region of the sgRNA, and wherein the sgRNA comprises the sequence of GUUUUAGAN x N x N x N x N x N x N x N x N x GAAAN y N y N y N y N y N y N y N y N y AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 6).

21. The sgRNA of claim 15, wherein the Nxand Nycomprise 10 nucleotides each, which are complementary nucleotides and form the upper stem region of the sgRNA, and wherein the sgRNA comprises the sequence of GUUUUAGAN x N x N x N x N x N x N x N x N x N x GAAAN y N y N y N y N y N y N y N y N y N y AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 7).

22. The sgRNA of claim 15, wherein the sgRNA comprises the sequence of GUUUUAGAGCGCGGAAACGCGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 8).

23. The sgRNA of claim 14, wherein the sgRNA comprises the sequence of GUUUUAGAGCCGGCGGAAACGCCGGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 9).

24. The sgRNA of any one of claims 14-23, wherein all of the nucleotides within the upper stem comprise 2’ O-methyl modifications.

25. The sgRNA of claim 24, wherein the sgRNA comprises a sequence as set forth in any one of SEQ ID NOS: 20-32 and 51-52.

26. The sgRNA of any one of claims 14-25, wherein one or more nucleotides within the hairpin 1 region and the hairpin 2 region are modified nucleotides.

27. The sgRNA of claim 26, wherein all of the nucleotides within the hairpin 1 region and the hairpin 2 region are modified nucleotides.

28. The sgRNA of any one of claims 14-27, wherein the loop of hairpin 1 comprises 2’-O-methyl modified nucleotides (e.g., 2’-O-methyl 3’-thiophosphonate (MS) nucleotides, 2’-O-methyl 3’-thioPACE (MSP) nucleotides), 2’-F modified nucleotides, locked nucleic acids, MOE (methoxyethyl), DNA nucleotides functionalized for conjugation, and combinations thereof.

29. A single guide RNA (sgRNA) comprising GUUUUAGAN xn GAAAN yn AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGACUUUGGUCCAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 10), wherein N xn and N yn have the same number of nucleotides and are complementary nucleotides to form base pairs, and wherein N xn and N yn the nucleotides of N and N are modified nucleotides and wherein n is an integer from 5 to 15.

30. The sgRNA of claim 29, wherein the Nxand Nycomprise 5 nucleotides each, which are complementary nucleotides and form the upper stem region of the sgRNA, and wherein the sgRNA comprises the sequence of GUUUUAGAN x N x N x N x N x GAAAN y N y N y N y N y AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGACUUUGGUCCAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 11).

31. The sgRNA of claim 29, wherein the Nxand Nycomprise 6 nucleotides each, which are complementary nucleotides and form the upper stem region of the sgRNA, and wherein the sgRNA comprises GUUUUAGAN x N x N x N x N x N x GAAAN y N y N y N y N y N y AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGACUUUGGUCCAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 12).

32. The sgRNA of claim 29, wherein the Nxand Nycomprise 7 nucleotides each, which are complementary nucleotides and form the upper stem region of the sgRNA, and wherein the sgRNA comprises the sequence of GUUUUAGAN x N x N x N x N x N x N x GAAAN y N y N y N y N y N y N y AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGACUUUGGUCCAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 13).

33. The sgRNA of claim 29, wherein the Nxand Nycomprise 8 nucleotides each, which are complementary nucleotides and form the upper stem region of the sgRNA, wherein the sgRNA comprises GUUUUAGAN x N x N x N x N x N x N x N x GAAAN y N y N y N y N y N y N y N y AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGACUUUGGUCCAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 14).

34. The sgRNA of claim 29, wherein the Nxand Nycomprise 9 nucleotides each, which are complementary nucleotides and form the upper stem region of the sgRNA, and wherein the sgRNA comprises the sequence of GUUUUAGAN x N x N x N x N x N x N x N x N x GAAAN y N y N y N y N y N y N y N y N y AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGACUUUGGUCCAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 15).

35. The sgRNA of claim 29, wherein the Nxand Nycomprise 10 nucleotides each, which are complementary nucleotides and form the upper stem region of the sgRNA, and wherein the sgRNA comprises the sequence of GUUUUAGAN x N x N x N x N x N x N x N x N x N x GAAAN y N y N y N y N y N y N y N y N y N y AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGACUUUGGUCCAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 16).

36. The sgRNA of claim 29, wherein the sgRNA comprises the sequence of GUUUUAGAGCCGGCGGAAACGCCGGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGACUUCGGUCCAAGUUUUU (SEQ ID NO: 17).

37. A single guide RNA (sgRNA) comprising GUUUUAGAN xn GAAAN yn AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGACN z N z N z N z GUCCAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 18) of the sequence, Where N xn and N yn They have the same number of nucleotides and are complementary nucleotides to form base pairs, and where N xn and N yn The nucleotides are modified nucleotides, wherein n is an integer from 5 to 15, and wherein the four nucleotides of the hairpin 1 loop (N) z N z N z N z Sequences containing UUCG, CUUG, or GCAA.

38. The sgRNA of any one of claims 29-37, wherein one or more nucleotides within the hairpin 1 region and the hairpin 2 region are chemically modified nucleotides.

39. The sgRNA of claim 38, wherein all of the nucleotides within the hairpin 1 region and the hairpin 2 region are modified nucleotides.

40. The sgRNA of any one of claims 29-39, wherein the loop of hairpin 1 comprises a locked nucleic acid.

41. The sgRNA of any one of the preceding claims, wherein the modifications comprise 2’-O-methyl modified nucleotides (e.g., 2’-O-methyl 3’-thiophosphonate (MS) nucleotides, 2’-O-methyl 3’-thioPACE (MSP) nucleotides), 2’-F modified nucleotides, locked nucleic acids, MOE (methoxyethyl), DNA nucleotides functionalized for conjugation, and combinations thereof.

42. The sgRNA of any one of the preceding claims, wherein at least one modification comprises a 2’-O’ methyl (2’-O-Me) modified nucleotide.

43. The sgRNA of any one of claims 29-42, wherein all of the nucleotides within the upper stem comprise 2’ O-methyl modifications.

44. The sgRNA of claim 43, wherein the sgRNA comprises a sequence as set forth in any one of SEQ ID NOS: 33-40.

45. The sgRNA of any of the preceding claims, wherein the gRNA further comprises a spacer sequence at the 5' end of the sgRNA; the spacer sequence comprising a sequence complementary to a target sequence of interest.

46. The sgRNA of claim 45, wherein the spacer sequence comprises about 18 to 25, or 18 to 30, or 20 to 25, or 20 to 30 nucleotides.

47. The sgRNA of any of the preceding claims, wherein the 3' end of the sgRNA is modified.

48. The sgRNA of any of the preceding claims, wherein the 5' end of the sgRNA is modified.

49. The sgRNA of claim 48, wherein at least the first three nucleotides at the 5' end of the sgRNA are modified nucleotides.

50. The sgRNA of any of claims 1 to 46, wherein the sgRNA comprises a modification at the 5' end of the sequence and a modification at the 3' end of the sequence.

51. The sgRNA of any of the preceding claims, wherein about 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 75%, 80%, 90%, or 100% of the nucleotides of the sgRNA are modified nucleotides.

52. The sgRNA of any of the preceding claims, wherein the sgRNA further comprises a nuclear localization sequence (NLS).

53. The sgRNA of any of the preceding claims, wherein the sgRNA comprises about 102 to 150 nucleotides.

54. The sgRNA of claim 53, wherein the sgRNA comprises about 102 to 120 nucleotides.

55. The sgRNA of any of the preceding claims, wherein the sgRNA increases gene modification efficacy by about 2 to 1000 fold.

56. The sgRNA of claim 55, wherein the sgRNA increases the gene modification efficacy by about 2 to 100 fold, 2 to 50 fold, 2 to 20 fold, or 10 to 50 fold.

57. The sgRNA of claim 56, wherein the sgRNA increases the gene modification efficacy by about 2 to 10 fold, 2 to 5 fold, 3 to 8 fold, or 5 to 10 fold.

58. A gene modification system comprising: (a) a CRISPR-associated protein (Cas) polypeptide or a variant thereof; and (b) a single guide RNA (sgRNA) according to any of the preceding claims.

59. The gene modification system of claim 58, wherein the Cas polypeptide is a Cas9 protein.

60. The gene modification system of claim 59, wherein Cas9 is S. pyogenes Cas9 or S. aureus Cas9.

61. The gene modification system of claim 60, wherein the Cas9 polypeptide is a nickase or a dCas9.

62. The gene modification system of any one of claims 58-61, wherein the gene modification efficacy is increased by about 2- to 1000-fold.

63. The gene modification system of claim 62, wherein the gene modification efficacy is increased by about 2- to 100-fold, or 2- to 50-fold, or 2- to 20-fold, or 10- to 50-fold.

64. The gene modification system of claim 63, wherein the gene modification efficacy is increased by about 2- to 10-fold, or 2- to 5-fold, or 3- to 8-fold, or 5- to 10-fold.

65. A composition comprising the single guide RNA of any one of claims 1-59.

66. The composition of claim 65, further comprising a Cas9 polypeptide or a variant thereof.

67. The composition of claim 66, wherein the Cas polypeptide is a Cas9 protein, dCas9, or a nickase.

68. The composition of any one of claims 65-67, formulated in a lipid nanoparticle.

69. A method for modifying a target gene in a cell, the method comprising introducing into the cell a gene editing system comprising the single guide RNA (sgRNA) of any one of claims 1-59.

70. The method of claim 66, further comprising introducing into the cell a CRISPR-associated protein (Cas) polypeptide or a variant thereof, wherein the sgRNA directs the Cas polypeptide to the target gene, and wherein the sgRNA induces modification of the target gene with enhanced activity relative to a corresponding unmodified sgRNA comprising 5' GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU 3' (SEQ ID NO: 19).

71. The method of claim 70, wherein the cell is a Cas9-expressing cell.

72. The method of any one of claims 70-71, wherein the cell is a mammalian cell.

73. The method of any one of claims 70-72, wherein the cell is an immune cell.

74. A kit comprising the sgRNA of any one of claims 1-57, the gene modification system of any one of claims 58-64, or the composition of any one of claims 65-68.

75. A single guide RNA comprising a sequence as set forth in any one of SEQ ID NOS: 20-21 and 51-52.

Citation Information

Patent Citations

  • Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation

    US20040171570A1

  • 4'-thionucleosides and oligomeric compounds

    US20050130923A1

  • Nucleosides having bicyclic sugar moiety

    US6403566B1

  • 6-modified bicyclic nucleic acid analogs

    US7399845B2

  • Artificial nucleic acids of n-o bond crosslinkage type

    US7427672B2