Engineering chlamydomonas for synthesizing high-value pigment as well as construction method and application of engineering chlamydomonas

Abstract

The invention discloses engineering chlamydomonas reinhardtii for synthesizing high-value pigment and a construction method and application thereof.An engineering chlamydomonas reinhardtii strain Blup-BKT-CHYB-CHLC is preserved in the China General Microbiological Culture Collection Center on September 1, 2025, and the preservation number is CGMCC NO.46634. The content of astaxanthin in the constructed engineering chlamydomonas reinhardtii strain reaches 25.5 mg / L, and the content of astaxanthin in the engineering chlamydomonas reinhardtii strain reaches 9.5 mg / L; in addition, the light energy utilization efficiency is remarkably enhanced, the stress resistance is improved, very strong oxidation resistance is achieved, the accumulation of astaxanthin endows the engineering strain with highlight tolerance, the yield of high-value pigments is increased, and the biomass of the engineering strain is greatly superior to that of a wild strain under the highlight condition. In addition, the chlorophyll c synthase is applied to the reconstruction of a pigment system of the chlamydomonas reinhardtii for the first time, a frontier tool is quickly converted, and a molecular mechanism of'chlorophyll c-astaxanthin-blue pigment 'for synergistically regulating the photosynthetic efficiency of the chlamydomonas reinhardtii and product synthesis is clarified for the first time. The research blank of pigment system coupling regulation and control of photosynthesis and metabolism in the chlamydomonas reinhardtii is filled.

Description

Technical Field

[0001] This invention belongs to the field of synthetic biology technology, and mainly relates to the construction and application of an engineered algal strain that integrates "light energy capture-photoprotection-multi-product synthesis", providing new algal strains and methods for the industrial application of microalgae. Background Technology

[0002] Microalgae are among the most photosynthetically efficient organisms. However, they do not possess all pigments simultaneously, leading to an imbalance between light energy utilization and photoprotection. This manifests as a "blind spot" in the light-harvesting spectrum and a "weak link" in photoprotection. Furthermore, while microalgae are an ideal source of natural pigments, current research suffers from two major limitations: firstly, the limited energy supply due to the single pigment as a product results in low cost-effectiveness; secondly, pigment synthesis is disconnected from light energy supply. These algal strains either have low photosynthetic efficiency or lack additional photoprotection mechanisms, making it difficult to balance biomass and pigment production, resulting in low overall production efficiency.

[0003] Chlorophyll C is a photosynthetic pigment found in some algae, which mainly absorbs light energy and expands the spectral range of photosynthesis; astaxanthin can absorb light energy to protect chlorophyll from light damage and is also a commercially available anti-cancer and antioxidant health product; blue pigment is a food additive commonly used in food, beverages and other products, and it has strong anti-inflammatory and antioxidant capabilities.

[0004] Existing microalgae suffer from two bottleneck problems: a lack of light-harvesting pigments, resulting in blind spots in the light-harvesting spectrum; an imbalance in photoprotection, leading to low photosynthetic efficiency; and insufficient energy for producing single high-value pigment products, resulting in low production cost-effectiveness. Summary of the Invention

[0005] Therefore, the purpose of this invention is to provide an engineered Chlamydomonas species with high-value pigments synthesized through light-harvesting system reconstruction and optimization, as well as its construction method and applications. This invention is based on synthetic biology strategies to heterologously express chlorophyll derived from diatoms in Chlamydomonas reinhardtii. c This study constructs an engineered algal strain that synergizes light-harvesting with enzymes to broaden the light-harvesting spectrum, utilizes astaxanthin synthesis pathways to achieve photosynthesis and high-value products, and incorporates a blue pigment synthesis gene as an additional high-value product. This elucidates the mechanism by which the light-harvesting system is reconstructed and optimized to synthesize high-value pigments, providing a new algal strain and method for the industrial application of microalgae. The constructed engineered algal strain can achieve increased biomass, including increased astaxanthin and blue pigment production, as well as enhanced photosynthetic systems, providing a "high-performance, cost-effective algal strain" for the industrial production of microalgal pigments. Furthermore, this strain can be applied in multiple fields, such as using astaxanthin and blue pigments as natural food additives or colorants, anti-cancer and antioxidant health products, and bioenergy precursors, breaking the bottleneck of single-product production in the microalgae industry.

[0006] To achieve the above objectives, the present invention provides the following technical solution: In a first aspect, the present invention provides an engineered Chlamydomonas reinhardtii strain for synthesizing high-value pigments ( Chlamydomonas reinhardtii Blup-BKT-CHYB-CHLC was deposited on September 1, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 46634. The depository address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0007] Based on the above technical solution, furthermore, the blue pigment protein gene is overexpressed in the *Chlamydomonas reinhardtii* strain Blup-BKT-CHYB-CHLC. Blup, β-Carotene ketolase gene fused to the N-terminus of a chloroplast transport peptide gene BKT and β-carotene hydroxylase gene ERROR Gene fragments and chlorophyll fused to the N-terminus of a chloroplast transport peptide gene c synthase gene CHLC .

[0008] Based on the above technical solution, further, the blue pigment protein gene... Bloop The nucleotide sequence is shown in SEQ ID NO.4.

[0009] Based on the above technical solution, further, the β-carotene ketolase gene fused to the N-terminus of the chloroplast transport peptide gene... BKT and β-carotene hydroxylase gene ERROR The nucleotide sequence of the gene fragment is shown in SEQ ID NO.5.

[0010] Based on the above technical solution, further, the chlorophyll with the N-terminus fused with the chloroplast transport peptide gene... c synthase gene CHLC The nucleotide sequence is shown in SEQ ID NO.6.

[0011] Secondly, the present invention provides a method for constructing the above-mentioned Chlamydomonas reinhardtii strain Blup-BKT-CHYB-CHLC, comprising the following steps: (1) Construct the blue pigment protein gene separately. Bloop expression carrier 、 Insertion of β-carotene ketolase gene with N-terminal fusion with chloroplast transport peptide gene BKT and β-carotene hydroxylase gene ERROR Gene fragment expression vector and chlorophyll with N-terminal fusion of chloroplast transport peptide gene c synthase gene CHLC The carrier of expression; (2) The blue protein gene was constructed separately by electroporation. Bloop expression carrier 、 Insertion of β-carotene ketolase gene with N-terminal fusion with chloroplast transport peptide gene BKT and β-carotene hydroxylase gene ERROR Gene fragment expression vector and chlorophyll with N-terminal fusion of chloroplast transport peptide gene c synthase gene CHLC The expression vector was transformed into Chlamydomonas reinhardtii to obtain the Chlamydomonas reinhardtii strain Blup-BKT-CHYB-CHLC.

[0012] Based on the above technical solution, further, a blue pigment protein gene is inserted. Bloop The expression vector's backbone is the pOpt-Clover-Paro plasmid; it inserts a β-carotene ketolase gene fused to the N-terminus of a chloroplast transport peptide gene. BKT and β-carotene hydroxylase gene ERROR The gene fragment expression vector's backbone is the pOpt-Clover-Hyg plasmid; chlorophyll is inserted at the N-terminus of a chloroplast transport peptide gene. c synthase gene CHLC The expression vector's backbone is the Hsp70A / RbcS2-SQS-Ble plasmid.

[0013] Based on the above technical solution, the construction method further includes the following steps: (1) Reconstructing the gene sequence: The blue pigment protein synthesis gene derived from jellyfish was reconstructed. Bloop The coding sequence of β-carotene ketolase derived from Chlamydomonas reinhardtii BKT β-Carotene hydroxylase from Haematococcus pluvialis ERROR Coding region sequence, chlorophyll c synthase CHLC The coding sequence was optimized based on the codon bias of the Chlamydomonas reinhardtii cell nucleus; simultaneously, BKT and ERROR The N-terminus of the gene sequence is fused with the chloroplast transport peptide gene (PsaD-SP1), in CHLC The N-terminus of the gene sequence is fused to the chloroplast transport peptide gene (PsaD-SP2), which... BKT and ERROR The sequence of the chloroplast transport peptide gene (PsaD-SP1) is shown in SEQ ID NO.1; CHLC The sequence of the N-terminus fused to the chloroplast transport peptide gene (PsaD-SP2) is shown in SEQ ID NO.2; (2) Constructing the expression carrier: The reconstructed expression carrier from step (1) Bloop Gene sequence, through NdeI and EcoRI The restriction sites were subcloned into the pOpt-Clover-Paro backbone plasmid to construct the pOpt-Blup-Paro expression vector; Reconstructing step (1) BKT and ERROR Gene sequences are linked together via GSG-linker and PsaD- is synthesized from scratch. BKT-L-ERROR Gene sequence, through NdeI and BglII The restriction enzyme sites were subcloned into the pOpt-Clover-Hyg backbone plasmid to construct pOpt- BKT-L-ERROR -Clover-Hyg expression vector, wherein the DNA sequence of the GSG-linker is shown in SEQ ID NO.3; The reconstructed CHLC gene sequence from step (1) was used to synthesize the PsaD-CHLC gene sequence de novo. XhoI and BamHI The restriction sites were subcloned into the Hsp70A / RbcS2-SQS-Ble backbone plasmid to construct the Hsp70A / RbcS2-CHLC-mVenus-Ble expression vector. (3) The constructed pOpt-Blup-Paro expression vector was introduced into wild-type Chlamydomonas reinhardtii algae by electroporation. Resistant algae were screened with paromomycin (15 μg / mL), and Blup-17 positive algae were obtained by clonal PCR and RT-PCR analysis. The pOpt-BKT-L-CHYB-Clover-Hyg expression vector was introduced into Blup-17 algae by electroporation. Resistant algae were selected with hygromycin (15 μg / mL), and Blup-BKT-CHYB-16 strain was obtained by clonal PCR and RT-PCR analysis. The constructed Hsp70A / RbcS2-CHLC-mVenus-Ble expression vector was introduced into Blup-BKT-CHYB-16 algae by electroporation. Bleomycin (10 μg / mL) was used to screen for drug-resistant algae. The drug-resistant algal strains were screened using μg / mL, and the Blup-BKT-CHYB-CHLC positive algal strain was obtained by cloning PCR and RT-PCR analysis. This strain is an engineered Chlamydomonas that has undergone reconstruction and optimization of its light-harvesting system to synthesize high-value pigments.

[0014] Based on the above technical solution, further, the electroporation method described in step (3) is electroporation.

[0015] Thirdly, the present invention provides the application of the above-mentioned Chlamydomonas reinhardtii strain Blup-BKT-CHYB-CHLC in the production of microalgal pigments.

[0016] Based on the above technical solution, the pigment further includes astaxanthin and blue pigment.

[0017] Compared with the prior art, the present invention has the following beneficial effects: 1. This invention presents an engineered Chlamydomonas strain, Blup-BKT-CHYB-CHLC-10, which utilizes a reconstructed and optimized light-harvesting system to synthesize high-value pigments. Under nitrogen-deficient stress conditions, this strain achieves an astaxanthin content of approximately 25.5 mg / L, significantly enhanced light energy utilization efficiency, improved stress resistance, and strong antioxidant properties. The accumulation of astaxanthin endows the engineered strain with high light tolerance, increased high-value pigment yield, and significantly superior biomass compared to the wild-type strain under high light conditions. This provides a "high-performance, cost-effective" strain for the industrial production of microalgal pigments. Furthermore, this strain can be applied in multiple fields, such as using astaxanthin and blue pigments as natural food additives or colorants, in anti-cancer and antioxidant health products, and as bioenergy precursors, breaking through the bottleneck of single-product production in the microalgae industry.

[0018] 2. This invention is the first to apply chlorophyll c synthase to the pigment system reconstruction of Chlamydomonas reinhardtii, rapidly transforming cutting-edge tools and elucidating for the first time the molecular mechanism of "chlorophyll c-astaxanthin-blue pigment" synergistic regulation of photosynthetic efficiency and product synthesis in Chlamydomonas reinhardtii, filling the research gap in the coupled regulation of photosynthesis and metabolism by the pigment system in Chlamydomonas reinhardtii. Attached Figure Description

[0019] To more clearly illustrate the embodiments of the present invention, the accompanying drawings involved in the embodiments will be briefly described below.

[0020] Figure 1 A schematic diagram of the blue pigment synthesis carrier provided in an embodiment of the present invention.

[0021] Figure 2 This is a schematic diagram of the astaxanthin synthesis carrier provided in an embodiment of the present invention.

[0022] Figure 3 This is a schematic diagram of the chlorophyll c synthesis carrier provided in an embodiment of the present invention.

[0023] Figure 4 The PCR results of the target gene of the blue pigment transgenic Chlamydomonas provided in the embodiments of the present invention.

[0024] Figure 5 The RT-PCR results of the blue pigment transgenic Chlamydomonas provided in the embodiments of the present invention.

[0025] Figure 6 The PCR results of the target gene of the transgenic Chlamydomonas aeruginosa provided in the embodiments of the present invention.

[0026] Figure 7The astaxanthin-transgenic Chlamydomonas RT-PCR results provided in the embodiments of the present invention.

[0027] Figure 8 The PCR results of the target gene of Chlamydomonas chlorophyll c transgenic are provided in the embodiments of the present invention.

[0028] Figure 9 The RT-PCR results of Chlorophyll c transgenic Chlamydomonas provided in the embodiments of the present invention.

[0029] Figure 10 The astaxanthin content of the transgenic Chlamydomonas Blup-BKT-CHYB-CHLC-10 positive algae provided in the embodiments of the present invention.

[0030] Figure 11 The results of QY (Fv / Fm) in the gene photosynthetic system of the transgenic Chlamydomonas Blup-BKT-CHYB-CHLC-10 positive algae provided in the embodiments of the present invention.

[0031] Figure 12 The results of non-photochemical quenching NPQ in the photosynthetic system of the transgenic Chlamydomonas Blup-BKT-CHYB-CHLC-10 positive algae provided in the embodiments of the present invention.

[0032] Figure 13 The electron migration rate (rETR) detection results are shown in the transgenic Chlamydomonas Blup-BKT-CHYB-CHLC-10 positive algal biosynthesis system provided in this embodiment of the invention. Detailed Implementation

[0033] The present invention will be described in detail below with reference to the embodiments. However, the implementation of the present invention is not limited thereto. Obviously, the embodiments described below are only some embodiments of the present invention. For those skilled in the art, other similar embodiments can be obtained without creative effort and all fall within the protection scope of the present invention.

[0034] Unless otherwise specified, the methods described in the following embodiments are conventional methods.

[0035] Unless otherwise specified, all percentages in the following examples are by mass percentages.

[0036] Unless otherwise specified, all experimental materials used in the following examples were purchased from conventional biochemical reagent stores.

[0037] Example 1 1. Gene source and sequence used Retrieved from the NCBI database (https: / / www.ncbi.nlm.nih.gov / ) (Source: Jellyfish) Rhizostoma lung Blue pigment protein Bloop Gene coding sequence information (GenBank accession number: AY507144), Chlamydomonas reinhardtii Chlamydomonas reinhardtii The key gene in the astaxanthin synthesis pathway is β-carotene ketolase (β-carotene ketolase). BKT Gene coding sequence information (GenBank accession number: Q4VKB4), Haematococcus pluvialis Haematococcus pluvialis The key gene in the astaxanthin synthesis pathway is β-carotene hydroxylase ( ERROR Gene coding sequence information (GenBank accession number: ADN43073), and *Phaeodactylum tricornutum*. Phaeodactylum tricornutum Chlorophyll source c synthase CHLC Gene coding sequence information (GenBank accession number: Phatr3-J43737).

[0038] 2. Reconstructing gene sequences To enhance gene expression, codon optimization was performed on the aforementioned genes based on the codon preferences of the nuclear genes encoding proteins of *Chlamydomonas reinhardtii*. Specifically, codon optimization and intron design were performed using the *Chlamydomonas reinhardtii* Intronserter online design website (https: / / bibiserv.cebitec.uni-bielefeld.de / intronserter). BKT and ERROR The N-terminus of the gene sequence is fused with the chloroplast transport peptide gene (PsaD-SP1), in CHLC The gene sequence is fused to the N-terminus of a chloroplast transport peptide gene (PsaD-SP2).

[0039] The PsaD-SP1 gene sequence is shown in SEQ ID NO.1: GCGGTGATGATGCGCACCCAGGCCCCCGCCGCGACCCGCGCGAGCTCGCGCGTGGCGGTGGCGGCCCGCCCGGCCGCGCGTCGCGCCGTGGTGGTGCGCGCCGAG.

[0040] The PsaD-SP2 gene sequence is shown in SEQ ID NO.2: ATGGCCGTGATGATGCGCACCCAGGCCCCCGCCGCCACCCGCGCCAGCAGCCGCGTGGCCGTGGCCGCCCGCCCCGCCGCCCGCCGCGCCGTGGTGGTGCGCGCCGAG.

[0041] 3. Constructing expression carriers Reconstruct the above design Bloop Gene sequence, through NdeI and EcoRI The restriction enzyme sites were subcloned into the pOpt-Clover-Paro backbone plasmid (reference: Expression levels of domestic cDNA cassettes integrated in the nuclear genomes of various Chlamydomonas reinhardtiistrains - ScienceDirect), and the pOpt-Blup-Paro expression vector was constructed; the above design was then reconstructed. BKT and ERROR The coding sequences were linked together using a GSG-linker (the DNA sequence of which is shown in SEQ ID NO.3: GGCAGCGGC); and synthesized de novo to obtain the PsaD-SP1-BKT-L-CHYB gene sequence. NdeI and BglII The restriction enzyme sites were subcloned into the pOpt-Clover-Hyg backbone plasmid (Reference: Expression levels of domestic cDNA cassettes integrated in the nuclear genomes of various Chlamydomonas reinhardtii strains - ScienceDirect), and pOpt- BKT-L-ERROR -Clover-Hyg expression vector; the above design was reconstructed. CHLC Gene sequence, de novo synthesis of the PsaD-SP2-CHLC gene sequence, through XhoI and BamHI The restriction sites were subcloned into the Hsp70A / RbcS2-SQS-Ble backbone plasmid (Reference: Expression levels of domestic cDNA cassettes integrated in the nuclear genomes of various Chlamydomonas reinhardtii strains - ScienceDirect), and the Hsp70A / RbcS2-CHLC-mVenus-Ble expression vector was constructed.

[0042] The reconstructed Blup DNA sequence is shown in SEQ ID NO.4: The reconstructed DNA sequence of PsaD-SP1-BKT-L-CHYB is shown in SEQ ID NO.5: The DNA sequence of the reconstructed PsaD-SP2-CHLC is shown in SEQ ID NO.6:

[0043] 4. Algal strain culture The constructed pOpt-Blup-Paro expression vector was transformed into a wild-type Chlamydomonas strain (the wild-type strain PL used in this example was purchased from the Chlamydomonas Resource Center, website: https: / / www.chlamycollection.org / ) via electroporation; then it was inoculated onto plates containing antibiotics (15 µg / mL paromomycin) and the plates were placed under continuous light (50 µmol / mL). -2 s -1 After culturing at 25°C for about 7 days, antibiotic-resistant monoclonal algal strains can be observed; positive algal strain Blup-17 was obtained by clonal PCR and RT-PCR analysis.

[0044] The constructed pOpt-BKT-L-CHYB-Clover-Hyg expression vector was transformed into the Blup-17 algal strain via electroporation; then, it was inoculated onto plates containing antibiotics (15 µg / mL hygromycin) and the plates were placed under continuous light (50 µmol / mL). -2 s -1 After culturing at 25°C for about 7 days, antibiotic-resistant monoclonal algal strains can be observed; positive algal strain Blup-BKT-CHYB-16 was obtained by clonal PCR and RT-PCR analysis.

[0045] The constructed Hsp70A / RbcS2-CHLC-mVenus-Ble expression vector was transformed into the Blup-BKT-CHYB-16 algal strain via electroporation; then, it was inoculated onto plates containing antibiotics (10 µg / mL bleomycin) and the plates were placed under continuous light (50 µmol / mL). -2 s -1 After culturing at 25°C for approximately 7 days, antibiotic-resistant monoclonal algal strains were observed. Positive algal strains, Blup-BKT-CHYB-CHLC-10, were obtained through clonal PCR and RT-PCR analysis.

[0046] The electroporation transformation described above utilizes the electroporation method. The specific steps are as follows: approximately 1.0 µg of linearized plasmid DNA is used in each transformation experiment, and *Chlamydomonas reinhardtii* cells are grown in TAP medium to a height of approximately 1.5 × 10⁻⁶. 6 Cells / mL; exponentially growing cells (2.5 × 10⁻⁶) were collected by centrifugation. 7Cells were suspended in 250 µL of TAP medium supplemented with 40 mM sucrose; the cell suspension was placed in a pre-chilled disposable electroporation cuvette and incubated at 16°C for 5 minutes; then electroporation was performed using a Micro Pluser at 800V; the electroporated cells were transferred to 5.0 mL of TAP medium containing 40 mM sucrose and incubated in the dark (10 µmol m... -2 s -1 Incubate for 16 hours.

[0047] The specific method for cloning PCR is as follows: Use a toothpick to pick up an appropriate amount of *Chlamydomonas reinhardtii* cells and add them to a PCR tube containing 50 μL of 10 mM EDTA (pH=8.0) solution. Vortex to mix (5-10 s), then incubate at 100℃ for 10 min. Immediately after incubation, remove the tube and place it on ice to cool. After cooling, vortex vigorously again for 5-10 s, then centrifuge at 1400 rpm for 1 min. Use 0.3 μL of the supernatant from centrifugation as the PCR template.

[0048] The RT-PCR analysis was performed as follows: RNA was extracted using the Trizol method, and its concentration and purity were detected using Nanodrop. 400 ng of RNA was taken, and a reverse transcription reaction system was prepared using an RNA reverse transcription kit (Takara) according to the instructions. The reverse transcription reaction mixture was incubated at 37°C for 30 min, then at 85°C for 1 min, immediately cooled on ice, and stored at -20°C for later use.

[0049] The specific steps for photosynthetic capacity testing are as follows: (1) Detection of maximum photochemical quantum yield (QY=Fv / Fm), non-photochemical quenching (NPQ), and relative electron transport rate (rETR): a. Measure the QY (FV / FM), NPQ and rETR of Chlamydomonas reinhardtii using FP110 / AP110 (Ecotech Ecotechnology Co., Ltd.); b. After culturing *Chlamydomonas reinhardtii* to the logarithmic growth phase, dilute the *Chlamydomonas reinhardtii* cell concentration to 0.5-1 × 10⁻⁶. 6 cells / mL, take 15mL of the diluted algal solution into a 15mL centrifuge tube; c. Wrap the centrifuge tubes with aluminum foil and keep them in the dark for 30 minutes; d. Take 4 mL of algal solution into the cuvette provided with the instrument, quickly place the cuvette into the FP110 / AP110 instrument, and measure QY, NPQ and rETR according to the instrument instruction manual. Each experiment should be performed in parallel at least 3 times.

[0050] e. Use FluorPenInstall software to read data. Connect the FP110 / AP110 instrument to the computer, open the FluorPenInstall software, and load the data.

[0051] The specific steps for colorimetric determination of astaxanthin content are as follows: (1) Turn on the water bath and set it to 65 degrees Celsius; (2) Take 5 mL of algal solution into a 50 mL centrifuge tube, add water, centrifuge at 6000 rpm for 5 min, and then remove the supernatant.

[0052] (3) Add 5 mL of methanol / KOH solution (a mixture of methanol and 5 wt% KOH aqueous solution with a volume ratio of 30:70) to the centrifuge tube, shake to disperse the algae evenly, and then place it in a constant temperature water bath at 65°C for 10 min (with the centrifuge tube cap on). Shake the centrifuge tube frequently during the water bath process.

[0053] (4) Centrifuge at 8000 rpm for 3 min to remove the supernatant; repeat (3) and (4) once.

[0054] (5) Add 5 mL of mixed solution (acetone and dimethyl sulfoxide in a volume ratio of 2:3) to the centrifuge tube, shake well, and sonicate for 3 min; (6) Centrifuge at 8000 rpm for 3 min. If the solution concentration is too high after centrifugation, a mixed solution (acetone and dimethyl sulfoxide in a volume ratio of 2:3) can be added for dilution.

[0055] (7) Place the solution in a 1 cm optical path cuvette and use the mixed solution (acetone and dimethyl sulfoxide mixed in a volume ratio of 2:3) as a control to measure the absorbance at a wavelength of 490 nm.

[0056] The calculation formula is as follows: C1 = 4.5 * A 490 *Va / Vb; In the formula: C1 represents the astaxanthin content per unit volume, in units of (mg / L); A 490 The absorbance of the liquid mixture at 490 nm and 1 cm depth is given. Va is the volume of the mixed solution (acetone and dimethyl sulfoxide in a volume ratio of 2:3) (the product of the volumes of the two mixed solutions in steps 5 and 6), and Vb is the volume of the algal solution.

[0057] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. An engineered Chlamydomonas reinhardtii strain that synthesizes high-value pigments ( Chlamydomonas reinhardtii )Blup-BKT-CHYB-CHLC, characterized in that, It was deposited on September 1, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.46634. The address of the depository is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

2. The engineered Chlamydomonas reinhardtii strain Blup-BKT-CHYB-CHLC according to claim 1, characterized in that, The blue protein gene was overexpressed in the *Chlamydomonas reinhardtii* strain Blup-BKT-CHYB-CHLC. Blup, β-Carotene ketolase gene fused to the N-terminus of a chloroplast transport peptide gene BKT and β-carotene hydroxylase gene CHYB Gene fragments and chlorophyll fused to the N-terminus of a chloroplast transport peptide gene c synthase gene CHLC .

3. The engineered Chlamydomonas reinhardtii strain Blup-BKT-CHYB-CHLC according to claim 2, characterized in that, The aforementioned blue pigment protein gene Blup The nucleotide sequence is shown in SEQ ID NO.

4.

4. The engineered Chlamydomonas reinhardtii strain Blup-BKT-CHYB-CHLC according to claim 2, characterized in that, The β-carotene ketolase gene fused to the N-terminus of a chloroplast transport peptide gene BKT and β-carotene hydroxylase gene CHYB The nucleotide sequence of the gene fragment is shown in SEQ ID NO.

5.

5. The engineered Chlamydomonas reinhardtii strain Blup-BKT-CHYB-CHLC according to claim 2, characterized in that, The chlorophyll with the N-terminus fused to the chloroplast transport peptide gene c synthase gene CHLC The nucleotide sequence is shown in SEQ ID NO.

6.

6. The method for constructing the Chlamydomonas reinhardtii strain Blup-BKT-CHYB-CHLC according to any one of claims 1-5, characterized in that, The steps include the following: (1) Construct the blue pigment protein gene separately. Blup expression carrier 、 Insertion of β-carotene ketolase gene with N-terminal fusion with chloroplast transport peptide gene BKT and β-carotene hydroxylase gene CHYB Gene fragment expression vector and chlorophyll with N-terminal fusion of chloroplast transport peptide gene c synthase gene CHLC The carrier of expression; (2) The blue protein gene was constructed separately by electroporation. Blup expression carrier 、 Insertion of β-carotene ketolase gene with N-terminal fusion with chloroplast transport peptide gene BKT and β-carotene hydroxylase gene CHYB Gene fragment expression vector and chlorophyll with N-terminal fusion of chloroplast transport peptide gene c synthase gene CHLC The expression vector was transformed into Chlamydomonas reinhardtii to obtain the Chlamydomonas reinhardtii strain Blup-BKT-CHYB-CHLC.

7. The construction method according to claim 6, characterized in that, Insertion of blue protein gene Blup The expression vector's backbone is the pOpt-Clover-Paro plasmid; it inserts a β-carotene ketolase gene fused to the N-terminus of a chloroplast transport peptide gene. BKT and β-carotene hydroxylase gene CHYB The gene fragment expression vector's backbone is the pOpt-Clover-Hyg plasmid; chlorophyll is inserted at the N-terminus of a chloroplast transport peptide gene. c synthase gene CHLC The expression vector's backbone is the Hsp70A / RbcS2-SQS-Ble plasmid.

8. The construction method according to claim 6, characterized in that, The electroporation method described above is an electroporation method.

9. The application of the Chlamydomonas reinhardtii strain Blup-BKT-CHYB-CHLC according to any one of claims 1-5 in the production of microalgal pigments.

10. The application according to claim 9, characterized in that, The pigments mentioned include astaxanthin and blue pigment.

Images