Application of soybean GmSW10 gene in regulating plant height, grain weight and grease and / or protein content

Abstract

The invention belongs to the technical field of plant molecular biology, and discloses an application of a soybean GmSW10 gene in reducing soybean plant height, grain weight and grease content and / or increasing protein content. The CDS sequence of the soybean GmSW10 gene is as shown in SEQ ID NO: 1. Knockout of the soybean GmSW10 gene can directly influence the plant height, the grain weight, the oil content and the protein content of soybean seeds, after the soybean GmSW10 gene is knocked out, the weight of soybean seeds and hundred grains is remarkably reduced, the plant height is reduced, the protein content is increased, and the oil content is reduced, which indicates that the GmSW10 gene is a key gene for regulating and controlling the plant height, the grain weight, the oil content and the protein content of the soybean, and the GmSW10 gene can be used for preparing the soybean GmSW10 gene for regulating and controlling the plant height, the grain weight, the oil content and the protein content of the soybean. And a new genetic resource is provided for genetic improvement of soybeans.

Description

Technical Field

[0001] This invention belongs to the field of plant molecular biology technology, specifically relating to the application of the soybean GmSW10 gene in regulating plant height, grain weight, oil and / or protein content. Background Technology

[0002] Soybean (Glycine max) is a vital food and economic crop worldwide, providing a major source of plant protein and edible oil globally. Its yield and quality directly impact food security and agricultural economic benefits. Soybean yield and quality are not determined by a single trait, but rather by a complex interplay of multiple agronomic traits. Among these, seed-related traits (such as 100-seed weight, oil content, and protein content) and plant height are recognized as core determinants.

[0003] Specifically, the photosynthetic products of a plant are limited. If the grains are too large (too heavy), the number of grains that can be formed with the same amount of energy will decrease. Appropriately reducing grain weight allows the plant to allocate its limited energy to more grains. Oil and protein content are key quality indicators that determine the economic value and processing uses of soybeans. Plant height indirectly affects the final yield by influencing plant architecture, lodging resistance, photosynthetic efficiency, and planting density.

[0004] Traditional breeding methods have long been effective in improving these traits, but the process is slow, time-consuming, and limited by the genetic diversity of existing germplasm resources. While marker-assisted selection (MAS) can accelerate the process, its effectiveness heavily depends on a deep understanding of the genetic regulatory mechanisms of the target trait. Most of these important traits are quantitative traits, controlled by multiple quantitative trait loci (QTLs) or the superposition of minor gene effects, and are significantly influenced by environmental factors, making their genetic mechanisms extremely complex.

[0005] Although QTL mapping has identified numerous relevant chromosomal regions, the soybean genome is highly complex, containing many repetitive sequences and paralogous genes. The contribution of key genes to phenotype is often low, making precise identification and cloning of major genes regulating these traits difficult using genetic methods. Therefore, identifying and cloning key genes that significantly regulate grain weight, oil content, protein content, or plant height from the soybean genome and elucidating their genetic regulatory mechanisms is not only of great theoretical significance but also provides valuable genetic resources and targets for the targeted breeding of high-yield, high-quality soybean varieties using advanced technologies such as molecular design breeding, thus addressing a core challenge in the industry. Summary of the Invention

[0006] The purpose of this invention is to provide a soybean GmSW10 gene that can regulate soybean plant height, grain weight, oil content, and protein content.

[0007] The following technical solutions are used to achieve the above objectives.

[0008] The first aspect of this invention provides the application of the soybean GmSW10 gene in reducing soybean plant height, grain weight, oil content and / or increasing protein content; the CDS sequence of the soybean GmSW10 gene is shown in SEQ ID NO:1.

[0009] The second aspect of this invention provides the application of the soybean GmSW10 gene in the breeding of soybeans with dwarf plants, small grain weight, low oil content and / or high protein content; the CDS sequence of the soybean GmSW10 gene is shown in SEQ ID NO:1.

[0010] The third aspect of this invention provides the application of a protein encoded by the soybean GmSW10 gene in the breeding of soybeans with dwarf plants, small grain weight, low oil content and / or high protein content; the amino acid sequence of the protein encoded by the soybean GmSW10 gene is shown in SEQ ID NO:2.

[0011] The fourth aspect of this invention provides the application of a protein encoded by the soybean GmSW10 gene in reducing soybean plant height, grain weight, oil content and / or increasing protein content; the amino acid sequence of the protein encoded by the soybean GmSW10 gene is shown in SEQ ID NO:2.

[0012] The fifth aspect of this invention provides the application of a soybean GmSW10 gene knockout vector in reducing soybean plant height, grain weight, oil content and / or increasing protein content; the CDS sequence of the soybean GmSW10 gene is shown in SEQ ID NO:1.

[0013] In some embodiments, the knockout target of the GmSW10 gene knockout vector is shown in SEQ ID NO:5 and SEQ ID NO:6.

[0014] In some embodiments, the soybean GmSW10 gene knockout vector is constructed through the following steps:

[0015] Using pHLW-gRNA-tRNA as a template, SEQ ID NO:7 and SEQ ID NO:8 as primers, PCR amplification and purification were performed. The PCR product and pPTG-gRNA-Cas9 vector plasmid were digested with enzymes, ligated by cyclic enzyme digestion, and transformed into plasmid. Positive clones were picked and plasmids were extracted to obtain the soybean GmSW10 gene knockout vector.

[0016] The sixth aspect of this invention provides the application of recombinant engineered bacteria transformed with a soybean GmSW10 gene knockout vector in reducing soybean plant height, grain weight, oil content and / or increasing protein content; the CDS sequence of the soybean GmSW10 gene is shown in SEQ ID NO:1.

[0017] The seventh aspect of this invention provides a method for reducing soybean plant height, grain weight, oil content, and / or increasing soybean protein content, comprising the following steps:

[0018] The soybean GmSW10 gene was knocked out in soybeans, and the CDS sequence of the soybean GmSW10 gene is shown in SEQ ID NO:1.

[0019] In some embodiments, the method for knocking out the soybean GmSW10 gene in soybeans includes the following steps:

[0020] Recombinant engineered bacteria transformed with a soybean GmSW10 gene knockout vector were transferred into soybean callus to obtain soybean GmSW10 gene knockout lines.

[0021] In this invention, it was found that knocking out the soybean GmSW10 gene (CDS sequence shown in SEQ ID NO:1) directly affects the plant height, grain weight, oil content, and protein content of soybean seeds. After knocking out the soybean GmSW10 gene, the soybean grains and 100-grain weight were significantly smaller, the plant height was shorter, the protein content increased, and the oil content decreased. This indicates that the GmSW10 gene is a key gene that regulates the plant height, grain weight, oil content, and protein content of soybeans, providing a new genetic resource for the genetic improvement of soybeans. Attached Figure Description

[0022] Figure 1 The homozygous lines gmsw10-1 and gmsw10-2 of soybean GmSW10 were knocked out.

[0023] Figure 2 Seed phenotypes of Williams82 soybean (control group) and GmSW10 knockout homozygous lines.

[0024] Figure 3 The 100-seed weight, oil and protein content, and plant height of Williams82 and T3 generation knockout homozygous lines (gmsw10-1 and gmsw10-2) were determined. Detailed Implementation

[0025] To facilitate understanding of the present invention, a more complete description will be provided below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0026] Unless otherwise specified, experimental methods in the following examples are generally performed under standard conditions or as recommended by the manufacturer. All commonly used chemical reagents used in the examples are commercially available products.

[0027] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the invention. The term "and / or" as used in this invention includes any and all combinations of one or more of the associated listed items.

[0028] Unless otherwise specified, experimental methods in the following examples were performed under standard conditions, such as those described in the fourth edition of *Molecular Cloning: A Laboratory Manual*, edited by Green and Sambrook, published in 2013, or under conditions recommended by the manufacturer. All commonly used chemical reagents used in the examples are commercially available products.

[0029] The present invention provides an application of the soybean GmSW10 gene and its encoded protein in regulating soybean plant height, grain weight, oil content and / or increasing protein content; the CDS sequence of the soybean GmSW10 gene is shown in SEQ ID NO:1.

[0030] This invention uses soybean as an example to illustrate the role of the soybean GmSW10 gene in reducing soybean plant height, grain weight, oil content, and / or increasing protein content. After knocking out the soybean GmSW10 gene, soybean grains and 100-grain weight significantly decreased, plant height decreased, and protein content increased while oil content decreased. This indicates that the GmSW10 gene is a key gene regulating soybean plant height, grain weight, oil content, and protein content, providing a new genetic resource for soybean genetic improvement. In common knowledge, those skilled in the art can apply this technology to crops in the same subfamily (Papilionoideae) as soybean, such as peanuts, broad beans, mung beans, red beans, peas, cowpeas, and common beans, to improve the plant height, grain weight, oil content, and protein content of these crops, and to cultivate superior seeds.

[0031] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments.

[0032] Example 1: Cloning of the GmSW10 gene

[0033] In this embodiment, the GmSW10 gene was cloned. The specific steps are as follows:

[0034] 1. Total RNA was extracted from Williams82 soybean seeds using the RNAprep Pure Plant Kit. cDNA was obtained by reverse transcription using the PrimeScript™ II 1st strand cDNA Synthesis (TaKaRa) kit and used as a cloning template.

[0035] 2. PCR amplification was performed using primers SW10-F (SEQ ID NO:3) and SW10-R (SEQ ID NO:4). The reaction system (40 μl) is shown in Table 1 below:

[0036] SW10-F(SEQ ID NO:3):ATGACTCTCATGACTCCTCCTCCA

[0037] SW10-R(SEQ ID NO:4):ATCATAGATTTTTACAGCCTTCTCGTG

[0038] Table 1

[0039]

[0040]

[0041] The PCR amplification conditions were as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 sec; 58℃ annealing for 30 sec; 72℃ extension for 4 min; 36 cycles; 72℃ extension for 5 min.

[0042] 3. After gel extraction and recovery of the PCR products, TA cloning was performed, followed by transformation into Top10 competent cells. Clones that tested positive by PCR were selected for culture culture and plasmid extraction. After enzyme digestion verification, the samples were sent to the company for sequencing.

[0043] Sequencing results showed that the CDS length of GmSW10 is 3366 bp (SEQ ID No. 1), encoding 1122 amino acids (SEQ ID No. 2). Blast and homology alignment revealed that this gene encodes a UBP family deubiquitinase.

[0044] CDS sequence of GmSW10 (SEQ ID NO.1):

[0045]

[0046] The amino acid sequence of GmSW10 (SEQ ID NO.2):

[0047]

[0048] Example 2: Construction of GmSW10 knockout vector

[0049] In this embodiment, a knockout vector for the GmSW10 gene was constructed. The specific steps are as follows:

[0050] 1. The two knockout target sequences of the GmSW10 gene are as follows:

[0051] Target 1 (SEQ ID NO:5): TCTGTGTAGGGGGCTATAAG

[0052] Target 2 (SEQ ID NO:6): CTGTGCGTAAAGATATGGAT.

[0053] 2. Using the intermediate vector pHLW-gRNA-tRNA as a template, PCR was performed using the designed forward and reverse adapter primers as follows. The adapter primer sequences are as follows:

[0054] GmSW10-Cas9-F(SEQ ID NO:7):

[0055] GGTCTCTTGCATCTGTGTAGGGGGCTATAAGGTTTCAGAGCTATGCTGGA

[0056] GmSW10-Cas9-R(SEQ ID NO:8):

[0057] GGTCTCTATCCATATCTTTACGCACAGTGCACCAGCCGGGAATCGA

[0058] The PCR system (40 μL) is shown in Table 2 below:

[0059] Table 2

[0060] PCR Mix (GenStar cat#A012-101) 20μL Template 0.01 μg / μL cDNA 2μL Primer GmSW10-Cas9-F 1.5μL Primer GmSW10-Cas9-R 1.5μL <![CDATA[ddH2O]]> 15μL

[0061] The PCR amplification conditions were as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 sec; 55℃ annealing for 30 sec; 72℃ extension for 20 s, 34 cycles; 72℃ extension for 5 min.

[0062] 3. Purify the PCR products according to the kit instructions.

[0063] 4. Cyclic enzyme digestion and ligation:

[0064] Add approximately 20–70 ng of PCR product and approximately 80–100 ng of undigested pPTG-gRNA-Cas9 vector plasmid to a 15 μL reaction system, and digest with 10 U BsaI at 37 °C for 15 min. Then add 0.5 μL of 10×NEB T4 DNA ligase buffer and 0.1 μL of 35 U ligase, and perform 12 cycles of variable-temperature cyclic digestion and ligation: 37 °C for 2 min, 10 °C for 3 min, 20 °C for 5 min; and finally 37 °C for 2 h.

[0065] 5. Transformation and identification of competent states:

[0066] The ligation product was transformed into E. coli Top10 competent cells and plated. Positive clones were picked and cultured in LB broth containing the corresponding antibiotics. PCR identification and sequencing were performed using primers SP-DL (SEQ ID NO:9) and SP-R (SEQ ID NO:10) to obtain the GmSW10 knockout vector.

[0067] SP-DL(SEQ ID NO:9):GTCGTGTCCACATGTTGACCGG

[0068] SP-R (SEQ ID NO: 10): CCCGACATAGATGCAATAACTTC.

[0069] Example 3: Agrobacterium-mediated transformation of soybeans

[0070] The Agrobacterium-mediated transformation of soybeans in this embodiment includes the following steps:

[0071] 1. Obtaining soybean explants

[0072] Williams82 soybean seeds with smooth surfaces, free from cracks, disease spots, and mold were sterilized with chlorine for 10-14 hours, and then cultured in the dark on MS basal medium. After germination, the two cotyledons were cut along the midline in a clean bench, the two original leaf buds were removed, and a wound about 3 mm long was made at the junction of the cotyledon and hypocotyl.

[0073] 2. Soybean genetic transformation

[0074] Agrobacterium-mediated genetic transformation was used to infect soybean callus with the EHA101 strain carrying the GmSW10 knockout vector, and transgenic plants were obtained after induction culture.

[0075] 3. Screening for heritable transgenic plants

[0076] T0 generation transgenic positive plants were screened by spraying glufosinate (160 mg / L). After PCR identification of the positive plants, T1 generation transgenic plants were obtained through propagation. Total DNA was extracted from the leaves of T2 generation homozygous transgenic plants. Primers F1 (SEQ ID NO:11), R1 (SEQ ID NO:12) and F2 (SEQ ID NO:13), R2 (SEQ ID NO:14) were used to amplify the sequences before and after the targeting site. Sequencing verification yielded two homozygous lines, gmsw10-1 and gmsw10-2, with specific editing methods as follows: Figure 1 As shown.

[0077] F1 (SEQ ID NO:11): TGGTTATTGGGGTCGAGTTGA

[0078] R1 (SEQ ID NO:12): TCAATGAATAACAGCTGCAACGA

[0079] F2 (SEQ ID NO:13): GTTCAATGCACGTGAGAGCG

[0080] R2 (SEQ ID NO: 14): GCCATCATGAAAAACCAGTACCT.

[0081] 4. Quality assessment of transgenic plants

[0082] Phenotypic observation of two types of soybean seeds with knockout ( Figure 2 The determination of 100-grain weight, oil and protein content, and plant height was also performed. Figure 3 The results showed that compared to the cultivated soybean Williams82, all knockout types (gmsw10-1 and gmsw10-2) exhibited smaller seeds, significantly reduced 100-seed weight, and significantly increased protein content in the seeds, accompanied by decreased oil content and plant height. These results indicate that GmSW10 can suppress seed size, and this gene plays an important role not only in regulating seed size, oil content, and protein content, but also in regulating soybean plant height. This suggests that the GmSW10 gene is a key gene regulating soybean plant height, seed weight, oil content, and protein content, providing a new genetic resource for soybean genetic improvement.

[0083] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0084] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. Application of the soybean GmSW10 gene in reducing soybean plant height, grain weight, oil content and / or increasing protein content; the CDS sequence of the soybean GmSW10 gene is shown in SEQ ID NO:

1.

2. Application of the soybean GmSW10 gene in the breeding of soybeans with dwarf plants, small grain weight, low oil content and / or high protein content; the CDS sequence of the soybean GmSW10 gene is shown in SEQ ID NO:

1.

3. Application of the protein encoded by the soybean GmSW10 gene in the breeding of soybeans with dwarf plants, small grain weight, low oil content and / or high protein content; the amino acid sequence of the protein encoded by the soybean GmSW10 gene is shown in SEQ ID NO:

2.

4. Application of the protein encoded by the soybean GmSW10 gene in reducing soybean plant height, grain weight, oil content and / or increasing protein content; the amino acid sequence of the protein encoded by the soybean GmSW10 gene is shown in SEQ ID NO:

2.

5. Application of the soybean GmSW10 gene knockout vector in reducing soybean plant height, grain weight, oil content and / or increasing protein content; the CDS sequence of the soybean GmSW10 gene is shown in SEQ ID NO:

1.

6. The application as described in claim 5, characterized in that, The knockout target sites of the GmSW10 gene knockout vector are shown in SEQ ID NO:5 and SEQ ID NO:

6.

7. The application as described in claim 5, characterized in that, The soybean GmSW10 gene knockout vector was constructed through the following steps: Using pHLW-gRNA-tRNA as a template, SEQ ID NO:7 and SEQ ID NO:8 as primers, PCR amplification and purification were performed. The PCR product and pPTG-gRNA-Cas9 vector plasmid were digested with enzymes, ligated by cyclic enzyme digestion, and transformed into plasmid. Positive clones were picked and plasmids were extracted to obtain the soybean GmSW10 gene knockout vector.

8. Application of recombinant engineered bacteria transformed with a soybean GmSW10 gene knockout vector in reducing soybean plant height, grain weight, oil content and / or increasing protein content; the CDS sequence of the soybean GmSW10 gene is shown in SEQ ID NO:

1.

9. A method for reducing soybean plant height, grain weight, oil content, and / or increasing soybean protein content, characterized in that, Includes the following steps: The soybean GmSW10 gene was knocked out in soybeans, and the CDS sequence of the soybean GmSW10 gene is shown in SEQ ID NO:

1.

10. The method as described in claim 9, characterized in that, The method for knocking out the soybean GmSW10 gene in soybeans includes the following steps: Recombinant engineered bacteria transformed with a soybean GmSW10 gene knockout vector were transferred into soybean callus to obtain soybean GmSW10 gene knockout lines.

Images