Application of soybean GmVQ70 in improving soybean cyst nematode resistance

Abstract

The invention discloses application of soybean GmVQ70 to improvement of soybean cyst nematode resistance, relates to the technical field of genetic engineering, and solves the problems that existing chemical control pollutes the environment and is difficult to implement crop rotation, and traditional breeding is long in period and prone to loss of resistance. The method comprises the following steps: 1, constructing an overexpression vector of the GmVQ70 gene to obtain a transformed strain; and 2, infecting soybean plant tissues by the transformed strain. The invention proves that the soybean GmVQ70 gene has the effect of regulating and controlling soybean cyst nematode resistance of soybeans for the first time. A receptor soybean plant is subjected to genetic transformation by using an overexpression vector of the GmVQ70 gene, and after soybean cyst nematode infection, the number of soybean root surface female insects can be remarkably reduced by 38.4% compared with a wild type, so that the resistance of soybeans to soybean cyst nematode is improved, and a gene resource is provided for soybean resistance breeding. The application and the method of the GmVQ70 gene play a key role in improving the resistance process of soybean cyst nematode, and a new molecular target can be provided for soybean precise molecular design breeding.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to the application of the soybean GmVQ70 gene in improving soybean cyst nematode resistance. Background Technology

[0002] Soybean cyst nematode (SCN) is a highly destructive global disease. Field SCN populations are predominantly composed of mixed physiological races, exhibiting significant variations, making control increasingly difficult. Current SCN control primarily relies on chemical control, but pesticide residues harm human health and the environment, and resistance issues reduce efficacy. Biological control is unstable due to environmental changes; traditional breeding methods are time-consuming and prone to resistance loss. In contrast, molecularly assisted breeding for disease resistance is economical and efficient, representing the most promising control strategy. However, existing soybean resistance resources are limited, and long-term cultivation can lead to changes in SCN physiological races, overcoming resistance gene defenses and exacerbating resistance loss. Therefore, identifying new SCN resistance gene resources and breeding broad-spectrum resistant varieties are crucial for improving long-term SCN control.

[0003] VQ proteins are a class of transcriptional co-regulatory factors containing the conserved domain FxxxVQxxTG, playing a crucial role in plant responses to biotic and abiotic stresses. VQ proteins have been extensively studied in various plants, including Arabidopsis, tomato, and wheat, and play key regulatory roles in salt stress, the jasmonic acid (JA) signaling pathway, and disease resistance. However, research on their application in soybean nematode resistance is still lacking, particularly regarding the effects of GmVQ70 gene overexpression on soybean cyst nematode resistance. Summary of the Invention

[0004] To address the problems of environmental pollution from chemical control, difficulties in implementing crop rotation, and long breeding cycles and easy loss of resistance in existing soybean cyst nematode control methods, this invention provides an application of the soybean GmVQ70 gene in improving soybean cyst nematode resistance, and provides a method for improving soybean resistance to soybean cyst nematode using this gene.

[0005] This invention relates to the application of the soybean GmVQ70 gene in enhancing soybean cyst nematode resistance.

[0006] Furthermore, the application of the soybean GmVQ70 gene in improving soybean cyst nematode resistance is investigated using the following steps to enhance soybean resistance to cyst nematodes:

[0007] I. Construct an overexpression vector for the GmVQ70 gene and transform it into Agrobacterium competent cells to obtain a transformed strain. The nucleotide sequence of the GmVQ70 gene is shown in SEQ ID NO:1.

[0008] 2. The transformed strain obtained in step one was used to infect soybean plant tissues, and transgenic soybean plants were obtained through plant tissue culture.

[0009] Furthermore, the overexpression vector backbone described in step one is the pCAMBIA1300-eGFP vector.

[0010] Furthermore, in step one, the overexpression vector is constructed as follows: using soybean genomic cDNA as a template, PCR amplification is performed using primers GmVQ70-F and GmVQ70-R to obtain PCR products; the PCR products are then amplified a second time using homologous recombination primers GmVQ70OE-F and GmVQ70OE-R, and after amplification, homologous recombination is performed with the pCAMBIA1300-eGFP vector to obtain the overexpression vector of the GmVQ70 gene.

[0011] The nucleotide sequence amplified by GmVQ70-F / R is shown in SEQ ID NO:2; the nucleotide sequence amplified by GmVQ70OE-F / R is shown in SEQ ID NO:3.

[0012] Furthermore, the Agrobacterium mentioned in step one is Agrobacterium K599.

[0013] Furthermore, the site of infection described in step two is the hypocotyl of soybean.

[0014] The beneficial effects of this invention are:

[0015] This invention constructed an overexpression vector for the soybean GmVQ70 gene and transformed it into Agrobacterium competent cells. The transformed engineered bacteria were then used to infect soybean root tissue, and successfully transformed soybean hairy roots were obtained through tissue culture. Twenty-one days after infection with soybean cyst nematodes, the number of first-generation female soybean nematodes significantly decreased. This invention demonstrates that, compared to wild-type soybean plants, soybean plants overexpressing the GmVQ70 gene exhibit significantly enhanced resistance to soybean cyst nematodes. This invention is the first to confirm that the soybean GmVQ70 gene plays a regulatory role in soybean resistance to soybean cyst nematodes. Genetic transformation of recipient soybean plants using the GmVQ70 gene overexpression vector, followed by infection with soybean cyst nematodes, significantly reduced the number of female soybean root nematodes by 38.4% compared to the wild type, thereby enhancing soybean resistance to soybean cyst nematodes and providing genetic resources for soybean resistance breeding. The application and method of the GmVQ70 gene described in this invention play a key role in improving soybean cyst nematode resistance and can provide a new molecular target for precision molecular design breeding of soybean. This invention solves the problems of environmental pollution from chemical control, difficulty in implementing crop rotation, and long breeding cycles and easy loss of resistance in the prevention and control of soybean cyst nematode disease. Attached Figure Description

[0016] Figure 1 The homologous recombination sequence of Example 1 is (SEQ ID NO:3, the underlined part shows the adapter and the corresponding restriction site).

[0017] Figure 2 This is a schematic diagram of the structure of the pCAMBIA1300-eGFP vector shown in Example 1;

[0018] Figure 3 This is a comparison diagram of the root status of wild-type soybean plants (EV) and transgenic soybean plants (GmVQ70-OE) that overexpress the GmVQ70 gene, as shown in Example 2.

[0019] Figure 4 The results show the gene expression levels of wild-type soybean plants (EV) and transgenic soybean plants overexpressing the GmVQ70 gene (GmVQ70-OE) as shown in Example 3.

[0020] Figure 5 The above represents the statistical results of the average number of female insects on the root surface of each soybean plant in wild-type soybean plants (EV) and transgenic soybean plants overexpressing the GmVQ70 gene (GmVQ70-OE) as shown in Example 3. Detailed Implementation

[0021] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0022] It should be noted that, unless otherwise specified, the embodiments and features described in the present invention can be combined with each other.

[0023] Example 1: Construction of a soybean GmVQ70 gene overexpression vector

[0024] 1. Primer design

[0025] Based on the transcription of the soybean GmVQ70 gene (SEQ ID NO:2: CTTCTTCACTCTTAGTTTCTC) using Glyma.19G125300.1, the gene was transcribed into the soybean GmVQ70 gene. ATGGCATCATCTCAGAACGTAGCCAGCATTGAGCCATGGATGCTTCGCCCACCTGTCACCGATTCATGGCT CGCAGAGTTCTTCGCTCGCGACGCCGATACCCTAACCAGGGCTCTTCAGAAGTCTCTCTCCGGCGCTGTTCTGCCG CAGGACAACCACCTTTCTCCGTTTCTGCACCAGCCCGCCGCCGCCGCCGCCACCCCCACCGTGTCCAGCCTCTCCG GCTCCGACCAGGAATCGGCGCCGCGCCGCCGTGCGGCGCCTCCGCCCTCTGGGAAGATCTCCAAGAGGAAGTCGCG CGCCTCGAAGCGCTCGCAGACGACGTTCATCACCGCGGACCCCGCCAACTTCCGGCAGATGGTCCAGCAGGTTACC GGCGTGCGGTTCGGCGGCGCGCCAATTGCGCCGGCGGCGGTGGTGAAGCCCGAGCCGCAGCGCGCCTCGGGCCTCG CCAGGTTCCCCGCCGGCGTGGGGTGCCTTCCGACGCTCGACACGTCGGCCTTCCTGCTGGACCATCACCAGCAGCA GGTGGTGCCCGCCTCTGTTAACTCTGGGCCTGGCACCGGGCTTTCTGGGCCCGGCCCACTCCCCTTCGCCCAACCC CTCCTTGACGCTCACGCTGCTTCCTTCGCTTCCTCAGGGTTAGATTTTGACACCTTCTCCAACTTCCCCACTCTCG AGTCGTGGAAAGTCATGTGADesign primers for the primer pair (GAGAGAAAAAAATATTGAGAATTTGAGATGAGATAGATTCGCTG), with the specific sequences as follows:

[0026] GmVQ70-F (SEQ ID NO:5):

[0027] 5'-CTTCTTCACTCTTAGTTTCTCATGGCATC-3'

[0028] GmVQ70-R (SEQ ID NO:6):

[0029] 5'-CAGCGAATCTATCTCATCTCAAATTCTCA-3'

[0030] Further design of primer sequences for homologous recombination, Figure 1 Homologous recombination sequences (such as SEQ ID NO:3: ATTTGTTGACTCGACA) GTCGACATGGCATCATCTCAGAACGTAGCCAGCATTGAGCCATGGATGCTTCGCCCACCTGTCACCGATTCATGGCTCGCAGAGTTCTTCGCTCGCGACGCCGATACCCTAACCAGGGCTCTTCAGAAGTCTCTCTCCGGCGCTGTTCTGCCGCAGGACAACCACCTTTCTCCGTTTCTGCACCAGCCCGCCGCCGCCGCCGCCACCCCCACCGTGTCCAGCCTCTCCGGCTCCGACCAGGAATCGGCGCCGCGCCGCCGTGCGGCGCCTCCGCCCTCTGGGAAGATCTCCAAGAGGAAGTCGCGCGCCTCGAAGCGCTCGCAGACGACGTTCATCACCGCGGACCCCGCCAACTTCCGGCAGATGGTCCAGCAGGTTACCGGCGTGCGGTTCGGCGGCGCGCCAATTGCGCCGGCGGCGGTGGTGAAGCCCGAGCCGCAGCGCGCCTCGGGCCTCGCCAGGTTCCCCGCCGGCGTGGGGTGCCTTCCGACGCTCGACACGTCGGCCTTCCTGCTGGACCATCACCAGCAGCAGGTGGTGCCCGCCTCTGTTAACTCTGGGCCTGGCACCGGGCTTTCTGGGCCCGGCCCACTCCCCTTCGCCCAACCCCTCCTTGACGCTCACGCTGCTTCCTTCGCTTCCTCAGGGTTAGATTTTGACACCTTCTCCAACTTCCCCACTCTCGAGTCGTGGAAAGTCATG TCTAGA GGATCCGCTCGAATT, the underlined part is the linker and the corresponding restriction sites), and the specific sequences of the primer pairs are as follows:

[0031] GmVQ70OE-F (SEQ ID NO:7):

[0032] 5’-ATTGTTGACTCGACA GTCGAC ATGGCATCATCTCAGAACGTAGC-3’

[0033] GmVQ70OE-R (SEQ ID NO:8):

[0034] 5’-AATTCGAGCGGATCC TCTAGACATGACTTTCCACGACTCGAGA-3'

[0035] Simultaneously, primer sequences for identifying recombinant clones were designed. The specific primer pairs are as follows:

[0036] OE-F (SEQ ID NO:9):

[0037] 5'-GGGACCTAATCGATTTCGAGAGATATTGCT-3'

[0038] OE-R (SEQ ID NO:10):

[0039] 5'-AAGCCTGGAATCGTCCATACTGGAATAG-3'

[0040] 2. Construction of pCAMBIA1300-eGFP-GmVQ70 recombinant plasmid

[0041] (1) PCR amplification of GmVQ70

[0042] Using soybean genomic cDNA as a template, PCR amplification was performed using primers GmVQ70-F / R to obtain the GmVQ70 gene fragment (underlined) as shown in SEQ ID NO:2, with a fragment length of 699 bp. Using the above product as a template, a second PCR amplification was performed using primers GmVQ70OE-F / R to obtain the gene sequence with homologous arms as shown in SEQ ID NO:3. The reaction system and amplification procedure for the two PCR reactions were the same, as shown in Tables 1 and 2.

[0043] Table 1 PCR amplification reaction system

[0044] Component Dosage ddH2O 19 μl 2 × Phanta Max Master Mix 25 μl Forward primer (10 μM) 2 μl Reverse primer (10 μM) 2 μl Template 2 μl

[0045] Table 2 PCR amplification reaction procedure

[0046]

[0047] (2) Gel electrophoresis detection

[0048] Five μL of the PCR amplification product was analyzed by agarose gel electrophoresis. The target bands obtained from the two PCR reactions were 764 bp and 738 bp, respectively, indicating that the GmVQ70 gene and the sequence with homologous arms were successfully amplified.

[0049] (3) Purification of PCR amplification products

[0050] The amplified products were purified using a second PCR product purification kit with homologous arms. The kit was the FastPure® Gel DNA Extraction Mini Kit (model DC301) manufactured by Nanjing Novizan Biotechnology Co., Ltd. The specific purification steps are as follows:

[0051] ① After DNA electrophoresis, quickly cut the gel containing the target DNA fragment under ultraviolet light and weigh the gel.

[0052] ② Add Buffer GDP in equal volume, and incubate in a 55°C water bath for 10 min until the gel block is completely dissolved. During this process, invert and mix twice to accelerate the dissolution of the gel.

[0053] ③ Collect droplets from the tube wall by brief centrifugation, place the FastPure DNA Mini Columns-G adsorption column in a 2 mL collection tube, transfer the sol solution to the adsorption column, and centrifuge at 12,000 rpm (13,800 × g) for 30 s;

[0054] ④ Discard the filtrate, place the adsorption column in the collection tube, add 300 µL of Buffer GDP to the adsorption column, let stand for 1 min, and then centrifuge at 12,000 rpm (13,800 × g) for 30 s.

[0055] ⑤ Discard the filtrate, place the adsorption column in the collection tube, add 700 µL of Buffer GW containing anhydrous ethanol to the adsorption column, and centrifuge at 12,000 rpm (13,800 × g) for 30 s;

[0056] ⑥ Repeat step ⑤;

[0057] ⑦ Discard the filtrate, place the adsorption column back into the collection tube, and centrifuge at 12,000 rpm (13,800 × g) for 2 min;

[0058] ⑧ Place the adsorption column in a 1.5 mL sterile centrifuge tube, add 30 µL of Elution Buffer to the center of the adsorption column, let stand for 2 min, then centrifuge at 12,000 rpm (13,800 × g) for 1 min, discard the adsorption column, and store the eluted DNA at -20℃ for later use.

[0059] (4) Homologous recombination linkage

[0060] The pCAMBIA1300-eGFP vector carrying the 35S promoter and GFP tag ( (A schematic diagram of the pCAMBIA1300-eGFP vector is shown.) The vector was double-digested with restriction endonucleases XbaⅠ and BamHI to obtain the digested product. Homologous recombination ligation was performed using the ClonExpress® II One Step Cloning Kit (model C112) from Nanjing Novizan Biotechnology Co., Ltd. Specifically, the vector digested product, the purified PCR amplification product, and the homologous recombinase were mixed according to the reaction system shown in Table 3, and reacted at 37℃ for 30 min to obtain the ligation product.

[0061] Table 3 Homologous recombination reaction system

[0062]

[0063] (5) Transformation of Escherichia coli competent cells

[0064] ① Take 50 μL of frozen DH5α competent cells (Shanghai Weidi Biotechnology Co., Ltd.), add 10 μL of the ligation product obtained in step (4), gently tap the bottom of the EP tube to mix (avoid using a pipette), and let stand on ice for 25 min.

[0065] ② Heat shock in a 42℃ water bath for 45 seconds, then quickly return to ice and let stand for 2 minutes;

[0066] ③ Add 700 μL of antibiotic-free sterile LB medium to the centrifuge tube and mix well. Incubate at 37°C and 200 rpm for 60 min.

[0067] ④ Centrifuge at 5000 rpm for 1 min to collect the bacterial cells, keep about 100 μL of supernatant, gently pipette to resuspend the bacterial block, and spread it on LB agar plates containing kanamycin.

[0068] ⑤ Invert the plate and incubate it overnight in a 37 ℃ incubator.

[0069] Single colonies grown on the above plates were identified by colony PCR using the vector primers OE-F / R. The reaction system is shown in Table 4. Single colonies were picked up with a pipette tip and mixed into the reaction system before PCR reaction. The reaction procedure is shown in Table 5. After the PCR reaction, the products were identified by electrophoresis. Positive clones should yield a 1608 bp PCR product (SEQ ID NO:4: GGGACCTAATCGATTTCGAGAGATATTGCTCAGATCTGTTAGCAACTGCCTTGTTTGTTGATTCTATTGCCGTGGATTAGGGTTTTTTTTCACGAGATTGCTTCAGATCCGTACTTAAGATTACGTAATGGATTTTGATTCTGATTTATCTGTGATTGTTGACTCGACAGTCGACATGGGGTTAATTAACGGTGAACAAAAGCTAATCTCCGAGGAAGACTTGAACGGTGAACAAAAATTAATCTCAGAAGAAGACTTGAACGGACTCGACGGTGAACAAAAGTTGATTTCTGAAGAAGATTTGAACGGTGAACAAAAGCTAATCTCCGAGGAAGACTTGAACGGTAGCGCTAAGAGCTCGAATTTCCGGCGCGCC). Figure 2ATGGCATCATCTCAGAACGTAGCCAGCATTGAGCCATGGATGCTTCGCCCACCTGTCACCGATTCATGGCTCGCAGAGTTCTTCGCTCGCGACGCCGATACCCTAACCAGGGCTCTTCAGAAGTCTCTCTCCGGCGCTGTTCTGCCGCAGGACAACCACCTTTCTCCGTTTCTGCACCAGCCCGCCGCCGCCGCCGCCACCCCCACCGTGTCCAGCCTCTCCGGCTCCGACCAGGAATCGGCGCCGCGCCGCCGTGCGGCGCCTCCGCCCTCTGGGAAGATCTCCAAGAGGAAGTCGCGCGCCTCGAAGCGCTCGCAGACGACGTTCATCACCGCGGACCCCGCCAACTTCCGGCAGATGGTCCAGCAGGTTACCGGCGTGCGGTTCGGCGGCGCGCCAATTGCGCCGGCGGCGGTGGTGAAGCCCGAGCCGCAGCGCGCCTCGGGCCTCGCCAGGTTCCCCGCCGGCGTGGGGTGCCTTCCGACGCTCGACACGTCGGCCTTCCTGCTGGACCATCACCAGCAGCAGGTGGTGCCCGCCTCTGTTAACTCTGGGCCTGGCACCGGGCTTTCTGGGCCCGGCCCACTCCCCTTCGCCCAACCCCTCCTTGACGCTCACGCTGCTTCCTTCGCTTCCTCAGGGTTAGATTTTGACACCTTCTCCAACTTCCCCACTCTCGAGTCGTGGAAAGTCATG GTCGAC A).

[0070] Table 4 PCR identification reaction system

[0071]

[0072] Table 5 PCR identification reaction procedure

[0073]

[0074] (6) Positive plasmid extraction and sequencing

[0075] Positive plasmid DNA was extracted using a method combining alkaline lysis and column purification. The specific steps are as follows:

[0076] ① Take 5 mL of positive bacterial culture that has been cultured overnight (12-16 h) and add it to a centrifuge tube. Centrifuge at 10,000 rpm (11,500 × g) for 1 min, discard the culture medium, and invert the tube onto absorbent paper to remove any remaining liquid.

[0077] ② Add 250 μL of Buffer P1 containing RNase A to the bacterial pellet and mix well by pipetting.

[0078] ③ Add 250 μL of Buffer P2 to step ② and gently invert the container 10 times to fully lyse the bacteria;

[0079] ④ Add 350 μL of Buffer P3 to step ③, immediately and gently invert 10 times to neutralize Buffer P2, and centrifuge at 12,000 rpm (13,400 × g) for 10 min;

[0080] ⑤ Place the FastPure DNA Mini Columns in a 2 mL Collection Tube, carefully transfer the supernatant from step ④ into the adsorption column, centrifuge at 12,000 rpm (13,400 × g) for 30 s, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube.

[0081] ⑥ Add 600 μL of Buffer PW2 diluted with anhydrous ethanol to the adsorption column, centrifuge at 12,000 rpm (13,400 × g) for 30 s, discard the waste liquid, and put the adsorption column back into the collection tube.

[0082] ⑦ Repeat step ⑥;

[0083] ⑧ Place the adsorption column back into the collection tube and centrifuge at 12,000 rpm (13,400 × g) for 1 min to dry the adsorption column and remove residual washing solution;

[0084] ⑨ Place the adsorption column in a new 1.5 mL sterile centrifuge tube, add 50 μL of Elution Buffer to the center of the adsorption membrane, let stand at room temperature for 2 min, and then centrifuge at 12,000 rpm (13,400 × g) for 1 min to elute the DNA;

[0085] ⑩ Discard the adsorption column and store the eluted plasmid DNA at -20℃ for later use.

[0086] The extracted positive plasmids can be sent for bidirectional sequencing to verify the correctness of the inserted fragment sequence. Sequencing yielded the sequence shown in SEQ ID NO:4, with the underlined restriction enzyme sites representing the inserted codon-removed GmVQ70 gene sequence (696 bp in length), which is consistent with the maintenance sequence of SEQ ID NO:1.

[0087] Example 2: Transformation of soybean by overexpression of hairy roots

[0088] 1. Plasmid transformation of Agrobacterium K599

[0089] ① Take out 50 μL of frozen K599 competent cells, thaw them on ice, add 1 μL of the sequenced plasmid obtained in Example 1, gently stir and mix with a pipette tip, and place on ice for 30 min.

[0090] ② After quick freezing in liquid nitrogen for 5 min, heat shock at 37℃ for 5 min, then cool in ice for 2 min;

[0091] ③ Add 800 μL of antibiotic-free LB liquid medium and incubate at 28°C and 150 rpm for 4 h.

[0092] ④ Take 100 μL of the shaken bacterial culture and spread it evenly on LB solid medium (containing 50 mg / mL kanamycin and streptomycin), incubate at 28℃ upside down for 2 days until single colonies grow;

[0093] ⑤ Colony PCR detection to determine whether the plasmid was successfully transformed into Agrobacterium K599;

[0094] ⑥ Select positive colonies and inoculate them into 5 mL of LB liquid medium containing the corresponding antibiotic. Incubate overnight at 28°C and 200 rpm. Take the incubated bacterial solution and add an equal volume of 30% glycerol for preservation. Store at 80°C for hairy root transformation.

[0095] 2. Transformation of soybean hairy roots and plant culture

[0096] ① The seeds of soybean Dongsheng 1 were surface sterilized with chlorine in a desiccator for 16 h (96 mL sodium hypochlorite plus 6 mL hydrochloric acid). After sterilization, the soybean seeds were placed in a sterile ultra-clean workbench and the residual chlorine was blown away with air.

[0097] ② Sow the chlorine-sterilized soybean seeds in a culture pot (5 cm × 5 cm × 10 cm) containing sterilized vermiculite (soaked in sterile water). The vermiculite covers the seeds to a thickness of about 2 mm. Place the culture pot in a tray.

[0098] ③ Place the tray in a climate chamber with constant temperature and humidity conditions of 28℃ / 16 h light and 24℃ / 8 ​​h darkness. After culturing for 5-6 days, make a slanted cut with sterile scissors 1 cm below the cotyledon node of the soybean, with a wound length of about 0.5-1 cm.

[0099] ④ Dip the wound in K599 bacterial solution containing the target gene, transfer it to a new culture pot containing moistened sterilized vermiculite, with 4 soybean seedlings in each culture pot, and water with 10 mL of K599 bacterial solution containing the target gene. Finally, culture in a smart greenhouse with a temperature of 24-28℃ and a photoperiod of 16 h / 8 h (day / night).

[0100] ⑤ After 21 days of cultivation, soybean positive roots were screened using a portable dual-fluorescent protein observation flashlight (LUYOR-3415);

[0101] ⑥ Take 1-2 positive roots from each plant, wash them with physiological saline, dry them with sterile filter paper, wrap them with aluminum foil, freeze them in liquid nitrogen for 1 hour, and then store them at -80℃ for RNA extraction and RT-qPCR verification of positive expression.

[0102] ⑦ Remove the negative roots of the soybean seedlings, carefully transfer the transgenic soybean seedlings with developed roots to disposable culture pots (8 cm × 12 cm) containing sterile sand in a 1:1 ratio, and allow the soybean roots to recover for 5-7 days. Then inoculate with soybean cyst nematodes. The obtained positive roots are shown below. TCTAG As shown ( Figure 3 A comparison of the root status of wild-type soybean plants (EV) and transgenic soybean plants overexpressing the GmVQ70 gene (GmVQ70-OE).

[0103] Example 3: Comparison of the number of female soybean cyst nematodes on the root surface of wild-type soybean plants and transgenic soybean plants after infection with soybean cyst nematodes.

[0104] 1. Detection of GmVQ70 gene expression level

[0105] Total RNA was extracted from 100 g of hairy root samples, and cDNA was synthesized. RNA extraction was performed using the TIANGEN RNAprep Pure Plant Plus Kit; cDNA synthesis was performed using the FastKing gDNADispelling RT SuperMix Kit.

[0106] Quantitative real-time PCR (qPCR) reactions were performed on a LightCycler® 480 system (Roche Life Sciences, USA), using Novizan Biosciences' ChamQ Universal SYBR qPCR Master Mix as the fluorescent dye. The reaction system is shown in Table 6, and the reaction procedure is shown in Table 7.

[0107] The results are as follows Figure 3 As shown ( Figure 4 The results show the gene expression levels of wild-type soybean plants (EV) and transgenic soybean plants overexpressing the GmVQ70 gene (GmVQ70-OE). The expression level of the GmVQ70 gene in transgenic soybean plants is significantly higher than that in wild-type soybean plants, indicating that the gene has been successfully transferred and expressed in the plants.

[0108] The primer sequences used for qPCR are as follows:

[0109] qGmVQ70-F (SEQ ID NO:11):

[0110] 5'-CCTTGACGCTCACGCTGCT-3'

[0111] qGmVQ70-R (SEQ ID NO:12):

[0112] 5'-CACGACTCGAGAGTGGGGAAG-3'

[0113] Table 6. Reaction system for qPCR detection of gene expression levels

[0114]

[0115] Table 7. qPCR reaction procedure for detecting gene expression levels

[0116]

[0117] 2. Soybean cyst nematode infection and female nematode count

[0118] The soybean cyst nematode race 5 (SCN5) used was collected in June 2017 from the field in Wuchang City, Heilongjiang Province, by members of the Farmland Pest Control Research Group of the Northeast Institute of Geography and Agroecology, Chinese Academy of Sciences (No. 138 Haping Road, Nangang District, Harbin, 150080, China). The race type was determined by host identification after single-cyst isolation, purification, and multiple generations of propagation. Wild-type soybean plants (transformed with an empty vector, EV) and transgenic soybean plants (transformed with the GmVQ70 gene overexpression vector) were inoculated with nematodes, with 1000 second-instar larvae (J2) inoculated per plant. The specific preparation and inoculation procedures are as follows:

[0119] ① Collect the sporangium soil and soybean root residue, and pour them together into a 5 L beaker containing tap water. Stir with a stirring rod to suspend the soil completely in the water and let it settle for about 30 seconds.

[0120] ② Pour the soil supernatant into a double sieve with an upper 20 mesh and a lower 100 mesh, collect the sporangia from the upper layer and rinse them clean;

[0121] ③ Transfer the sporangia to a double sieve with an upper 200 mesh (800 μm aperture) and a lower 500 mesh (150 μm aperture), gently break the sporangia with a rubber stopper, and gently flush the eggs to the lower sieve with a high-pressure water gun.

[0122] ④ Collect the eggs on a 500-mesh sieve with distilled water and place them in an incubation frame containing incubation filter paper. Place the incubation frame in sterile water containing 3 mM zinc sulfate to stimulate incubation, and incubate in a constant temperature incubator at 28℃.

[0123] ⑤ Two days after hatching, start collecting second-instar larvae (J2), observe them under a microscope and count the number of nematodes using a counting chamber, and dilute 1000 nematodes to 1-2 mL for inoculation;

[0124] ⑥ Make a hole on each side of the plant, 1 cm from the root, using a 1 mL syringe tip, with a hole depth of 4-5 cm;

[0125] ⑦ Use a 5 mL pipette to inoculate the nematode suspension into each of the two holes on both sides of the plant to complete the nematode inoculation.

[0126] Twenty-one days after inoculation, the roots were gently washed with tap water, and the number of female insects on the hairy root surface of individual GmVQ70-OE and EV plants was counted. Results are as follows: Figure 4 As shown ( Figure 5 Figure 5 The above is a statistical result of the average number of female soybean root nematodes per plant in wild-type soybean plants (EV) and transgenic soybean plants overexpressing the GmVQ70 gene (GmVQ70-OE) as shown in Example 3. The number of female soybean root nematodes in transgenic soybean plants was significantly reduced compared with wild-type soybean plants, with an average reduction of 38.4% per plant, indicating that overexpression of the GmVQ70 gene can significantly improve the resistance of soybean to soybean cyst nematode.

Claims

1. Application of a soybean GmVQ70 gene in improving soybean cyst nematode resistance.

2. The application of the soybean GmVQ70 gene in improving soybean cyst nematode resistance according to claim 1, characterized in that, The following steps can be used to improve soybean resistance to cyst nematodes: I. Construct an overexpression vector for the GmVQ70 gene and transform it into Agrobacterium competent cells to obtain a transformed strain. The nucleotide sequence of the GmVQ70 gene is shown in SEQ ID NO:

1.

2. The transformed strain obtained in step one was used to infect soybean plant tissues, and transgenic soybean plants were obtained through plant tissue culture.

3. The application of the soybean GmVQ70 gene in improving soybean cyst nematode resistance according to claim 1, characterized in that, The overexpression vector in step one has a backbone of pCAMBIA1300-eGFP.

4. The application of the soybean GmVQ70 gene in improving soybean cyst nematode resistance according to claim 1, characterized in that, The method for constructing the overexpression vector in step one is as follows: using soybean genomic cDNA as a template, PCR amplification is performed using primers GmVQ70-F and GmVQ70-R to obtain PCR products; The PCR product was amplified a second time using homologous recombination primers GmVQ70OE-F and GmVQ70OE-R. After amplification, it was ligated into the pCAMBIA1300-eGFP vector for homologous recombination to obtain an overexpression vector of the GmVQ70 gene.

5. The application of the soybean GmVQ70 gene in improving soybean cyst nematode resistance according to claim 3, characterized in that, The nucleotide sequence amplified by GmVQ70-F / R is shown in SEQ ID NO:2; the nucleotide sequence amplified by GmVQ70OE-F / R is shown in SEQ ID NO:

3.

6. The application of the soybean GmVQ70 gene in improving soybean cyst nematode resistance according to claim 1, characterized in that, The Agrobacterium mentioned in step one is Agrobacterium K599.

7. The application of the soybean GmVQ70 gene in improving soybean cyst nematode resistance according to claim 1, characterized in that, The site of infection described in step two is the hypocotyl of soybean.

Images