Combination of vitamins and oligosaccharides for enhancing bone growth and / or bone strength

Abstract

The present invention provides a combination of a vitamin mixture and an oligosaccharide mixture for use in enhancing bone growth and / or bone strength, for example, in children suffering from and / or being suffering from a growth retardation and / or a growth retardation.

Description

Technical Field

[0001] The present invention relates to compositions and methods for enhancing bone growth and / or bone strength in children, for example, those suffering from and / or currently suffering from growth retardation and / or slowed growth. Background Technology

[0002] Human bone growth and development require an adequate supply of many different nutrients. Classical nutritional deficiencies are associated with stunted growth (e.g., energy, protein, Zn), rickets (e.g., vitamin D), and other bone abnormalities (e.g., Cu, Zn, vitamin C). There is evidence that childhood growth patterns and nutritional exposure influence peak bone mass and later fracture risk. However, using bone health as a standard to define dietary reference values ​​is challenging, and the question of what type of diet constitutes optimal support for bone growth and development remains unanswered (see, for example, Prentice, A. et al., 2006. Proceedings of the Nutrition Society, 65(4), pp. 348-360).

[0003] Several approaches can be taken to improve the intake of growth-limiting nutrients, including the administration of micronutrient supplements, micronutrient fortification of food, or improvement of dietary intake. However, particularly in populations with poor dietary quality, several micronutrient deficiencies may occur simultaneously, in which case growth may be affected by more than one growth-limiting nutrient (see, for example, Rivera, JA et al., 2003. The Journal of Nutrition, 133(11), pp. 4010S-4020S).

[0004] Therefore, new nutritional interventions are needed to enhance bone growth and / or bone strength in children, for example, those with growth retardation and / or slowed growth. Summary of the Invention

[0005] The inventors have surprisingly discovered that the combination of vitamin K2, vitamin A, and vitamin D synergistically promotes osteoblast mineralization. Furthermore, the inventors have surprisingly discovered that the combination of vitamin K2, A, and D with short-chain fatty acids (SCFAs) synergistically promotes osteoblast differentiation. SCFAs can be produced, for example, through oligosaccharide fermentation in the gut.

[0006] In one aspect, the present invention provides a combination of a vitamin mixture and an oligosaccharide mixture for enhancing bone growth and / or bone strength in a subject, wherein the vitamin mixture comprises or consists of vitamin K2, vitamin A, and vitamin D.

[0007] In another aspect, the present invention provides the use of a combination of vitamin mixtures and oligosaccharide mixtures in the manufacture of a medical food product for enhancing bone growth and / or bone strength in a subject, wherein the vitamin mixture comprises or consists of vitamin K2, vitamin A, and vitamin D.

[0008] In another aspect, the present invention provides a method for enhancing bone growth and / or bone strength in a subject, the method comprising administering to the subject an effective amount of a combination of a vitamin mixture and an oligosaccharide mixture, wherein the vitamin mixture comprises or consists of vitamin K2, vitamin A, and vitamin D.

[0009] The subject can be any suitable subject; specifically, the subject can be a child or adolescent. The subject can be a human child. For example, the subject can be someone approximately 3 years of age or older and / or approximately 10 years of age or younger. In some embodiments, the subject is someone approximately 3 years of age to approximately 10 years of age. Alternatively, the subject can be a young animal, such as a young pet. The subject may have and / or may be currently suffering from growth retardation and / or growth slowing. The subject may be preterm, have low birth weight, and / or have experienced intrauterine growth retardation.

[0010] The oligosaccharide mixture can be any suitable mixture of two or more oligosaccharides. For example, the oligosaccharide mixture may contain 2'-fucosylated lactose (2'FL) and at least one other oligosaccharide, or consist of the latter. Suitably, the at least one other oligosaccharide contains at least one sialylated oligosaccharide, at least one fucoidylated oligosaccharide, and / or at least one N-acetylated oligosaccharide, or consists of the latter. Suitably, the at least one sialylated oligosaccharide is selected from the group consisting of 3'-sialylated lactose (3'-SL), 6'-sialylated lactose (6'-SL), sialylated lactose-N-tetrasaccharide b (LSTb), sialylated lactose-N-tetrasaccharide c (LSTc), disialyllactose-N-tetrasaccharide, and combinations thereof. In some embodiments, the at least one sialylated oligosaccharide is selected from 3'-sialylated lactose (3'-SL), 6'-sialylated lactose (6'-SL), and combinations thereof. In some embodiments, at least one sialylated oligosaccharide is 6'-sialyl lactose (6'-SL). Suitably, at least one fucosylated oligosaccharide is selected from the group consisting of: 3-fucosylactose (3FL), difucosylactose (diFL), lactose-N-fucopentose-I (LNFP-I), lactose-N-fucopentose-II (LNFP-II), lactose-N-fucopentose-III (LNFP-III), lactose-N-fucopentose-V (LNFP-V), lactose-neofofucopentose V (LNnFP-V), lactose-N-difucosyhexose-I (LNDFH-1), lactose-N-neofodifucosyhexose (LNnDFH), monofucosylactose-N-hexose-III (MFNLH-III), difucosylactose-N-hexose-a (DFLNHa), and combinations thereof. In some embodiments, at least one fucoidylated oligosaccharide is difucosyllactose (diFL). Suitably, at least one N-acetylated oligosaccharide is selected from the group consisting of N-acetyl-glucosamine, N-acetyl-galactosamine, lactose-N-tetrasaccharide (LNT), lactose-N-neotetrasaccharide (LNnT), and combinations thereof. In some embodiments, at least one N-acetylated oligosaccharide is selected from lactose-N-tetrasaccharide (LNT), lactose-N-neotetrasaccharide (LNnT), and combinations thereof. In some embodiments, at least one N-acetylated oligosaccharide is both lactose-N-tetrasaccharide (LNT) and lactose-N-neotetrasaccharide (LNnT).Suitably, the oligosaccharide mixture comprises: (a) at least one sialylated oligosaccharide at about 10% to about 35% by weight, about 10% to about 30% by weight, or about 10% to about 25% by weight relative to the total weight of the oligosaccharide mixture; (b) at least one fucoidylated oligosaccharide at about 30% to about 80% by weight, about 40% to about 80% by weight, or about 50% to about 70% by weight relative to the total weight of the oligosaccharide mixture; and / or (c) at least one N-acetylated oligosaccharide at about 10% to about 35% by weight, about 15% to about 30% by weight, or about 15% to about 20% by weight relative to the total weight of the oligosaccharide mixture.

[0011] This combination can be administered via any suitable route. Appropriately, it is administered orally. It can be administered alone, simultaneously, or sequentially. In some embodiments, it is administered simultaneously.

[0012] This combination can be administered to the subject in any suitable amount. Appropriately, vitamin K2 is administered to the subject at a rate of about 5 µg / day to about 200 µg / day. Appropriately, vitamin A is administered to the subject at a rate of about 100 µg RE / day to about 1000 µg RE / day. Appropriately, vitamin D is administered to the subject at a rate of about 2.5 µg / day to about 100 µg / day. Appropriately, the oligosaccharide mixture is administered to the subject in a total amount of about 0.5 g / day to about 10 g / day. Appropriately, 2'FL is administered to the subject at a rate of about 0.5 g / day to about 5 g / day.

[0013] This combination can be provided in any suitable form (e.g., as a composition). This combination can be provided as a nutritional composition. This combination can be provided as a medical food product for clinical nutrition. This combination can be provided as a dairy formula.

[0014] The composition may contain any suitable combination of components. Suitably, the composition contains vitamin K2 in an amount from about 5 µg / 100g to about 200 µg / 100g based on dry weight. Suitably, the composition contains vitamin A in an amount from about 100 µg Reg / 100g to about 1000 µg RE / 100g based on dry weight. Suitably, the composition contains vitamin D in an amount from about 2.5 µg / 100g to about 20 µg / 100g based on dry weight. Suitably, the composition contains a mixture of oligosaccharides in a total amount from about 0.5 wt% to about 10 wt% based on dry weight. Suitably, the composition contains 2'FL in an amount from about 0.5 wt% to about 5 wt% based on dry weight.

[0015] This combination can synergistically enhance bone growth and / or bone strength. This combination can enhance bone mineralization. This combination can promote osteoblast mineralization and / or osteoblast differentiation. This combination can promote catch-up growth. Appropriately, catch-up growth is determined using a high rate of increase.

[0016] The inventors also surprisingly discovered that mixtures of human milk oligosaccharides (HMOs) promote the production of vitamin K2 in the gastrointestinal tract (e.g., via the conversion of vitamin K1).

[0017] In another aspect, the present invention provides the use of oligosaccharide mixtures in promoting vitamin K2 production in the gut of a subject. The oligosaccharide mixture can be any mixture described herein.

[0018] In another aspect, the present invention provides a method for promoting vitamin K2 production in the gut of a subject, the method comprising administering to the subject an effective amount of an oligosaccharide mixture. The oligosaccharide mixture may be any mixture described herein. Attached Figure Description

[0019] Figure 1 Vitamins K2, A, and D affect the activity of alkaline phosphatase (ALP) and osteocalcin in pre-osteoblast cell lines. Effect of mRNA levels

[0020] (A) ALP activity after 7 days of differentiation (without ascorbic acid). (B) Osteocalcin mRNA level after 21 days of differentiation (without ascorbic acid). (C) Osteocalcin mRNA level after 28 days of differentiation (with ascorbic acid). Pos = positive control; Neg = negative control; MK-7 = supplemented with 3µM methylnaphthoquinone-7; VitD = supplemented with 1nM 1α,25-dihydroxyvitamin D3; VitA = supplemented with 100nM all-trans retinoic acid.

[0021] Figure 2 Effects of Vitamins K2, A, D, and Short-Chain Fatty Acids (SCFAs) on ALP Activity in Preosteoblast Cell Lines ring

[0022] ALP activity after 7 days of differentiation (without ascorbic acid). Pos = positive control; Neg = negative control; MK-7+A+D = supplemented with 3µM methylnaphthoquinone-7, 1nM 1α,25-dihydroxyvitamin D3 and 100nM all-trans retinoic acid; SCFA 20μM = supplemented with 15µM sodium acetate, 4µM sodium propionate and 1µM sodium butyrate; SCFA 50μM = supplemented with 37.5µM sodium acetate, 10µM sodium propionate and 2.5µM sodium butyrate; SCFA 60μM = supplemented with 45µM sodium acetate, 12µM sodium propionate and 3µM sodium butyrate.

[0023] Figure 3 - Effects of human milk oligosaccharides (HMOs) on vitamin K2 production in an intestinal model

[0024] The following groups were evaluated: blank; single HMO (1.3 g / L 2 FL); and HMO mixture (2.5 g / L 2 FL, DiFL, LNnT, LNT and 6SL). Detailed Implementation

[0025] Preferred features and embodiments of the invention will now be described by way of non-limiting examples. Those skilled in the art will understand that they can combine all the features of the invention disclosed herein without departing from the scope of the invention as disclosed.

[0026] Any references to prior art literature in this specification should not be construed as an admission that such prior art is well-known or part of general common knowledge in the art. All publications mentioned in this specification are incorporated herein by reference.

[0027] As used in this specification, the words “including,” “comprising,” and similar terms should not be construed as having an exclusive or exhaustive meaning. In other words, they are intended to mean “including, but not limited to.” The terms “including / comprising” and similar terms also include the term “consisting of.”

[0028] Unless otherwise specified, the practice of this invention will employ conventional techniques within the capabilities of those skilled in the art. Such techniques are described in the literature. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art.

[0029] Numerical ranges include the numerical values ​​that define the range, and unless otherwise stated, all percentages disclosed herein are based on w / w. As used herein, the term “about” means approximately, nearby, roughly, or around. When the term “about” is used in conjunction with a numerical value or range, it modifies the value or range by extending the boundaries to be above and below the stated numerical value. Generally, the terms “about” and “approximately” are used herein to modify numerical values ​​above and below the stated value by 10%.

[0030] combination

[0031] In one aspect, the present invention provides a combination of a vitamin mixture and an oligosaccharide mixture for enhancing bone growth and / or bone strength in a subject.

[0032] The combinations of the present invention may be referred to as combination therapies. As used herein, “combination therapy” may refer to a therapy that includes the administration of two or more agents, mixtures (e.g., vitamin mixtures, oligosaccharide mixtures and / or probiotic mixtures), or compositions (e.g., vitamin mixtures, oligosaccharide mixtures and / or probiotics).

[0033] This combination can be administered by any suitable route and in any suitable form. Suitablely, the combination is administered orally and / or enterally. In a preferred embodiment, the combination is administered orally. The combination can be administered alone, simultaneously, or sequentially. In a preferred embodiment, the combination is administered simultaneously.

[0034] Vitamin Mixture

[0035] The combination of the present invention comprises a vitamin mixture. As used herein, a “vitamin mixture” may refer to a mixture of two or more vitamins. Vitamins are organic micronutrients required by the body to perform a range of normal functions and include vitamin K2, vitamin A, vitamin D, vitamin C, folic acid, vitamin B3, vitamin B6, vitamin B12, and vitamin E.

[0036] The vitamin mixture used in this invention comprises or consists of vitamin K2, vitamin A, and vitamin D. The inventors have surprisingly discovered that the combination of vitamin K2, vitamin A, and vitamin D synergistically promotes osteoblast mineralization.

[0037] Vitamin K2

[0038] Vitamin K2 (methylnaphthoquinone) is one of three types of vitamin K, the other two being vitamin K1 (phylloquinone) and K3 (menaquinone), and can have the following general formula:

[0039]

[0040] Vitamin K2 is composed of different forms with varying numbers (n) of isoprene units, ranging from 4 to 13. These forms are indicated by a suffix (-n), for example, methylnaphthoquinone-7 (MK-7) has seven isoprene units (n=7).

[0041] Suitablely, vitamin K2 comprises or consists of methylnaphthoquinone-4 (MK-4), methylnaphthoquinone-5 (MK-5), methylnaphthoquinone-6 (MK-6), methylnaphthoquinone-7 (MK-7), methylnaphthoquinone-8 (MK-8), and methylnaphthoquinone-9 (MK-9). Suitablely, vitamin K2 comprises or consists of methylnaphthoquinone-7 (MK-7), methylnaphthoquinone-8 (MK-8), and methylnaphthoquinone-9 (MK-9). In some embodiments, vitamin K2 comprises or consists of methylnaphthoquinone-7 (MK-7). In some embodiments, vitamin K2 consists of methylnaphthoquinone-7 (MK-7).

[0042] The inventors have surprisingly discovered that mixtures of human milk oligosaccharides (HMOs) promote the production of vitamin K2 in the gastrointestinal tract (e.g., via the conversion of vitamin K1).

[0043] In one aspect, the present invention provides the use of oligosaccharide mixtures in promoting the production of vitamin K2 in the intestine of a subject.

[0044] In one aspect, the present invention provides a method for promoting the production of vitamin K2 in the gut of a subject, the method comprising administering to the subject an effective amount of a mixture of oligosaccharides.

[0045] The oligosaccharide mixture can be any mixture described herein. In some embodiments, the oligosaccharide mixture comprises or consists of 2'-fucosylated lactose (2'FL), difucosylated lactose (diFL), 6'-sialylated lactose (6'-SL), lactose-N-tetrasaccharide (LNT), and lactose-N-neotetrasaccharide (LNnT).

[0046] In some embodiments, the oligosaccharide mixture promotes the de novo production of methylnaphthoquinone-7 in the subject's gut (e.g., via the gut microbiota). In some embodiments, the oligosaccharide mixture promotes the biotransformation from chloroquinone to methylnaphthoquinone-4 in the subject's gut (e.g., via the gut microbiota).

[0047] Vitamin A

[0048] Vitamin A comprises a family of molecules containing a 20-carbon structure with a methyl-substituted cyclohexenyl ring (β-ionone ring) and a tetraene side chain with a hydroxyl group (retinol), an aldehyde group (retinal), a carboxylic acid group (retinoic acid), or an ester group (retinyl ester) at carbon-15. The term vitamin A can also include provitamin A carotenoids, which are dietary precursors to retinol. Among the many carotenoids in nature, some possess provitamin A nutritional activity, including α-carotene, β-carotene, and β-cryptoxanthin.

[0049] The amount of vitamin A can be referred to as retinol equivalent (RE) or retinol activity equivalent (RAE). For the dietary provitamin A carotenoids β-carotene, α-carotene, and β-cryptoxanthin, the RE is set at 6 μg, 12 μg, and 12 μg, respectively. When using μg RAE, the vitamin A activity of the provitamin A carotenoids is half that assumed when using μg RE. For the dietary provitamin A carotenoids β-carotene, α-carotene, and β-cryptoxanthin, the RAE is set at 12 μg, 24 μg, and 24 μg, respectively. (See, for example, Dietary Reference Intakes for Vitamin A, Vitamin K, Arsenic, Boron, Chromium, Copper, Iodine, Iron, Manganese, Molybdenum, Nickel, Silicon, Vanadium, and Zinc. Washington (DC): National Academies Press (US); 2001.4, Vitamin A).

[0050] Vitamin D

[0051] Vitamin D is a group of fat-soluble open-ring steroids, including vitamin D2 (ergocalciferol) and vitamin D3 (cholecalciferol). Calcitriol (also known as 1,25-dihydroxyvitamin D) is the active form of vitamin D. Appropriately, vitamin D comprises or consists of vitamin D2 and vitamin D3. Appropriately, vitamin D comprises or consists of calcitriol.

[0052] Administration of vitamins K2, A and D

[0053] Vitamins K2, A, and D may be administered to the subject in any suitable form and via any suitable route of administration (e.g., in any form and via any route described herein).

[0054] Appropriate doses of vitamin K2 are described, for example, in: Kozioł-Kozakowska, A. and Maresz, K., 2022. Children, 9(1), p. 78 and European Food Safety Authority (EFSA), 2008. EFSA Journal, 6(11), p. 822. Appropriate doses of vitamin A are described, for example, in: Ross, AC and Moran, NE, 2020. Current Developments in Nutrition, 4(10), p. nzaa096 and EFSA Panel on Dietetic Products, Nutrition, and Allergies (NDA), 2015. EFSA Journal, 13(3), p. 4028. Appropriate doses of vitamin D are described, for example, in: Greer, FR, 2004. The American Journal of Clinical Nutrition, 80(6), pp. 1759S-1762S and EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA), 2016. EFSA Journal, 14(10), p. e04547.

[0055] Appropriately, vitamin K2 is administered to the subject at an amount of at least about 0.5 µg / kg / day, at least about 1 µg / kg / day, or at least about 2 µg / kg / day. Appropriately, vitamin K2 is administered to the subject at an amount of about 10 µg / kg / day or less, about 7.5 µg / kg / day or less, or about 5 µg / kg / day or less. Appropriately, vitamin K2 is administered to the subject at an amount of about 0.5 µg / kg / day to about 10 µg / kg / day, about 1 µg / kg / day to about 7.5 µg / kg / day, or about 2 µg / kg / day to about 5 µg / kg / day.

[0056] Appropriately, vitamin K2 is administered to the subject in amounts of at least about 5 µg / day, at least about 10 µg / day, at least about 15 µg / day, at least about 20 µg / day, at least about 25 µg / day, or at least about 30 µg / day. Appropriately, vitamin K2 is administered to the subject in amounts of about 200 µg / day or less, about 100 µg / day or less, about 90 µg / day or less, about 80 µg / day or less, about 70 µg / day or less, or about 60 µg / day or less. Appropriately, vitamin K2 is administered to the subject in amounts of about 5 µg / day to about 200 µg / day, about 10 µg / day to about 100 µg / day, about 15 µg / day to about 90 µg / day, about 20 µg / day to about 80 µg / day, about 25 µg / day to about 70 µg / day, or about 30 µg / day to about 60 µg / day.

[0057] Appropriately, vitamin A is administered to the subject in an amount of at least about 100 µg RE / day, at least about 200 µg RE / day, or at least about 300 µg RE / day. Appropriately, vitamin A is administered to the subject in an amount of about 1000 µg RE / day or less, about 800 µg RE / day or less, about 600 µg RE / day or less, or about 400 µg RE / day or less. Appropriately, vitamin A is administered to the subject in an amount of about 100 µg RE / day to about 1000 µg RE / day, about 200 µg RE / day to about 800 µg RE / day, about 300 µg RE / day to about 600 µg RE / day, or about 300 µg RE / day to about 400 µg RE / day.

[0058] Appropriately, vitamin A is administered to the subject at an amount of at least about 100 µg RE / day, at least about 200 µg RAE / day, or at least about 300 µg RAE / day. Appropriately, vitamin A is administered to the subject at an amount of about 1000 µg RAE / day or less, about 800 µg RAE / day or less, about 600 µg RAE / day or less, or about 400 µg RAE / day or less. Appropriately, vitamin A is administered to the subject at an amount of about 100 µg RAE / day to about 1000 µg RAE / day, about 200 µg RAE / day to about 800 µg RAE / day, about 300 µg RAE / day to about 600 µg RAE / day, or about 300 µg RAE / day to about 400 µg RAE / day.

[0059] Appropriately, vitamin D is administered to the subject at an amount of at least about 2.5 µg / day, at least about 5 µg / day, at least about 10 µg / day, or at least about 15 µg / day. Appropriately, vitamin D is administered to the subject at an amount of about 100 µg / day or less, about 75 µg / day or less, or about 50 µg / day or less. Appropriately, vitamin D is administered to the subject at an amount of about 2.5 µg / day to about 100 µg / day, about 5 µg / day to about 100 µg / day, about 10 µg / day to about 75 µg / day, or about 15 µg / day to about 50 µg / day. Appropriately, vitamin D is administered to the subject at an amount of about 15 µg / day.

[0060] Appropriately, vitamin K2 was administered to the subject at a rate of about 5 µg / day to about 200 µg / day, vitamin A was administered to the subject at a rate of about 100 µg RE / day to about 1000 µg RE / day, and vitamin D was administered to the subject at a rate of about 2.5 µg / day to about 100 µg / day.

[0061] Oligosaccharide mixture

[0062] The present invention comprises an oligosaccharide mixture. As used herein, "oligosaccharide mixture" may refer to a mixture of two or more oligosaccharides. Oligosaccharides are sugar polymers containing small amounts (typically two to ten) of monosaccharides and are among the most well-known prebiotics. Short-chain fatty acids (SCFAs) (such as acetate, butyrate, and propionate) can be produced through fermentation of the oligosaccharide mixture in the gut.

[0063] The oligosaccharide mixtures used in this invention may comprise or consist of human milk oligosaccharides (HMOs). Many different types of HMOs are found in human milk and are generally based on combinations of glucose, galactose, sialic acid (N-acetylneuraminic acid), fucose, and / or N-acetylglucosamine with many different bonds between them. Almost all HMOs have a lactose molecule at their reducing end, and the non-reducing terminal position is occupied by sialic acid and / or fucose (if present). HMOs can be acidic (e.g., oligosaccharides containing charged sialic acid) or neutral (e.g., fucoidylated oligosaccharides).

[0064] Suitably, the mixture of oligosaccharides may comprise at least one fucoidylated oligosaccharide, at least one sialylated oligosaccharide, and / or at least one N-acetylated oligosaccharide. In some embodiments, the mixture of oligosaccharides comprises or consists of at least one fucoidylated oligosaccharide, at least one sialylated oligosaccharide, and at least one N-acetylated oligosaccharide. In some embodiments, the mixture of oligosaccharides comprises or consists of 2'-fucosylated lactose (2'FL), difucosylated lactose (diFL), 6'-sialylated lactose (6'-SL), lactose-N-tetrasaccharide (LNT), and lactose-N-neotetrasaccharide (LNnT). In some embodiments, the mixture of oligosaccharides comprises or consists of 2'-fucosylated lactose (2'FL), difucosylated lactose (diFL), 6'-sialylated lactose (6'-SL), 3'-sialylated lactose (3'-SL), lactose-N-tetrasaccharide (LNT), and lactose-N-neotetrasaccharide (LNnT).

[0065] In some embodiments, the oligosaccharide mixture comprises at least one fucoidylated oligosaccharide at about 30% to about 80% by weight, about 40% to about 80% by weight, or about 50% to about 70% by weight relative to the total weight of the oligosaccharide mixture. In some embodiments, the oligosaccharide mixture comprises at least one sialylated oligosaccharide at about 10% to about 35% by weight, about 10% to about 30% by weight, or about 10% to about 25% by weight relative to the total weight of the oligosaccharide mixture. In some embodiments, the oligosaccharide mixture comprises at least one N-acetylated oligosaccharide at about 10% to about 35% by weight, about 15% to about 30% by weight, or about 15% to about 20% by weight relative to the total weight of the oligosaccharide mixture.

[0066] In some embodiments, the oligosaccharide mixture comprises or consists of at least one fucoidylated oligosaccharide at about 30% to about 80% by weight, about 40% to about 80% by weight, or about 50% to about 70% by weight relative to the total weight of the oligosaccharide mixture; and at least one N-acetylated oligosaccharide at about 10% to about 35% by weight, about 15% to about 30% by weight, or about 15% to about 20% by weight relative to the total weight of the oligosaccharide mixture.

[0067] In some embodiments, the oligosaccharide mixture comprises or consists of at least one fucoidylated oligosaccharide at about 30% to about 80% by weight, about 40% to about 80% by weight, or about 50% to about 70% by weight relative to the total weight of the oligosaccharide mixture; at least one sialylated oligosaccharide at about 10% to about 35% by weight, about 10% to about 30% by weight, or about 10% to about 25% by weight relative to the total weight of the oligosaccharide mixture; and at least one N-acetylated oligosaccharide at about 10% to about 35% by weight, about 15% to about 30% by weight, or about 15% to about 20% by weight relative to the total weight of the oligosaccharide mixture.

[0068] Oligosaccharides can be obtained by any suitable method. Suitable methods for synthesizing oligosaccharides are well known to those skilled in the art. For example, methods for preparing oligosaccharides by microbial fermentation, enzymatic methods, chemical synthesis or combinations of these techniques have been developed (see, for example, Zeuner et al., 2019. Molecules, 24(11), p. 2033).

[0069] Fucosylated oligosaccharides

[0070] In some embodiments, the mixture of oligosaccharides contains at least one fucoidylated oligosaccharide.

[0071] Non-limiting examples of fucosylated oligosaccharides include: 2'-fucosylated lactose (2'FL), 3-fucosylated lactose (3FL), difucosylated lactose (diFL), lactose-N-fucopentose (such as lactose-N-fucopentose I (LNFP-I), lactose-N-fucopentose II (LNFP-II), lactose-N-fucopentose III (LNFP-III), or lactose-N-fucopentose V (LNFP-V)), lactose-N-fucohexose, lactose-N-difucohexose I, lactose-neofofucopentose V (LNnFP-V), lactose-N-difucosylated hexose-I (LNDFH-1), lactose- N-Neo-difucosylhexose-I (LNnDFH), fucosyllactose-N-hexose, fucosyllactose-N-neohexose (such as fucosyllactose-N-neohexose I, fucosyllactose-N-neohexose II), mono-fucosyllactose-N-hexose III (MFNLH-III), difucosyllactose-N-hexose I, difucosyllactose-N-neohexose, difucosyllactose-N-neohexose I, difucosyllactose-N-neohexose II, difucosyllactose-N-hexose-a (DFLNHa), fucosyl-para-lactose-N-hexose, trifucosyl-para-lactose-N-hexose I, and combinations thereof.

[0072] In a preferred embodiment, at least one fucoidylated oligosaccharide comprises 2'-fucosylated lactose (2'FL), which is typically the most common HMO naturally found in human breast milk.

[0073] In some embodiments, at least one fucosylated oligosaccharide is selected from the group consisting of 2'-fucosylated lactose (2'FL), difucosylated lactose (diFL), and combinations thereof. In some embodiments, at least one fucosylated oligosaccharide comprises 2'-fucosylated lactose (2'FL) and difucosylated lactose (diFL), or a combination thereof.

[0074] Fucosylated oligosaccharides can be obtained by any suitable method. For example, 2'FL can be prepared using specific fucosyltransferases and / or fucosidases via biotechnological means, through enzyme-based fermentation techniques (recombinant or natural enzymes) or microbial fermentation techniques. In the latter case, the microorganisms can express their natural enzymes and substrates, or can be engineered to produce the corresponding substrates and enzymes. Alternatively, 2'FL can be chemically synthesized from lactose and free fucose. diFL can be synthesized via enzymatic, biotechnological, and / or chemical methods.

[0075] Sialotropic oligosaccharides

[0076] In some embodiments, the mixture of oligosaccharides contains at least one sialylated oligosaccharide.

[0077] Non-limiting examples of sialylated oligosaccharides include: 3'-sialyl lactose (3'-SL), 6'-sialyl lactose (6'-SL), sialyl lactose-N-tetrasaccharide b (LSTb), sialyl lactose-N-tetrasaccharide c (LSTc), disialyllactose-N-tetrasaccharide, and combinations thereof.

[0078] In some embodiments, at least one sialylated oligosaccharide is selected from the group consisting of 3'-sialyl lactose (3'-SL), 6'-sialyl lactose (6'-SL), and combinations thereof. In some embodiments, at least one sialylated oligosaccharide comprises or is composed of 6'-sialyl lactose (6'-SL). In some embodiments, at least one sialylated oligosaccharide comprises or is composed of 6'-sialyl lactose (6'-SL) and 3'-sialyl lactose (3'-SL).

[0079] Sialized oligosaccharides can be obtained by any suitable method. For example, 3'-sialyl lactose (3'-SL) and / or 6'-sialyl lactose (6'-SL) can be isolated from natural sources such as animal milk using chromatographic or filtration techniques. Alternatively, sialyl oligosaccharides can be prepared by biotechnological means, such as enzyme-based fermentation (recombinant or natural enzymes), chemical synthesis, or microbial fermentation, using specific sialyl transferases or sialic acidases, neuraminidases. In the latter case, the microorganisms can express their natural enzymes and substrates, or can be engineered to produce the corresponding substrates and enzymes. Single or mixed microbial cultures can be used. Sialized oligosaccharides can be formed starting with acceptor substrates initially having any degree of polymerization (DP), beginning with DP = 1. Alternatively, sialyl lactose can be produced by chemical synthesis from lactose and free N'-acetylneuraminic acid (sialic acid). Sialolactose can also be purchased from, for example, KyowaHakko Kogyo, Japan, or GeneChem, Republic of Korea.

[0080] If the oligosaccharide mixture contains 3'-sialyl lactose (3'-SL) and 6'-sialyl lactose (6'-SL), it may be particularly advantageous that the 3'-sialyl lactose (3'-SL) and 6'-sialyl lactose (6'-SL) are included in the nutritional composition in a weight ratio between about 10:1 and about 1:10 (such as between about 10:1 and about 2:1, between about 8:1 and about 3:1, between about 6:1 and about 3:1, between about 5:1 and about 3:1, between about 5:1 and about 4:1, or between about 1:2 and about 1.5:1).

[0081] N-acetylated oligosaccharides

[0082] In some embodiments, the mixture of oligosaccharides contains at least one N-acetylated oligosaccharide.

[0083] Suitablely, at least one N-acetylated oligosaccharide is selected from the group consisting of N-acetyl-glucosamine, N-acetyl-galactosamine, and combinations thereof. Non-limiting examples of N-acetylated oligosaccharides include: LNT (lactose-N-tetrasaccharide), para-lactose-N-neohexose (para-LNnH), LNnT (lactose-N-neohexose), and any combination thereof. Other examples are lactose-N-hexose, lactose-N-neohexose, para-lactose-N-hexose, para-lactose-N-neohexose, lactose-N-octasaccharide, lactose-N-neoctasaccharide, isolose-N-octasaccharide, para-lactose-N-octasaccharide, and lactose-N-decansaccharide.

[0084] In some embodiments, at least one N-acetylated oligosaccharide is selected from the group consisting of lactose-N-tetrasaccharide (LNT), lactose-N-neotetrasaccharide (LNnT), and combinations thereof. In some embodiments, at least one N-acetylated oligosaccharide comprises or is composed of lactose-N-tetrasaccharide (LNT) and lactose-N-neotetrasaccharide (LNnT).

[0085] N-acetylated oligosaccharides can be obtained by any suitable method. For example, LNnT can be chemically synthesized by enzymatically transferring sugar units from the donor moiety to the acceptor moiety using a glycosyltransferase. Alternatively, LNnT can be prepared by chemically converting a free or oligosaccharide-bound ketohexose (e.g., fructose) into N-acetylated hexosamine or an oligosaccharide containing N-acetylated hexosamine. LNTs can be synthesized by enzymatic, biotechnological, and / or chemical methods.

[0086] Application of oligosaccharide mixture

[0087] Oligosaccharides may be administered to subjects in any suitable form and via any suitable route of administration (e.g., in any form and via any route described herein).

[0088] Appropriate dosages of human oligosaccharides are described, for example, in the following: EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA), 2015. EFSA Journal, 13(11), p. 4299; EFSA Panel on Nutrition, Novel Foods and Food Allergens (NDA), 2019. EFSA Journal, 17(6), p. e05717; EFSA Panel on Nutrition, Novel Foods and Food Allergens (NDA), 2020. EFSA Journal, 18(5), p. e06097; EFSA Panel on Nutrition, Novel Foods and Food Allergens (NDA), 2022. EFSA Journal, 20(5), p. e07331; and EFSA Panel on Nutrition, Novel Foods and Food Allergens (NDA), 2019. EFSA Journal, 17(12), page e05907.

[0089] Suitable, the oligosaccharide mixture is administered to the subject in an amount of at least about 0.5 g / day, at least about 1 g / day, or at least about 2 g / day. Suitable, the oligosaccharide mixture is administered to the subject in an amount of about 10 g / day or less, about 8 g / day or less, or about 5 g / day or less. Suitable, the oligosaccharide mixture is administered to the subject in an amount of about 0.5 g / day to about 10 g / day, about 1 g / day to about 8 g / day, or about 2 g / day to about 5 g / day.

[0090] Appropriately, 2'FL is administered to the subject at a dose of at least about 0.5 g / day, at least about 0.8 g / day, or at least about 1 g / day. Appropriately, 2'FL is administered to the subject at a dose of about 5 g / day or less, about 4 g / day or less, or about 3 g / day or less. Appropriately, 2'FL is administered to the subject at a dose of about 0.5 g / day to about 5 g / day, about 0.8 g / day to about 4 g / day, or about 1 g / day to about 3 g / day.

[0091] Appropriately, diFL is administered to the subject at a dose of at least about 0.1 g / day, at least about 0.15 g / day, or at least about 0.2 g / day. Appropriately, diFL is administered to the subject at a dose of about 1 g / day or less, about 0.8 g / day or less, or about 0.6 g / day or less. Appropriately, diFL is administered to the subject at a dose of about 0.1 g / day to about 1 g / day, about 0.15 g / day to about 0.8 g / day, or about 0.2 g / day to about 0.6 g / day.

[0092] Appropriately, 6'-SL is administered to the subject at a dose of at least about 0.1 g / day, at least about 0.15 g / day, or at least about 0.2 g / day. Appropriately, 6'-SL is administered to the subject at a dose of about 1 g / day or less, about 0.8 g / day or less, or about 0.6 g / day or less. Appropriately, 6'-SL is administered to the subject at a dose of about 0.1 g / day to about 1 g / day, about 0.15 g / day to about 0.8 g / day, or about 0.2 g / day to about 0.6 g / day.

[0093] Appropriately, 3'-SL is administered to the subject at a dose of at least about 0.1 g / day, at least about 0.15 g / day, or at least about 0.2 g / day. Appropriately, 3'-SL is administered to the subject at a dose of about 1 g / day or less, about 0.8 g / day or less, or about 0.6 g / day or less. Appropriately, 3'-SL is administered to the subject at a dose of about 0.1 g / day to about 1 g / day, about 0.15 g / day to about 0.8 g / day, or about 0.2 g / day to about 0.6 g / day.

[0094] Appropriately, LNT is administered to the subject at a dose of at least about 0.2 g / day, at least about 0.3 g / day, or at least about 0.4 g / day. Appropriately, LNT is administered to the subject at a dose of about 2.5 g / day or less, about 2 g / day or less, or about 1.5 g / day or less. Appropriately, LNT is administered to the subject at a dose of about 0.2 g / day to about 2.5 g / day, about 0.3 g / day to about 2 g / day, or about 0.4 g / day to about 1.5 g / day.

[0095] Appropriately, LNnT is administered to the subject at a dose of at least about 0.2 g / day, at least about 0.3 g / day, or at least about 0.4 g / day. Appropriately, LNnT is administered to the subject at a dose of about 2.5 g / day or less, about 2 g / day or less, or about 1.5 g / day or less. Appropriately, LNnT is administered to the subject at a dose of about 0.2 g / day to about 2.5 g / day, about 0.3 g / day to about 2 g / day, or about 0.4 g / day to about 1.5 g / day.

[0096] Appropriately, vitamin K2 was administered to the subject at an amount of about 5 µg / day to about 200 µg / day, vitamin A was administered to the subject at an amount of about 100 µg RE / day to about 1000 µg RE / day, vitamin D was administered to the subject at an amount of about 2.5 µg / day to about 100 µg / day, and a mixture of oligosaccharides was administered to the subject at an amount of about 0.5 g / day to about 10 g / day.

[0097] Appropriately, 2'FL was administered to the subject at a dose of about 0.5 g / day to about 5 g / day; diFL was administered to the subject at a dose of about 0.1 g / day to about 1 g / day; 6'-SL was administered to the subject at a dose of about 0.1 g / day to about 1 g / day; 3'-SL was administered to the subject at a dose of about 0.1 g / day to about 1 g / day; LNT was administered to the subject at a dose of about 0.2 g / day to about 2.5 g / day; and / or LNnT was administered to the subject at a dose of about 0.2 g / day to about 2.5 g / day.

[0098] Probiotics

[0099] The combinations of the present invention may further comprise one or more probiotics. As used herein, the term “probiotic” may refer to a combination of live microorganisms present in sufficient quantities to alter the composition of a subject’s gut microbiota (see, for example, Hill, C. et al., 2014. Nature reviews Gastroenterology & hepatology, 11(8), p. 506). Profitably, probiotics comprise commercially available probiotic strains and / or strains that have been shown to have health benefits (see, for example, Fijan, S., 2014. International journal of environmental research and public health, 11(5), pp. 4745-4767). Exemplary probiotic microorganisms may include Bifidobacterium, Lactobacillus, Limosilactobacillus, Lactobacillus paracasei, Saccharomyces, Enterococcus, Streptococcus, Pediococcus, Leuconostoc, Bacillus, and Escherichia coli.

[0100] In some implementations, the probiotics comprise or consist of Bifidobacterium, Lactobacillus, Lactobacillus reuteri, and / or Lactobacillus paracasei.

[0101] Bifidobacterium longum

[0102] In some implementations, the probiotics contain or consist of Bifidobacterium longum.

[0103] Bifidobacterium longum is a bacterium found in the human digestive tract. In 2002, three previously distinct species of Bifidobacterium (Bifidobacterium infantis, Bifidobacterium longum, and Bifidobacterium suis) were merged with biotypes Bifidobacterium infantis, Bifidobacterium longum, and Bifidobacterium suis into a single species named Bifidobacterium longum (Sakata, S. et al., 2002. International journal of systematic and evolutionary microbiology, 52(6), pp. 1945-1951).

[0104] In some implementations, the probiotics comprise or consist of the following: Bifidobacterium longum ssp. infantis (also known as infantile Bifidobacterium), Bifidobacterium longum ssp. suis (also known as swine Bifidobacterium), and / or Bifidobacterium longum ssp. longum (also known as long Bifidobacterium).

[0105] In some embodiments, the probiotic comprises or is composed of Bifidobacterium infantis. In some embodiments, the probiotic comprises or is composed of Bifidobacterium infantis LMG 11588 or a derivative thereof (e.g., R0033, which has been deemed safe (GRAS) by the US Food and Drug Administration; see, for example, Duboux, S. et al., 2022. Microorganisms, 10(2), p. 203). Bifidobacterium infantis can promote endogenous production of vitamin K2 through the production of precursors.

[0106] Bifidobacterium animalis

[0107] In some implementations, the probiotics contain or consist of Bifidobacterium animalis.

[0108] Bifidobacterium animalis is a genus of bacteria that can be found in the large intestine of most mammals, including humans. Bifidobacterium animalis and Bifidobacterium lactis were previously described as two distinct species. Currently, both are considered: Bifidobacterium animalis, which has both subspecies *Bifidobacterium animalis* and subspecies *Bifidobacterium lactis* (see Masco, L. et al., 2004. *International Journal of Systematic and Evolutionary Microbiology*, 54(4), pp. 1137-1143).

[0109] In some implementations, the probiotic comprises or consists of Bifidobacterium animalis lactic acid species (also known as Bifidobacterium lactis). For example, various traits of the bacterial Bifidobacterium lactis HN019 that are important to its ability to function as a probiotic have been studied (see, for example, Sanders, ME, 2006. Journal of clinical gastroenterology, 40(9), pp. 776-783).

[0110] Lactobacillus rhamnosus

[0111] In some implementations, the probiotics contain or consist of Lactobacillus rhamnosus.

[0112] Lactobacillus rhamnosus (also known as Lactobacillus rhamnosus) is a short, Gram-positive, homofermentative, facultative anaerobic, asporophore that typically occurs in chains. Lactobacillus rhamnosus GG (LGG) is one of the most widely used probiotic strains. Various health effects have been documented (see, for example, Segers, ME and Lebeer, S., 2014. Microbial cell factories, 13(1), pp. 1–16). Lactobacillus rhamnosus can promote endogenous production of vitamin K2 through the production of precursors.

[0113] In some implementations, the probiotic contains or is composed of Lactobacillus rhamnosus LPR.

[0114] Application of probiotics

[0115] Any appropriate amount of probiotics may be administered to the subject in any suitable form and via any suitable route of administration (e.g., in any form and via any route described herein).

[0116] Appropriately, one or more probiotics are added at a concentration of at least about 10 5 CFU / day, at least approximately 10 6 CFU / day, at least approximately 10 7 CFU / day, at least approximately 10 8 CFU / day, at least approximately 10 9 CFU / day or at least approximately 10 10 The total amount of CFU / day was administered to the subjects. Appropriately, one or more probiotics were administered at approximately 10... 12 CFU / day or less, approximately 10 11 CFU / day or less or about 10 10 The subject was administered a total dose of CFU / day or less. Appropriately, one or more probiotics were administered at approximately 10... 6 CFU / day to approximately 10 12 CFU / day, approximately 10 7 CFU / day to approximately 10 11 CFU / day or approximately 10 8 CFU / day to approximately 10 10 The total amount of CFU / day was administered to the subjects.

[0117] Appropriately, Bifidobacterium longum (e.g., Bifidobacterium infantis) at a concentration of at least about 10 5CFU / day, at least approximately 10 6 CFU / day, at least approximately 10 7 CFU / day, at least approximately 10 8 CFU / day, at least approximately 10 9 CFU / day or at least approximately 10 10 The subject was administered CFU / day. Appropriately, Bifidobacterium longum (e.g., Bifidobacterium infantis) was administered at approximately 10... 12 CFU / day or less, approximately 10 11 CFU / day or less or about 10 10 Administer CFU / day or less to the subject. Appropriately, Bifidobacterium longum (e.g., Bifidobacterium infantis) is administered at approximately 10... 6 CFU / day to approximately 10 12 CFU / day, approximately 10 7 CFU / day to approximately 10 11 CFU / day or approximately 10 8 CFU / day to approximately 10 10 The subject was given a dose of CFU / day.

[0118] Appropriately, animal Bifidobacteria (e.g., Lactobacillus bifidum) at a concentration of at least about 10 5 CFU / day, at least approximately 10 6 CFU / day, at least approximately 10 7 CFU / day, at least approximately 10 8 CFU / day, at least approximately 10 9 CFU / day or at least approximately 10 10 The subject was administered CFU / day. Appropriately, Bifidobacterium animalis (e.g., Bifidobacterium lactis) was administered at approximately 10... 12 CFU / day or less, approximately 10 11 CFU / day or less or about 10 10 Administer CFU / day or less to the subject. Appropriately, animal Bifidobacterium (e.g., Lactobacillus lactis) is administered at approximately 10... 6 CFU / day to approximately 10 12 CFU / day, approximately 10 7 CFU / day to approximately 10 11 CFU / day or approximately 10 8 CFU / day to approximately 10 10 The subject was given a dose of CFU / day.

[0119] Appropriately, Lactobacillus rhamnosus at a concentration of at least about 10 5 CFU / day, at least approximately 10 6 CFU / day, at least approximately 10 7 CFU / day, at least approximately 10 8 CFU / day, at least approximately 109 CFU / day or at least approximately 10 10 The subjects were administered CFU / day. Appropriately, *Lactobacillus rhamnosus* was administered at approximately 10... 12 CFU / day or less, approximately 10 11 CFU / day or less or about 10 10 Administer CFU / day or less to the subject. Appropriately, administer Lactobacillus rhamnosus at approximately 10... 6 CFU / day to approximately 10 12 CFU / day, approximately 10 7 CFU / day to approximately 10 11 CFU / day or approximately 10 8 CFU / day to approximately 10 10 The subject was given a dose of CFU / day.

[0120] Composition

[0121] Appropriately, the combination is in the form of a composition. The composition may contain any combination of therapeutically effective amounts.

[0122] The composition can be any type of composition that can be incorporated into the composition, such as a food or beverage product, an animal feed product, a nutritional supplement for human or animal, or a pharmaceutical composition. The composition can be in solid (e.g., powder), liquid, or semi-liquid form. The composition can be in the form of a food composition, a pet food composition, a beverage, a nutritional formula, a nutritional supplement, or a nutritional product.

[0123] Food and beverage products, intended for the purpose of providing nutrition and / or pleasure, include all products intended for oral consumption by humans. For example, this can be a nutritional composition, such as that for children. Examples of food and beverage products include dairy products, such as dairy products or yogurt, soups, sauces, sweet and savory snacks, powdered beverages, and cereal products.

[0124] In some implementations, the combination is in the form of a nutritional composition, a medical food product for clinical nutrition, a dairy formula, or a supplement.

[0125] In some embodiments, the combination is in the form of a nutritional composition. As used herein, "nutritional composition" can mean a composition that supplies nutrients to a subject. Such nutritional compositions are typically administered orally or intravenously and typically include a lipid or fat source and a protein source.

[0126] In some implementations, the combination takes the form of a medical food product for clinical nutrition. As used herein, "medical food product for clinical nutrition" may also be referred to as "food for a specific medical purpose (FSMP)," and refers to a specialized food designed to help meet the nutritional or dietary needs of a subject who has a disease, condition, or medical condition that is temporarily or permanently unable to obtain adequate nutritional intake from a normal food or by modifying a normal diet.

[0127] In a preferred embodiment, the combination is in the form of a dairy formula. As used herein, the term "dairy formula" can refer to a food intended for, for example, childhood nutrition, which may provide, for example, a sole source or supplemental source of nutrition for children aged about 3 years or older. In some embodiments, the dairy formula is growing milk.

[0128] In some embodiments, the composition (e.g., a dairy formula) is in powder form and reconstituted in an aqueous medium (e.g., water) prior to application. In other embodiments, the composition (e.g., a dairy formula) is in a ready-to-apply liquid form (e.g., a ready-to-eat formula).

[0129] In another embodiment, the composition is in the form of a supplement. As used herein, "supplement" or "dietary supplement" is used to supplement the nutrition of a subject (as is commonly used, but it can also be added to any kind of composition intended for intake by the subject). When the composition is a supplement, it may be provided in unit dosage form. Supplements are typically available in the form of liquids, gels, powders, or tablets or capsules. Powdered supplements typically cover the supplement to be dissolved in water or milk or sprayed into food or beverages. Such supplements are intended to provide additional nutritional and / or health benefits to the subject consuming them. Supplements can be used to provide nutrients and / or health benefits to humans and animals.

[0130] In another embodiment, the combination is in the form of a fortifier. The fortifier may be a dairy formula fortifier.

[0131] In another embodiment, the combination is in the form of a pharmaceutical product. Pharmaceutical products include, for example, drops, syrups, powders, tablets, or capsules designed to treat or prevent adverse medical conditions in subjects in need.

[0132] The combination may also be in the form of animal food products or nutritional supplements for animals. Preferably, the animal is a mammal. Examples of animals include primates (e.g., humans), cattle, sheep, goats, horses, dogs, cats, rabbits, rats, mice, fish, birds, etc.

[0133] The nutritional compositions of the present invention, particularly dairy formula foods, typically contain protein sources, carbohydrate sources, and lipid sources. However, in some embodiments, especially if the nutritional compositions of the present invention are supplements or fortifiers, only lipids (or lipid sources) may be present.

[0134] The nutritional composition of the present invention may contain about 100 kcal / 100g to about 1000 kcal / 100g, about 200 kcal / 100g to about 800 kcal / 100g, or about 400 kcal / 100g to about 600 kcal / 100g based on dry weight.

[0135] Vitamin Mixture

[0136] The nutritional compositions according to the invention (e.g., dairy formula foods) may contain any suitable amounts of vitamins K2, A, and D.

[0137] Suitablely, the nutritional composition contains vitamin K2 in an amount of at least about 5 µg / 100g, at least about 10 µg / 100g, at least about 15 µg / 100g, at least about 20 µg / 100g, at least about 25 µg / 100g, or at least about 30 µg / 100g based on dry weight. Suitablely, the nutritional composition contains vitamin K2 in an amount of at least 2100 µg / 100g, at least 100 µg / 100g, at least 90 µg / 100g, at least 80 µg / 100g, at least 70 µg / 100g, or at least 60 µg / 100g based on dry weight. Suitable, the nutritional composition contains vitamin K2 in amounts of about 5 µg / 100g to about 200 µg / 100g, about 10 µg / 100g to about 100 µg / 100g, about 15 µg / 100g to about 90 µg / 100g, about 20 µg / 100g to about 80 µg / 100g, about 25 µg / 100g to about 70 µg / 100g, or about 30 µg / 100g to about 60 µg / 100g.

[0138] Suitablely, the nutritional composition contains vitamin A in an amount of at least about 100 µg RE / 100g, at least about 200 µg RE / 100g, or at least about 300 µg RE / 100g based on a dry weight. Suitablely, the nutritional composition contains vitamin A in an amount of at least about 1000 µg RE / 100g, at least about 800 µg RE / 100g, at least about 600 µg RE / 100g, or at least about 400 µg RE / 100g based on a dry weight. Suitable, the nutritional composition contains vitamin A in amounts based on dry weight of about 100 µg RE / 100g to about 1000 µg RE / 100g, about 200 µg RE / 100g to about 800 µg RE / 100g, about 300 µg RE / 100g to about 600 µg RE / 100g, or about 300 µg RE / 100g to about 400 µg RE / 100g.

[0139] Suitablely, the nutritional composition contains vitamin A in an amount of at least about 100 µg RAE / 100g, at least about 200 µg RAE / 100g, or at least about 300 µg RAE / 100g based on a dry weight. Suitablely, the nutritional composition contains vitamin A in an amount of at least about 1000 µg RAE / 100g, at least about 800 µg RAE / 100g, at least about 600 µg RAE / 100g, or at least about 400 µg RAE / 100g based on a dry weight. Suitable, the nutritional composition contains vitamin A in amounts based on dry weight of about 100 µg RAE / 100g to about 1000 µg RAE / 100g, about 200 µg RAE / 100g to about 800 µg RAE / 100g, about 300 µg RAE / 100g to about 600 µg RAE / 100g, or about 300 µg RAE / 100g to about 400 µg RAE / 100g.

[0140] Suitablely, the nutritional composition contains vitamin D in an amount of at least about 2.5 µg / 100g, at least about 5 µg / 100g, at least about 10 µg / 100g, or at least about 15 µg / 100g based on dry weight. Suitablely, the nutritional composition contains vitamin D in an amount of at least about 100 µg / 100g, at least about 75 µg / 100g, or at least about 50 µg / 100g based on dry weight. Suitablely, the nutritional composition contains vitamin D in an amount of at least about 2.5 µg / 100g to about 100 µg / 100g, at least about 5 µg / 100g to about 100 µg / 100g, at least about 10 µg / 100g to about 75 µg / 100g, or at least about 15 µg / 100g to about 50 µg / 100g based on dry weight.

[0141] Oligosaccharide mixture

[0142] The nutritional compositions according to the invention (e.g., dairy formula foods) may contain any suitable amount of oligosaccharides.

[0143] Suitably, the nutritional composition comprises a mixture of oligosaccharides in a total amount based on a dry weight of at least about 0.5% by weight, at least about 1% by weight, or at least about 2% by weight. Suitably, the nutritional composition comprises a mixture of oligosaccharides in a total amount based on a dry weight of about 10% by weight or less, about 8% by weight or less, or about 5% by weight or less. Suitably, the nutritional composition comprises a mixture of oligosaccharides in a total amount based on a dry weight of about 0.5% by weight to about 10% by weight, about 1% by weight to about 8% by weight, or about 2% by weight to about 5% by weight.

[0144] Suitably, the nutritional composition comprises at least one fucoidylated oligosaccharide in an amount of about 0.05 wt% to about 3 wt%, about 0.1 wt% to about 2 wt%, or about 0.2 wt% to about 1.5 wt% based on dry weight. Suitably, the nutritional composition comprises at least one sialylated oligosaccharide in an amount of about 0.01 wt% to about 2 wt%, about 0.05 wt% to about 1.5 wt%, or about 0.07 wt% to about 1 wt% based on dry weight. Suitably, the nutritional composition comprises at least one N-acetylated oligosaccharide in an amount of about 0.01 wt% to about 1 wt%, about 0.03 wt% to about 0.6 wt%, or about 0.05 wt% to about 0.5 wt% based on dry weight.

[0145] Suitablely, the nutritional composition comprises 2'FL in an amount of at least about 0.5% by weight, at least about 0.8% by weight, or at least about 1% by weight based on dry weight. Suitablely, the nutritional composition comprises 2'FL in an amount of about 5% by weight or less, about 4% by weight or less, or about 3% by weight or less based on dry weight. Suitablely, the nutritional composition comprises 2'FL in an amount of about 0.5% by weight to about 5% by weight, about 0.8% by weight to about 4% by weight, or about 1% by weight to about 3% by weight based on dry weight.

[0146] Suitably, the nutritional composition comprises diFL in an amount of at least about 0.1% by weight, at least about 0.15% by weight, or at least about 0.2% by weight based on dry weight. Suitably, the nutritional composition comprises diFL in an amount of about 1% by weight or less, about 0.8% by weight or less, or about 0.6% by weight or less based on dry weight. Suitably, the nutritional composition comprises diFL in an amount of about 0.1% by weight to about 1% by weight, about 0.15% by weight to about 0.8% by weight, or about 0.2% by weight to about 0.6% by weight based on dry weight.

[0147] Suitably, the nutritional composition comprises 6'-SL in an amount of at least about 0.1% by weight, at least about 0.15% by weight, or at least about 0.2% by weight based on dry weight. Suitably, the nutritional composition comprises 6'-SL in an amount of about 1% by weight or less, about 0.8% by weight or less, or about 0.6% by weight or less based on dry weight. Suitably, the nutritional composition comprises 6'-SL in an amount of about 0.1% by weight to about 1% by weight, about 0.15% by weight to about 0.8% by weight, or about 0.2% by weight to about 0.6% by weight based on dry weight.

[0148] Suitably, the nutritional composition comprises 3'-SL in an amount of at least about 0.1% by weight, at least about 0.15% by weight, or at least about 0.2% by weight based on dry weight. Suitably, the nutritional composition comprises 3'-SL in an amount of about 1% by weight or less, about 0.8% by weight or less, or about 0.6% by weight or less based on dry weight. Suitably, the nutritional composition comprises 3'-SL in an amount of about 0.1% by weight to about 1% by weight, about 0.15% by weight to about 0.8% by weight, or about 0.2% by weight to about 0.6% by weight based on dry weight.

[0149] Suitably, the nutritional composition comprises LNT in an amount of at least about 0.2% by weight, at least about 0.3% by weight, or at least about 0.4% by weight based on dry weight. Suitably, the nutritional composition comprises LNT in an amount of about 2.5% by weight or less, about 2% by weight or less, or about 1.5% by weight or less based on dry weight. Suitably, the nutritional composition comprises LNT in an amount of about 0.2% by weight to about 2.5% by weight, about 0.3% by weight to about 2% by weight, or about 0.4% by weight to about 1.5% by weight based on dry weight.

[0150] Suitably, the nutritional composition comprises LNnT in an amount of at least about 0.2% by weight, at least about 0.3% by weight, or at least about 0.4% by weight based on dry weight. Suitably, the nutritional composition comprises LNnT in an amount of about 2.5% by weight or less, about 2% by weight or less, or about 1.5% by weight or less based on dry weight. Suitably, the nutritional composition comprises LNnT in an amount of about 0.2% by weight to about 2.5% by weight, about 0.3% by weight to about 2% by weight, or about 0.4% by weight to about 1.5% by weight based on dry weight.

[0151] Suitable, the nutritional composition comprises 2'FL (concentration may refer to the concentration of the composition, for example, after reconstruction with water) of a total amount of about 0.05 g / L to about 2 g / L, about 0.1 g / L to about 1 g / L, about 0.15 g / L to about 0.8 g / L, about 0.2 g / L to about 0.7 g / L, or about 0.25 g / L to about 0.6 g / L.

[0152] Suitably, the nutritional composition comprises a total amount of fucoidylated oligosaccharides (e.g., 2'FL and / or diFL) of about 0.1 g / L to about 4 g / L, about 0.1 g / L to about 3.5 g / L, about 0.15 g / L to about 3 g / L, about 0.2 g / L to about 2.5 g / L, about 0.3 g / L to about 2 g / L, about 0.4 g / L to about 2 g / L, or about 0.5 g / L to about 2 g / L (concentration may refer to the concentration of the composition after reconstruction with water, for example). In one specific embodiment, the nutritional composition comprises about 0.2 g / L to about 1.8 g / L of total fucoidylated oligosaccharides.

[0153] Suitablely, the nutritional composition comprises a total amount of sialylated oligosaccharides (e.g., 3'-sialyl lactose (3'-SL) and / or 6'-sialyl lactose (6'-SL)) in amounts of about 0.05 g / L to about 0.75 g / L, about 0.05 g / L to about 0.5 g / L, about 0.1 g / L to about 0.3 g / L, or about 0.1 g / L to about 0.4 g / L (concentration may refer to the concentration after the composition has been reconstituted, for example, with water). In one specific embodiment, the nutritional composition comprises about 0.12 g / L to about 0.4 g / L of total sialylated oligosaccharides.

[0154] Suitable, the nutritional composition comprises a total amount of N-acetylated oligosaccharides (e.g., LNT and / or LNnT) of about 0.05 g / L to about 0.5 g / L, about 0.1 g / L to about 0.5 g / L, about 0.2 g / L to about 0.4 g / L or about 0.3 g / L (concentration may refer to the concentration of the composition after reconstruction with water, for example).

[0155] Appropriately, the nutritional composition comprises:

[0156] - at least one sialylated oligosaccharide in a total amount of about 0.05 g / L to about 0.75 g / L, about 0.05 g / L to about 0.5 g / L, about 0.1 g / L to about 0.3 g / L, or about 0.1 g / L to about 0.4 mg / L;

[0157] - at least one fucoidylated oligosaccharide in a total amount of about 0.1 g / L to about 4 g / L, about 0.1 g / L to about 3.5 g / L, about 0.15 g / L to about 3 g / L, about 0.2 g / L to about 2.5 g / L, about 0.3 g / L to about 2 g / L, about 0.4 g / L to about 2 g / L, or about 0.5 g / L to about 2 g / L; and / or

[0158] - At least one N-acetylated oligosaccharide in a total amount of about 0.05 g / L to about 0.5 g / L, about 0.1 g / L to about 0.5 g / L, or about 0.2 g / L to about 0.4 g / L.

[0159] Probiotics

[0160] The nutritional compositions according to the invention (e.g., dairy formula foods) may contain any suitable amount of probiotics.

[0161] Appropriately, the nutritional composition contains at least about 10g based on dry weight. 5 cfu / 100g, at least about 10 6 cfu / 100g, at least about 10 7 CFU / 100g or at least approximately 10 8 cfu / 100g, at least about 10 9 CFU / 100g or at least approximately 10 10 One or more probiotics in total amount of CFU / 100g. Suitable, the nutritional composition contains approximately 10 CFU / 100g based on dry weight. 12 cfu / 100g or less, approximately 10 11 cfu / 100g or less, approximately 10 10 One or more probiotics at a total amount of CFU / 100g or less. Appropriately, the nutritional composition contains approximately 10 CFU / 100g based on dry weight. 6 CFU / 100g to approximately 10 12 cfu / 100g, approximately 10 7 CFU / 100g to approximately 10 11 CFU / 100g or approximately 10 8 CFU / 100g to approximately 10 10 One or more probiotics in total amount of CFU / 100g.

[0162] Appropriately, the nutritional composition contains at least about 10g based on dry weight. 5 cfu / 100g, at least about 10 6 cfu / 100g, at least about 10 7 CFU / 100g or at least approximately 10 8 cfu / 100g, at least about 10 9 CFU / 100g or at least approximately 10 10 Bifidobacterium longum (e.g., Bifidobacterium infantis) at a concentration of CFU / 100g. Appropriately, the nutritional composition contains approximately 10 CFU / 100g based on dry weight. 12 cfu / 100g or less, approximately 10 11 cfu / 100g or less, approximately 10 10 CFU / 100g or less of Bifidobacterium longum (e.g., Bifidobacterium infantis). Appropriately, the nutritional composition contains approximately 10 CFU / 100g based on dry weight. 6 CFU / 100g to approximately 10 12 cfu / 100g, approximately 10 7 CFU / 100g to approximately 10 11CFU / 100g or approximately 10 8 CFU / 100g to approximately 10 10 Bifidobacterium longum (e.g., Bifidobacterium infantis) at a concentration of CFU / 100g.

[0163] Appropriately, the nutritional composition contains at least about 10g based on dry weight. 5 cfu / 100g, at least about 10 6 cfu / 100g, at least about 10 7 CFU / 100g or at least approximately 10 8 cfu / 100g, at least about 10 9 CFU / 100g or at least approximately 10 10 Animal Bifidobacterium (e.g., Bifidobacterium lactis) at a concentration of CFU / 100g. Appropriately, the nutritional composition contains approximately 10 CFU / 100g based on dry weight. 12 cfu / 100g or less, approximately 10 11 cfu / 100g or less, approximately 10 10 CFU / 100g or less of animal Bifidobacterium (e.g., Bifidobacterium lactis). Appropriately, the nutritional composition contains approximately 10 CFU / 100g based on dry weight. 6 CFU / 100g to approximately 10 12 cfu / 100g, approximately 10 7 CFU / 100g to approximately 10 11 CFU / 100g or approximately 10 8 CFU / 100g to approximately 10 10 Animal Bifidobacterium (e.g., Bifidobacterium lactis) at a concentration of CFU / 100g.

[0164] Appropriately, the nutritional composition contains at least about 10g based on dry weight. 5 cfu / 100g, at least about 10 6 cfu / 100g, at least about 10 7 CFU / 100g or at least approximately 10 8 cfu / 100g, at least about 10 9 CFU / 100g or at least approximately 10 10 Lactobacillus rhamnosus at a concentration of CFU / 100g. Appropriately, the nutritional composition contains approximately 10 CFU / 100g of Lactobacillus rhamnosus based on dry weight. 12 cfu / 100g or less, approximately 10 11 cfu / 100g or less, approximately 10 10 Lactobacillus rhamnosus, CFU / 100g or less. Appropriately, the nutritional composition contains approximately 10 CFU / 100g based on dry weight. 6 CFU / 100g to approximately 10 12 cfu / 100g, approximately 10 7CFU / 100g to approximately 10 11 CFU / 100g or approximately 10 8 CFU / 100g to approximately 10 10 Lactobacillus rhamnosus at a concentration of CFU / 100g.

[0165] protein

[0166] The nutritional compositions according to the invention (e.g., dairy formula foods) may contain a protein source. This is particularly preferred when the nutritional compositions of the invention are dairy formula foods. The amount of protein may be from about 1g to about 4g / 100kcal or from about 1.5g to about 3g / 100kcal.

[0167] Protein sources based on, for example, whey, casein, and mixtures thereof, or plant-based (e.g., soybean-based) protein sources can be used. With regard to the whey protein of interest, the protein source may be based on acidic whey or sweet whey, or mixtures thereof, and may contain any desired proportions of α-lactalbumin and β-lactoglobulin. In some embodiments, the protein source is whey-dominant (i.e., more than 50% of the protein is derived from whey protein, such as 60% or 70%). The protein may be whole or hydrolyzed, or a mixture of whole and hydrolyzed proteins. The term "whole" means that the major components of the protein are intact, i.e., the molecular structure is not altered, for example, at least 80% of the protein is not altered, such as at least 85% of the protein is not altered, preferably at least 90% of the protein is not altered, even more preferably at least 95% of the protein is not altered, such as at least 98% of the protein is not altered. In one specific embodiment, 100% of the protein is not altered.

[0168] The term "hydrolyzed" means, in the context of this invention, that the protein has been hydrolyzed or broken down into its constituent amino acids.

[0169] The protein can be completely or partially hydrolyzed. If the protein requires hydrolysis, the hydrolysis process can be carried out as needed and as is known in the art. For example, whey protein hydrolysates can be prepared by enzymatic hydrolysis of whey fractions in one or more steps. If the whey fraction used as a raw material is substantially lactose-free, it has been found that the protein undergoes much less lysine blockage during the hydrolysis process. This allows the degree of lysine blockage to be reduced from about 15% by weight of total lysine to less than about 10% by weight of lysine; for example, about 7% by weight of lysine, which greatly improves the nutritional quality of the protein source.

[0170] In one specific embodiment, the protein of the composition is hydrolyzed, completely hydrolyzed, or partially hydrolyzed. The degree of hydrolysis (DH) of the protein can be 2 to 20, 8 to 40, or 20 to 60, or 20 to 80, or greater than 10, 20, 40, 60, 80, or 90.

[0171] At least 70%, 80%, 85%, 90%, 95%, or 97% of the protein can be hydrolyzed. In one specific embodiment, 100% of the protein is hydrolyzed.

[0172] In one specific embodiment, the protein in the composition is plant-based.

[0173] carbohydrate

[0174] The nutritional compositions according to the invention (e.g., dairy formula foods) may contain a carbohydrate source. This is particularly preferred when the nutritional compositions of the invention are dairy formula foods. The amount of carbohydrates may be from about 5g to about 20g / 100kcal or from about 10g to about 15g / 100kcal.

[0175] Any carbohydrate source commonly found in dairy formula can be used, such as lactose, sucrose, cane sugar, maltodextrin, starch, and mixtures thereof, but one of the preferred carbohydrate sources for dairy formula is lactose.

[0176] lipids

[0177] The nutritional compositions according to the invention (e.g., dairy formula foods) may contain lipids and essential fatty acids. This is particularly preferred when the nutritional compositions of the invention are dairy formula foods. The amount of lipids may be from about 1g to about 10g / 100kcal or from about 2g to about 6g / 100kcal.

[0178] Non-limiting examples of lipids include: palm oil extract, high-oleic sunflower oil, high-oleic safflower oil, canola oil, fish oil, coconut oil, milk fat, and combinations thereof. It may be particularly advantageous if the composition contains fat in an amount of about 25 to about 30 g / 100 g dry weight of the composition. Non-limiting examples of essential fatty acids include: linoleic acid (LA), α-linolenic acid (ALA). The compositions of the present invention may also contain gangliosides, monosialotetrahexosylganglioside-3 (GM3) and disialialotetrahexosylganglioside-3 (GD3), and combinations thereof.

[0179] Other components

[0180] The nutritional compositions of the present invention (e.g., dairy formula foods) may also contain all vitamins and minerals considered essential for a daily diet and required in significant amounts. Minimum requirements for certain vitamins and minerals have been determined. Examples of minerals, vitamins, and other nutrients optionally present in the compositions of the present invention include vitamins B1, B2, B3, B6, B12, E, K1, C, folic acid, inositol, niacin, biotin, pantothenic acid, choline, calcium, phosphorus, iodine, iron, magnesium, copper, zinc, manganese, chlorine, potassium, sodium, selenium, chromium, molybdenum, taurine, and L-carnitine. Minerals are typically added in salt form. The presence and amount of specific minerals and other vitamins will vary depending on the target population. If necessary, the nutritional compositions of the present invention may contain emulsifiers and stabilizers such as soy, lecithin, monoglyceride citrate, and diglyceride citrate.

[0181] The nutritional compositions of the present invention (e.g., dairy formula foods) may also contain other substances that may have beneficial effects, especially on bone health or bone development, such as lactoferrin, osteopontin, TGFbeta, slgA, glutamine, nucleotides, nucleosides, etc.

[0182] Preparation of the composition

[0183] The compositions according to the invention can be prepared by any known or other suitable method. For example, nutritional compositions (e.g., dairy formula foods) can be perfected by blending a protein source with a carbohydrate source and a lipid source in suitable proportions. If an emulsifier is used, it can be included in this stage. Vitamins and minerals can be added at this stage, but may also be added subsequently to prevent thermal degradation. Water (preferably reverse osmosis water or deionized water) can then be added and mixed to form a liquid mixture. The mixing temperature is preferably room temperature, but may also be higher. The liquid mixture can then be heat-treated to reduce bacterial load. The mixture can then be homogenized.

[0184] If it is necessary to produce a powdered composition, the homogenized mixture is dried in a suitable drying device (such as a spray dryer or freeze dryer) and converted into a powder.

[0185] Methods for manufacturing formulated foods are based on the concept that the product must be nutritionally adequate and microbiologically safe for consumption. Therefore, steps to eliminate or limit microbial growth are crucial to the production process. The processing techniques for each specific formulated food are the property of the manufacturer, but generally, for powdered products, this involves preserving oil-in-water (o / w) emulsions through dehydration, or for ready-to-eat or concentrated liquid products, it involves sterilization. Powdered formulated foods can be produced by various methods, such as dry-blending dehydrated components to form a homogeneous formulated food, or hydrating and wet-blending mixtures of macro-components (such as fats, proteins, and carbohydrates), and then evaporating and spray-drying the resulting mixture. A combination of these methods can be used, where a base powder is first prepared by wet-blending and spray-drying all or some of the macro-components, and then dry-blending the remaining components (including carbohydrates, minerals, vitamins, and other micronutrients) to obtain the final formulated food. Liquid formulated foods are provided in ready-to-eat form or as concentrated liquids, which require dilution with water, typically 1:1. The manufacturing methods for these products are similar to those used to manufacture reconstituted milk.

[0186] If it is necessary to produce liquid formulated food products, the homogenized mixture can be filled into a suitable container, preferably under aseptic conditions. However, the liquid composition can also be cooked in the container, and suitable equipment for such filling and cooking is commercially available.

[0187] Subjects

[0188] The subject can be any suitable subject. Appropriately, the subject can be a mammal. In a preferred embodiment, the subject is a human. In other embodiments, the subject is an animal, preferably a pet. The pet can be an animal selected from dogs, cats, birds, fish, rodents (such as mice, rats, and guinea pigs), rabbits, etc. In some embodiments, the pet is a small dog breed.

[0189] In some implementation schemes, the subjects are adolescents, teenagers, or children. The term "adolescent" can refer to an individual who has not yet reached adulthood. The term "teenager" can refer to an individual from the onset of puberty to adulthood. The term "child" can refer to an individual between birth and puberty.

[0190] In a preferred embodiment, the subject is approximately 3 years of age or older. In some embodiments, the subject is approximately 4 years of age or older, or approximately 5 years of age or older.

[0191] In a preferred embodiment, the subject is about 10 years old or younger. In some embodiments, the subject is about 9 years old or younger, about 8 years old or younger, about 7 years old or younger, about 6 years old or younger, or about 5 years old or younger.

[0192] In some implementations, the subjects are approximately 3 to 10 years old, approximately 3 to 9 years old, approximately 3 to 8 years old, approximately 3 to 7 years old, approximately 3 to 6 years old, or approximately 3 to 5 years old.

[0193] This invention is particularly applicable to children who are premature or have low birth weight or experience intrauterine growth retardation, or infants and young children who suffer from growth retardation due to malnutrition or disease (such as Crohn's disease and / or celiac disease and / or cancer), or infants and young children treated with medications (such as chemotherapy drugs and / or corticosteroids) that cause malabsorption, anorexia, and / or metabolic bone disease. This invention is particularly preferred for children who are premature or have low birth weight or experience intrauterine growth retardation or suffer from intrauterine malnutrition or growth retardation. This invention is also applicable to children at risk of bone disease, with a family history of bone disease, or who have experienced at least one, preferably several, fractures.

[0194] In some implementations, the subjects suffer from and / or are suffering from growth retardation. Growth retardation can be defined as an age-related height value that is less than two standard deviations from the median of the WHO child growth standards (see, for example, De Onis, M. and Branca, F., 2016. Maternal & child nutrition, 12, pp. 12-26).

[0195] In some implementations, the subject suffers from and / or is suffering from growth retardation. The term “growth retardation” can describe a pattern of weight gain that is slower than expected for age and sex in children and other adolescents (see, for example, King, C. and Davis, T., 2010. European journal of clinical nutrition, 64(1), pp. S11–S13). In some implementations, the subject suffers from and / or is suffering from growth retardation and / or growth slowing due to malnutrition or experiencing conditions such as anorexia, Crohn's disease, and / or celiac disease. In some implementations, the subject suffers from and / or is suffering from growth retardation and / or growth slowing due to treatment with medications that cause malabsorption, anorexia, and / or metabolic bone disease, such as chemotherapy drugs and / or corticosteroids.

[0196] In some implementations, the subject is preterm, has low birth weight, or experiences intrauterine growth restriction. The term "preterm infant" can refer to an infant born at a gestational age of less than 37 weeks. The term "low birth weight infant" can refer to an infant born with a live birth weight of less than 2,500g.

[0197] Methods for enhancing bone growth and / or bone strength

[0198] The inventors have demonstrated that the combination of the present invention can be used to enhance bone growth and / or bone strength in subjects.

[0199] In the context of this invention, the term "enhanced bone growth and / or bone strength" may specifically refer to one or more of the following physiological processes: bone catch-up growth, bone quality gain, peak bone quality optimization, promotion of bone formation, promotion of bone anabolism, promotion of bone mineralization, increase of bone mineral density and microstructure, regulation of bone biomechanical properties, and regulation of the ratio of bone formation and / or bone resorption.

[0200] In one aspect, the present invention provides a combination according to the invention for enhancing bone growth and / or bone strength in a subject.

[0201] In one aspect, the present invention provides the use of the combination according to the invention in the manufacture of a medical food product for enhancing bone growth and / or bone strength in a subject.

[0202] In one aspect, the present invention provides a method for enhancing bone growth and / or bone strength in a subject, the method comprising administering a therapeutically effective amount of the combination according to the invention to a subject in need thereof.

[0203] As used herein, “promoting bone growth and / or strength” can refer to supporting normal bone growth and / or strength, for example, during childhood and adolescence. Supporting normal bone growth and / or strength results in normal bone anatomy and physiology. Appropriate methods and parameters for determining bone growth and strength will be known to those skilled in the art (see, for example, Donnelly, E., 2011. Clinical Orthopaedics and Related Research, 469(8), pp. 2128-2138). Suitablely, one or more bone parameters selected from the following can be used to determine normal bone growth and / or strength: trabecular bone volume fraction (BV / TV), bone mineral density (BMD), bone mineral content (BMC), cortical bone volume (Ct.BV), medial and lateral diameters, anteroposterior diameters, bone ultimate force (FMax), and bone stiffness. In some embodiments, one or more bone parameters selected from the following are used to determine normal bone growth and / or strength: bone mineral density (BMD), trabecular bone volume fraction (BV / TV), cortical bone volume (Ct.BV), and bone ultimate force (FMax). Those skilled in the art can obtain suitable methods for determining these parameters.

[0204] Methods for promoting catch-up growth

[0205] The combination of the present invention can promote catch-up growth in subjects with, for example, growth retardation and / or slowed growth.

[0206] In one aspect, the present invention provides a combination according to the invention for promoting catch-up growth in subjects.

[0207] In one aspect, the present invention provides the use of the combination according to the invention in the manufacture of a medical food product for promoting catch-up growth in subjects.

[0208] In one aspect, the present invention provides a method for promoting catch-up growth in a subject, the method comprising administering a therapeutically effective amount of the combination according to the invention to a subject in need of it.

[0209] As used in this article, “catch-up growth” can refer to a high rate of growth exceeding the normal age limit for at least one year after a brief period of growth inhibition, and can be complete or incomplete (see, for example, Wit, JM and Boersma, B., 2002. Journal of Pediatric Endocrinology and Metabolism, 15, pp. 1229-1242).

[0210] The appropriate methods and parameters for determining catch-up growth are known to those skilled in the art. Appropriately, catch-up growth can be determined using high-velocity or high-standard-deviation scores (see, for example, Frongillo, EA, Leroy, JL and Lapping, K., 2019. Advances in Nutrition, 10(3), pp. 372-379 and Desmond, C. and Casale, D., 2017. PLOS ONE, 12(12), p. e0189135).

[0211] In some implementations, catch-up growth is measured as an absolute term of linear growth (i.e., a reduction in high-level defects from the mean of a healthy reference group). In some implementations, catch-up growth is measured as a relative linear growth (i.e., an improvement in age-high z-score and / or passing the -2SD or -1SD cutoff).

[0212] Example

[0213] The invention is further described with reference to the following embodiments. It should be understood that the invention protected by the claims is not intended to be limited in any way by these embodiments.

[0214] Example 1 - Effects of a combination of vitamins K2, A, D and HMO on bone development

[0215] result

[0216] The effects of vitamins K2, A, D, and short-chain fatty acids (SCFA) on alkaline phosphatase (ALP) activity and osteocalcin mRNA levels in pre-osteoblast cell lines were investigated.

[0217] Seven days after differentiation (without ascorbic acid), vitamins A and D showed significant effects on ALP activity, a marker of osteoblast differentiation; however, vitamin K2 did not show a significant effect (see [link to original text]). Figure 1 A). On the other hand, after 21 days of differentiation (without ascorbic acid), vitamin K2 showed a significant effect on osteocalcin expression, a key protein for osteoblast mineralization activity; however, vitamins A and D did not show a significant effect (see [link to relevant documentation]). Figure 1 B).

[0218] After 28 days of differentiation (containing ascorbic acid), the combination of vitamins K2, A, and D synergistically promotes osteoblast mineralization (see [link to original text]). Figure 1 C).

[0219] The effects of SCFA were further investigated. Three mixtures of 75% acetate, 20% propionate, and 5% butyrate were evaluated to simulate normal physiological conditions (20 μM SCFA), physiological conditions after prebiotic supplementation (50 μM SCFA), and physiological conditions after synbiotic supplementation (60 μM SCFA).

[0220] Seven days after differentiation (without ascorbic acid), the combination of vitamins K2, A, and D with 50 μM or 60 μM SCFA synergistically promotes osteoblast differentiation (see [link to relevant documentation]). Figure 2 This effect is 28.4% higher than the cumulative effect.

[0221] In a simulated gastrointestinal model, a mixture of human milk oligosaccharides (2.5 g / L 2FL, DiFL, LNnT, LNT, and 6SL) was further shown to promote vitamin K2 production in the gastrointestinal tract (see [link to study]). Figure 3 ).

[0222] Materials and methods

[0223] MC3T3-E1 subclone 4 culture and treatment conditions

[0224] Pre-osteoblast cell line MC3T3-E1 subclone 4 (CRL-2593) was purchased from ATCC (Manassas; Virginia, USA). Cells were maintained in growth medium (GM) consisting of ascorbic acid-free αMEM (ThermoFisher Scientific) supplemented with 10% fetal bovine serum (FCS, ThermoFisher Scientific) and 1% penicillin / streptomycin. All medium was replaced every 2 to 3 days. Cells were passaged with trypsin / EDTA solution when confluence was less than 80%. To induce differentiation into osteoblasts, cells were cultured at 5 × 10⁶ cells / year. 4 cells / cm 2Inoculated and grown in GM until confluence lasted 24 hours. The medium was then switched to differentiation medium (DM) consisting of GM supplemented with 10 mM β-glycerophosphate and the treatment solution of interest. Depending on the experiment, 50 µg / ml ascorbic acid was also added to the DM.

[0225] osteoblast alkaline phosphatase activity

[0226] In addition to the positive control, MC3T3-E1 subclonal 4 cells were differentiated for 7 days using the following treatment solutions in the absence of ascorbic acid: a mixture consisting of 3 µM vit. K2 (methylnaphthoquinone-7), 100 nM vit. A (all-trans retinoic acid), and 1 nM vit. D (1α,25-dihydroxyvitamin D3); a mixture designated "SCFA20" consisting of 15 µM sodium acetate, 4 µM sodium propionate, and 1 µM sodium butyrate; a mixture designated "SCFA50" consisting of 37.5 µM sodium acetate, 10 µM sodium propionate, and 2.5 µM sodium butyrate; and a mixture designated "SCFA60" consisting of 45 µM sodium acetate, 12 µM sodium propionate, and 3 µM sodium butyrate. The vitamin mixtures were also combined with three different combinations of short-chain fatty acids (SCFAs).

[0227] After 7 days of differentiation, cells were then collected for alkaline phosphatase (ALP) activity assays, as previously described but with slight modifications. Briefly, cells were lysed by heat shock and collected in ALP buffer (1 M diethanolamine, 0.24 M MgCl2, pH 9.8). The enzymatic reaction was monitored at 405 nm following the addition of disodium 4-nitrophenyl phosphate hexahydrate. Michaelis-Menten kinetics were assessed at 30 °C for 30 min. max Used as a representative of ALP activity. The activity value is normalized to the protein content measured via the Pierce BCA Protein Assay Kit (ThermoFisher Scientific), according to the manufacturer's instructions.

[0228] osteocalcin RNA extraction

[0229] MC3T3-E1 subclone 4 cells were differentiated for 21 days (in DM without ascorbic acid except for the positive control) or 28 days (in DM containing ascorbic acid). Cells were then collected for gene expression analysis. RNA was extracted using the RNeasy plus miniature extraction kit (Qiagen; Hilden, Germany) with the QIAcube (Qiagen) according to the manufacturer's instructions. Briefly, cells were lysed in RLT buffer and centrifuged in a QIAshredder column (Qiagen), followed by processing with the QIAcube. RNA concentration was measured using a DropSense96 (TRINEAN, Gentbrugge, Belgium).

[0230] Reverse transcription and quantitative PCR (qPCR)

[0231] cDNA was synthesized using a high-capacity cDNA reverse transcription kit (AppliedBiosystems; Waltham, Massachusetts, USA) according to the manufacturer's instructions. In short, 0.7 µg of RNA was mixed into the kit components and reverse transcribed using the following procedure: 25°C for 10 min, 37°C for 120 min, and 85°C for 5 min. The cDNA was diluted 7-fold with RNase-free water and used for qPCR using the LightCycler 1536 DNA Green Master kit (Roche; Basel, Switzerland) according to the manufacturer's instructions. In short, cDNA was diluted 7-fold in a solution containing the master mixture, BrightGreen, and DNA primers targeting osteocalcin (Ocn) and β-2-microglobulin (B2m, the housekeeping gene). These DNA primers had the following nucleotide sequences: Ocn-f ACCATCTTTCTGCTCACTCTG, Ocn-rGTTCACTACCTTATTGCCCTCC, B2m-f CACTGACCGGCCTGTATGCT, and B2m-rGTATGTTCGGCTTCCCATTCTC. The reaction was run in a LightCycler 480 II (Roche) using the following procedure: 40 cycles of 7 min at 95°C, 1 sec at 95°C, and 30 sec at 60°C. Methods were used to assess relative gene expression.

[0232] Predigestion and vitamin K2 production

[0233] To assess intestinal production of vitamin K2, the Human Microbiome Ecosystem Simulator (SHIME) was used. ®(See Van de Wiele, T. et al., 2015. The Impact of Food Bioactives on Health: in vitro and ex vivo models, pp. 305-317). SHIME assays typically consist of colonic fermentation of selected amounts of the test compound under simulated conditions representing the gastrointestinal tract of the subject. The yield of methylnaphthoquinone-7 was determined by supercritical fluid chromatography-tandem mass spectrometry (SFC-MS / MS).

[0234] For this group of experiments, a two-stage batch system simulating upper gastrointestinal (upper GIT, stomach, and small intestine) and colonic conditions was used as a simplified SHIME. ® The system. These studies used cow's milk-based infant beverages containing minerals appropriate for the age group, also known as infant formula milk.

[0235] To mimic the absorption process that occurs in the infant's small intestine, a dialysis method was applied using a cellulose membrane with a 14 kDa cutoff. By introducing a small intestinal suspension into the dialysis membrane, molecules such as digested amino acids, sugars, micronutrients, and minerals are gradually removed from the upper gastrointestinal matrix.

[0236] In addition, during the 1-hour incubation period, the pH was gradually decreased from 5.5 to 3.0 during gastric incubation to mimic the pH of an infant's stomach. Furthermore, during the first 30 minutes of small intestinal incubation (duodenal), a fixed pH of 4.5 was maintained to ensure optimal absorption of available minerals. In the subsequent 145-minute small intestinal phase (jejunum + ileum), pH 7 was introduced. The milk matrix, after exposure to gastric and small intestinal conditions, was transferred to a colonic chamber containing an infant's fecal sample.

[0237] Fresh feces were collected from 12-month-old infant donors. Fecal suspensions were prepared and mixed with a preservative. At the start of a short colon incubation, test components (blank; single HMO (1.3 g / L 2 FL); and HMO mixtures ((2.5 g / L 2 FL, DiFL, LNnT, LNT, and 6 SL)) were added to a sugar-depleted nutrient medium containing basal nutrients present in the colon (e.g., host-derived glycans, such as mucins).

[0238] Implementation Plan

[0239] Various preferred features and embodiments of the invention will now be described with reference to the following numbered paragraphs.

[0240] 1. A combination of a vitamin mixture and an oligosaccharide mixture, said combination being used to enhance bone growth and / or bone strength in child or adolescent subjects, wherein said vitamin mixture comprises or consists of vitamin K2, vitamin A and vitamin D, and wherein said oligosaccharide mixture comprises or consists of 2'-fucosylated lactose (2'FL) and at least one other oligosaccharide.

[0241] 2. The combination for the purpose described in paragraph 1, wherein vitamin K2 is administered to the subject at an amount of about 5 µg / day to about 200 µg / day.

[0242] 3. The combination for the purpose described in paragraph 1 or 2, wherein vitamin A is administered to the subject at an amount of about 100 µg RE / day to about 1000 µg RE / day.

[0243] 4. The combination of vitamin D administered to the subject at an amount of about 2.5 µg / day to about 100 µg / day, according to any of the preceding paragraphs for the purpose described above.

[0244] 5. The combination for the purpose described in any of the preceding paragraphs, wherein the at least one additional oligosaccharide comprises at least one sialylated oligosaccharide, at least one fucoidylated oligosaccharide, and / or at least one N-acetylated oligosaccharide, or is composed of the like.

[0245] 6. The combination for the stated purpose as described in paragraph 5, wherein the at least one sialylated oligosaccharide is selected from the group consisting of: 3'-sialyl lactose (3'-SL), 6'-sialyl lactose (6'-SL), sialyl lactose-N-tetrasaccharide b (LSTb), sialyl lactose-N-tetrasaccharide c (LSTc), disialyllactose-N-tetrasaccharide, and combinations thereof, preferably wherein the at least one sialylated oligosaccharide is selected from 3'-sialyl lactose (3'-SL), 6'-sialyl lactose (6'-SL), and combinations thereof.

[0246] 7. The combination for the stated purpose as described in paragraph 5 or 6, wherein the at least one fucosylated oligosaccharide is selected from the group consisting of: 3-fucosylated lactose (3FL), difucosylated lactose (diFL), lactose-N-fucopentose-I (LNFP-I), lactose-N-fucopentose-II (LNFP-II), lactose-N-fucopentose-III (LNFP-III), and lactose-N-fucopentose-V (LNFP-V). Lactose-neofucopentose V (LNnFP-V), lactose-N-difucosylhexose-I (LNDFH-1), lactose-N-neofucopentose-hexose (LNnDFH), monofucosyllactose-N-hexose-III (MFNLH-III), difucosyllactose-N-hexose-a (DFLNHa), and combinations thereof, preferably wherein at least one of the fucoidylated oligosaccharides is difucosyllactose (diFL).

[0247] 8. The combination for the purpose according to any one of paragraphs 5 to 7, wherein the at least one N-acetylated oligosaccharide is selected from the group consisting of: N-acetyl-glucosamine, N-acetyl-galactosamine, lactose-N-tetrasaccharide (LNT), lactose-N-neotetrasaccharide (LNnT), and combinations thereof, preferably wherein the at least one N-acetylated oligosaccharide is selected from lactose-N-tetrasaccharide (LNT), lactose-N-neotetrasaccharide (LNnT), and combinations thereof.

[0248] 9. The combination for the purpose described in any of the preceding paragraphs, wherein the oligosaccharide mixture is administered to the subject in a total amount of about 0.5 g / day to about 10 g / day.

[0249] 10. The combination of the use described in any of the preceding paragraphs, wherein 2'FL is administered to the subject at an amount of about 0.5 g / day to about 5 g / day.

[0250] 11. The combination for the stated purpose according to any of the preceding paragraphs, wherein the oligosaccharide mixture comprises:

[0251] (a) About 10% to about 35% of the total weight of the oligosaccharide mixture, preferably about 10% to about 30% of the total weight, more preferably about 10% to about 25% of the total weight of the oligosaccharide mixture;

[0252] (b) at least one fucoidylated oligosaccharide, comprising about 30% to about 80% by weight, preferably about 40% to about 80% by weight, more preferably about 50% to about 70% by weight, relative to the total weight of the oligosaccharide mixture; and / or

[0253] (c) at least one N-acetylated oligosaccharide, comprising about 10% to about 35% of the total weight of the oligosaccharide mixture, preferably about 15% to about 30% of the total weight, and more preferably about 15% to about 20% of the total weight of the mixture.

[0254] 12. The combination for the purpose described in any of the preceding paragraphs, wherein the combination is provided in the form of a nutritional composition.

[0255] 13. The combination for the purpose described in any of the preceding paragraphs, wherein the combination is provided in the form of a medical food product for clinical nutrition.

[0256] 14. The combination for the purpose described in any of the preceding paragraphs, wherein the combination is provided in the form of a dairy formula food.

[0257] 15. The combination for the purpose according to any one of paragraphs 12 to 14, wherein the composition comprises vitamin K2 in an amount of about 5 µg / 100g to about 200 µg / 100g based on a dry weight.

[0258] 16. The combination for the purpose according to any one of paragraphs 12 to 15, wherein the composition comprises vitamin A in an amount based on about 100 µg RE / 100g to about 1000 µg RE / 100g by dry weight.

[0259] 17. The combination for the purpose according to any one of paragraphs 12 to 16, wherein the composition comprises vitamin D in an amount from about 2.5 µg / 100g to about 100 µg / 100g based on a dry weight.

[0260] 18. The combination for the purpose according to any one of paragraphs 12 to 17, wherein the composition comprises the oligosaccharide mixture in a total amount based on about 0.5% by weight to about 10% by weight of dry weight.

[0261] 19. The combination for the purpose according to any one of paragraphs 12 to 18, wherein the composition comprises 2'FL in an amount of about 0.5% by weight to about 5% by weight based on dry weight.

[0262] 20. The combination of the uses described in any of the preceding paragraphs, wherein the subject is a human.

[0263] 21. The combination of the subjects for the purposes described in any of the preceding paragraphs, wherein the subjects are about 3 years of age or older and / or about 10 years of age or younger, preferably wherein the subjects are about 3 years of age to about 10 years of age.

[0264] 22. The combination for the purpose described in any one of paragraphs 1 to 19, wherein the subject is an animal, preferably wherein the animal is a pet.

[0265] 23. The combination of the uses described in any of the preceding paragraphs, wherein the subject has and / or is suffering from growth retardation and / or growth slowdown.

[0266] 24. The combination of the preceding paragraphs for the purposes described herein, wherein the subject is preterm or has low birth weight or experiences intrauterine growth retardation.

[0267] 25. The combination for the purpose described in any of the preceding paragraphs, wherein the combination is administered orally.

[0268] 26. The combination of the uses described in any of the preceding paragraphs, wherein the combination is applied individually, simultaneously or sequentially, preferably wherein the combination is applied simultaneously.

[0269] 27. The combination for the purpose described in any of the preceding paragraphs, wherein the combination synergistically enhances bone growth and / or bone strength.

[0270] 28. The combination for the purpose described in any of the preceding paragraphs, wherein the combination enhances bone mineralization.

[0271] 29. The combination for the purpose described in any of the preceding paragraphs, wherein the combination promotes osteoblast mineralization and / or osteoblast differentiation.

[0272] 30. The combination of bone mineral density (BMD), trabecular bone volume fraction (BV / TV), cortical bone volume (Ct.BV), and bone ultimate strength (FMax) as described in any of the preceding paragraphs for the purpose thereof.

[0273] 31. The combination for the purpose described in any of the preceding paragraphs, wherein the combination promotes catch-up growth, preferably wherein catch-up growth is determined using height velocity.

[0274] 32. Use of a combination of vitamin mixtures and oligosaccharide mixtures in the manufacture of a medical food product for enhancing bone growth and / or bone strength in child or adolescent subjects, wherein the vitamin mixture comprises or consists of vitamin K2, vitamin A, and vitamin D, and wherein the oligosaccharide mixture comprises or consists of 2'-fucosylated lactose (2'FL) and at least one other oligosaccharide.

[0275] 33. A method for enhancing bone growth and / or bone strength in a child or adolescent subject, the method comprising administering to the subject an effective amount of a combination of a vitamin mixture and an oligosaccharide mixture, wherein the vitamin mixture comprises or consists of vitamin K2, vitamin A, and vitamin D, and wherein the oligosaccharide mixture comprises or consists of 2'-fucosylated lactose (2'FL) and at least one other oligosaccharide.

[0276] 34. Use of oligosaccharide mixtures in promoting vitamin K2 production in the gut of subjects.

[0277] 35. According to the use described in paragraph 34, the oligosaccharide mixture comprises or consists of 2'-fucosylated lactose (2'FL) and at least one other oligosaccharide.

[0278] 36. The use as described in paragraph 34 or 35, wherein the at least one additional oligosaccharide comprises at least one sialylated oligosaccharide, at least one fucoidylated oligosaccharide, and / or at least one N-acetylated oligosaccharide, or is composed of the like.

[0279] 37. According to the use described in paragraph 36, the at least one sialylated oligosaccharide is selected from the group consisting of 3'-sialyl lactose (3'-SL), 6'-sialyl lactose (6'-SL), sialyl lactose-N-tetrasaccharide b (LSTb), sialyl lactose-N-tetrasaccharide c (LSTc), disialyllactose-N-tetrasaccharide, and combinations thereof, preferably wherein the at least one sialylated oligosaccharide is selected from 3'-sialyl lactose (3'-SL), 6'-sialyl lactose (6'-SL), and combinations thereof.

[0280] 38. According to the use described in paragraph 36 or 37, wherein the at least one fucosylated oligosaccharide is selected from the group consisting of: 3-fucosylvose (3FL), difucosylvose (diFL), lactose-N-fucopentose-I (LNFP-I), lactose-N-fucopentose-II (LNFP-II), lactose-N-fucopentose-III (LNFP-III), and lactose-N-fucopentose-V (LNFP-V). Lactose-neofucopentose V (LNnFP-V), lactose-N-difucosylhexose-I (LNDFH-1), lactose-N-neofucopentose-hexose (LNnDFH), monofucosyllactose-N-hexose-III (MFNLH-III), difucosyllactose-N-hexose-a (DFLNHa), and combinations thereof, preferably wherein at least one of the fucoidylated oligosaccharides is difucosyllactose (diFL).

[0281] 39. The use according to any one of paragraphs 36 to 38, wherein the at least one N-acetylated oligosaccharide is selected from the group consisting of: N-acetyl-glucosamine, N-acetyl-galactosamine, lactose-N-tetrasaccharide (LNT), lactose-N-neotetrasaccharide (LNnT), and combinations thereof, preferably wherein the at least one N-acetylated oligosaccharide is selected from lactose-N-tetrasaccharide (LNT), lactose-N-neotetrasaccharide (LNnT), and combinations thereof.

[0282] 40. The use according to any one of paragraphs 34 to 39, wherein the oligosaccharide mixture is administered to the subject in a total amount of about 0.5 g / day to about 10 g / day.

[0283] 41. The use according to any one of paragraphs 34 to 40, wherein 2'FL is administered to the subject in an amount of about 0.5 g / day to about 5 g / day.

[0284] 42. The use according to any one of paragraphs 34 to 41, wherein the oligosaccharide mixture comprises:

[0285] (a) About 10% to about 35% of the total weight of the oligosaccharide mixture, preferably about 10% to about 30% of the total weight, more preferably about 10% to about 25% of the total weight of the oligosaccharide mixture;

[0286] (b) at least one fucoidylated oligosaccharide, comprising about 30% to about 80% by weight, preferably about 40% to about 80% by weight, more preferably about 50% to about 70% by weight, relative to the total weight of the oligosaccharide mixture; and / or

[0287] (c) at least one N-acetylated oligosaccharide, comprising about 10% to about 35% of the total weight of the oligosaccharide mixture, preferably about 15% to about 30% of the total weight, and more preferably about 15% to about 20% of the total weight of the mixture.

[0288] Although the invention has been described by way of example, it should be understood that variations and modifications may be made without departing from the scope of the invention as defined in the claims. Furthermore, if known equivalents exist for specific features, such equivalents should be incorporated as expressly mentioned in this specification.

Claims

1. A combination of a vitamin mixture and an oligosaccharide mixture, said combination being used to enhance bone growth and / or bone strength in child or adolescent subjects, wherein said vitamin mixture comprises or consists of vitamin K2, vitamin A and vitamin D, and wherein said oligosaccharide mixture comprises or consists of 2'-fucosylated lactose (2'FL) and at least one other oligosaccharide.

2. The combination for the purpose according to claim 1, wherein vitamin K2 is administered to the subject at an amount of about 5 µg / day to about 200 µg / day, wherein vitamin A is administered to the subject at an amount of about 100 µg RE / day to about 1000 µg RE / day, and / or wherein vitamin D is administered to the subject at an amount of about 2.5 µg / day to about 100 µg / day.

3. The combination for the purpose according to claim 1 or 2, wherein the at least one additional oligosaccharide comprises at least one sialylated oligosaccharide, at least one fucoidylated oligosaccharide, and / or at least one N-acetylated oligosaccharide, or is composed of the like.

4. The combination for the said purpose according to claim 3, wherein: (a) The at least one sialylated oligosaccharide is selected from the group consisting of: 3'-sialyl lactose (3'-SL), 6'-sialyl lactose (6'-SL), sialyl lactose-N-tetrasaccharide b (LSTb), sialyl lactose-N-tetrasaccharide c (LSTc), disialyllactose-N-tetrasaccharide, and combinations thereof, preferably wherein the at least one sialylated oligosaccharide is selected from 3'-sialyl lactose (3'-SL), 6'-sialyl lactose (6'-SL), and combinations thereof; (b) The at least one fucosylated oligosaccharide is selected from the group consisting of: 3-fucosylated lactose (3FL), difucosylated lactose (diFL), lactose-N-fucopentose-I (LNFP-I), lactose-N-fucopentose-II (LNFP-II), lactose-N-fucopentose-III (LNFP-III), lactose-N-fucopentose-V (LNFP-V), lactose-neofofucopentose-V (LNnFP-V), lactose-N-difucosylated hexose-I (LNDFH-1), lactose-N-neofodifucosylated hexose (LNnDFH), monofucosylated lactose-N-hexose-III (MFNLH-III), difucosylated lactose-N-hexose-a (DFLNHa), and combinations thereof, preferably wherein the at least one fucosylated oligosaccharide is difucosylated lactose (diFL); and / or (c) The at least one N-acetylated oligosaccharide is selected from the group consisting of N-acetyl-glucosamine, N-acetyl-galactosamine, lactose-N-tetrasaccharide (LNT), lactose-N-neotetrasaccharide (LNnT), and combinations thereof, preferably wherein the at least one N-acetylated oligosaccharide is selected from lactose-N-tetrasaccharide (LNT), lactose-N-neotetrasaccharide (LNnT), and combinations thereof.

5. The combination for the purpose according to any of the preceding claims, wherein the oligosaccharide mixture is administered to the subject in a total amount of about 0.5 g / day to about 10 g / day.

6. The combination for the said use according to any preceding claim, wherein the oligosaccharide mixture comprises: (a) About 10% to about 35% of the total weight of the oligosaccharide mixture, preferably about 10% to about 30% of the total weight, more preferably about 10% to about 25% of the total weight of the oligosaccharide mixture; (b) at least one fucoidylated oligosaccharide, comprising about 30% to about 80% by weight, preferably about 40% to about 80% by weight, more preferably about 50% to about 70% by weight, relative to the total weight of the oligosaccharide mixture; and / or (c) at least one N-acetylated oligosaccharide, comprising about 10% to about 35% of the total weight of the oligosaccharide mixture, preferably about 15% to about 30% of the total weight, and more preferably about 15% to about 20% of the total weight of the mixture.

7. The combination for the said use according to any of the preceding claims, wherein the combination is provided in the form of a nutritional composition, optionally wherein the combination is provided in the form of a dairy formula food.

8. The combination for the purpose according to any of the preceding claims, wherein the subject is a human being, preferably wherein the subject is about 3 years of age or older and / or about 10 years of age or younger, more preferably wherein the subject is about 3 years of age or about 10 years of age.

9. The combination for the purpose according to any one of claims 1 to 7, wherein the subject is an animal, preferably wherein the animal is a pet.

10. The combination for the purpose according to any of the preceding claims, wherein the subject has and / or is suffering from growth retardation and / or growth slowdown.

11. The combination for the purpose according to any of the preceding claims, wherein the combination is administered orally, preferably wherein the combination is administered simultaneously.

12. The combination for the purpose according to any of the preceding claims, wherein the combination synergistically enhances bone growth and / or bone strength.

13. The combination for the purpose according to any of the preceding claims, wherein the combination promotes osteoblast mineralization and / or osteoblast differentiation.

14. The combination for the purpose according to any of the preceding claims, wherein the combination improves one or more bone parameters selected from: bone mineral density (BMD), trabecular bone volume fraction (BV / TV), cortical bone volume (Ct.BV), and bone ultimate force (FMax).

15. The combination for the purpose according to any of the preceding claims, wherein the combination promotes catch-up growth, preferably wherein catch-up growth is determined using height velocity.

Images