Primer probe combination for detecting parvovirus B19

Abstract

The invention discloses a primer probe combination for detecting parvovirus B19. According to the invention, a method for simultaneously detecting double targets of the NS1 gene and the VP1 gene of the B19 virus is established, the detection accuracy is improved, the clinical omission ratio is reduced, meanwhile, the result credibility is increased, and unnecessary confirmation experiments are reduced. Meanwhile, the method using the MGB-TaqMan fluorescent probe has the advantages of rapidness, sensitivity, easiness in operation and the like, the double-target synergism is good, and the clinical reinspection condition can be reduced.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to a primer-probe combination for detecting parvovirus B19. Background Technology

[0002] Human parvovirus B19, or B19 virus for short, belongs to the family Parvoviridae, genus Erythrovirus. It is a non-enveloped, single-stranded linear DNA virus with a genome size of approximately 5.6 kb, encoding six genes. Phylogenetic analysis of the NS1-VP1 region classifies B19 into three genotypes: 1, 2, and 3. In my country, genotype 1a is the predominant type circulating clinically. Currently, human parvovirus B19 has become one of the major pathogens threatening the safety of blood products.

[0003] Specific IgG antibodies only begin to appear 15 days after B19 infection, and a definitive diagnosis of acute B19 infection requires IgG to change from negative to positive or a titer ≥4-fold increase, along with positive specific IgM antibodies. Therefore, confirming B19 infection through serum antibody detection during the acute phase is quite difficult. Currently, the main method for B19 virus nucleic acid detection is the single-gene TaqMan fluorescent probe method, which is prone to false negatives in samples with low viral loads and viral mutant strains.

[0004] Therefore, providing a more accurate method for detecting the B19 virus is of great importance in this field. Summary of the Invention

[0005] To overcome the shortcomings of existing technologies, this invention provides a primer-probe combination for detecting parvovirus B19.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] A first aspect of the present invention provides a primer-probe combination for detecting parvovirus B19, said primer-probe combination having at least 90% identity with the nucleic acid sequence shown in any one of SEQ ID NO:1-6.

[0008] Furthermore, the primer-probe combination is shown in SEQ ID NO:1-6.

[0009] Furthermore, the primers are labeled with a labeling substance.

[0010] Furthermore, the labeling substance includes fluorescent substances, radioactive isotopes, or enzymes.

[0011] Furthermore, the fluorescent substances include TAMRA, Alexa 555, Alexa 647, Cy3 and Cy5 of the cyanine dye series, and fluorescein.

[0012] Furthermore, the radioactive isotope includes 32 P, 33 P, 35 S.

[0013] Furthermore, the enzymes include alkaline phosphatase and horseradish peroxidase.

[0014] Furthermore, the probe is connected to a fluorescent group and / or a quenching group.

[0015] Furthermore, the fluorescent group includes FAM, FITC, HEX, VIC, TET, JOE, ROX, CY3, CY5, or CY7.

[0016] Furthermore, the quenching group includes MGB, BHQ1, BHQ2, BHQ3, or DABCYL.

[0017] A second aspect of the present invention provides a reagent for detecting parvovirus B19, the reagent comprising the primer-probe combination described in the first aspect of the present invention.

[0018] Furthermore, the reagent also includes enzymes for PCR.

[0019] Furthermore, the enzymes used for PCR include DNA repair enzymes, DNA polymerases, and RNA polymerases.

[0020] Furthermore, the DNA repair enzyme is selected from UDG enzymes.

[0021] Furthermore, the reagents also include dNTPs, buffer solution, and Mg. 2+ .

[0022] Furthermore, the buffer solution includes polymerase buffer and Tris hydrochloric acid buffer.

[0023] Furthermore, Mg 2+ The sources include MgCl2 and MgSO4.

[0024] A third aspect of the present invention provides a kit for detecting parvovirus B19, the kit comprising the primer-probe combination described in the first aspect of the present invention or the reagent described in the second aspect of the present invention.

[0025] Furthermore, the kit also includes a fluorescent dye.

[0026] Furthermore, the kit also includes instructions.

[0027] A fourth aspect of the present invention provides a method for amplifying the sequence of parvovirus B19, the method comprising performing an amplification reaction using the primer-probe combination described in the first aspect of the present invention, the reagent described in the second aspect of the present invention, or the kit described in the third aspect of the present invention.

[0028] Furthermore, the amplification reaction is performed using PCR.

[0029] Furthermore, the PCR is a multiplex PCR.

[0030] Furthermore, the amplification reaction is carried out under similar amplification conditions.

[0031] Furthermore, the method described is not for diagnostic purposes.

[0032] The fifth aspect of the present invention provides a method for detecting parvovirus B19 in a sample, the method comprising using the primer-probe combination described in the first aspect of the present invention, the reagent described in the second aspect of the present invention, the kit described in the third aspect of the present invention, or the method described in the fourth aspect of the present invention.

[0033] Furthermore, the method described is not for diagnostic purposes.

[0034] The sixth aspect of the present invention provides the application of the primer-probe combination described in the first aspect of the present invention, the reagent described in the second aspect of the present invention, or the kit described in the third aspect of the present invention in the amplification / detection of parvovirus B19.

[0035] Furthermore, the amplification / detection of parvovirus B19 is for non-diagnostic purposes.

[0036] The seventh aspect of the present invention provides the use of the primer-probe combination described in the first aspect of the present invention, the reagent described in the second aspect of the present invention, or the kit described in the third aspect of the present invention in the preparation of products for amplification / detection of parvovirus B19.

[0037] Advantages and beneficial effects of the present invention:

[0038] This application establishes a method for simultaneously detecting the NS1 and VP1 genes of the B19 virus, which improves detection accuracy, reduces the clinical false negative rate, increases the reliability of results, and reduces unnecessary confirmatory experiments. Furthermore, the method using MGB-TaqMan fluorescent probes offers advantages such as speed, sensitivity, and ease of operation, and the good synergy between the two targets reduces the need for retesting in clinical settings.

[0039] The primer-probe combination of the TaqMan-MGB fluorescent probe method in this application, when used with qPCR, achieves a sensitivity of up to 10 IU / mL, providing highly specific detection results for extremely low concentrations of B19 DNA or RNA. For blood pooled sample testing (e.g., 10-to-1, 100-to-1), it exhibits even higher sensitivity, reducing the false negative rate for positive samples. Using digital PCR, it can accurately quantify the B19 viral load with a sensitivity of 0.5-1 copies / mL, reducing the uncertainty or bias in single-gene quantification, thus achieving more precise detection. Attached Figure Description

[0040] Figure 1 This is a graph showing the amplification curves of B19 virus with different primer concentrations;

[0041] Figure 2 These are amplification curves of B19 virus at different probe concentrations;

[0042] Figure 3 These are amplification curves of the B19 virus verified at different Tm levels.

[0043] Figure 4 It is a B19 virus amplification curve that verifies the positive concordance rate, detection limit, and specificity. Detailed Implementation

[0044] The following provides definitions for some of the terms used in this specification. Unless otherwise stated, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0045] The present invention provides a primer-probe combination for detecting parvovirus B19, wherein the primer-probe combination has at least 90% identity with the nucleic acid sequence shown in any one of SEQ ID NO:1-6.

[0046] In some embodiments, identity / similarity refers to the similarity between two or more nucleic acid sequences, or two or more amino acid sequences, expressed according to the identity or similarity between sequences. Sequence identity can be measured by percentage identity; the higher the percentage, the more consistent the sequences. When compared using standard methods, homologs or orthologs of nucleic acid or amino acid sequences have a relatively high level of sequence identity / similarity. The primers disclosed in this application are not limited to the exact sequences shown, and as those skilled in the art will recognize, the sequences can be modified if necessary without significantly affecting the primers' ability to function. For example, sequences with at least 90% identity to any of SEQ ID NO:1-6, preferably at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, such as 100% sequence identity, are provided in this application. Those skilled in the art will recognize that these provided sequence identity ranges are merely for guidance purposes, and primers outside these ranges may also be used.

[0047] The primers are labeled with a marker substance, which may include a fluorescent substance, a radioactive isotope, or an enzyme.

[0048] In some embodiments, fluorescent substances include, but are not limited to, TAMRA, Alexa555, Alexa647, Cy3 and Cy5 of the cyanine dye series, and fluorescein.

[0049] Radioactive isotopes include, but are not limited to, 32 P, 33 P, 35 S.

[0050] Enzymes include, but are not limited to, alkaline phosphatase and horseradish peroxidase.

[0051] In some embodiments, the primers of this application labeled with a labeling substance can bind directly to the primers or bind via a linker. As the linker, any linker commonly used in the field is acceptable; specifically, for example, nucleic acids of 1 to 3 bases are preferred, DNA of 1 to 3 bases is more preferred, DNA of 2 bases is even more preferred, and adenine (A)-adenine (A) is particularly preferred.

[0052] As for the method of labeling the primers involved in this application with fluorescent substances, it is sufficient to follow the methods known in themselves that are commonly used in the field.

[0053] As for the method of labeling the primers involved in this application with radioisotopes, any method known in the art can be used. Specifically, examples include random priming, nick translation, 5' end labeling based on T4 polynucleotide kinase, and 3' end labeling based on terminal deoxynucleotidyl transferase. The primers include at least one modified nucleotide.

[0054] As for the method of labeling the primers involved in this application with enzymes, it is sufficient to follow the methods known in themselves that are commonly used in the field. Specifically, for example, direct labeling methods can be used, such as directly covalently binding enzyme molecules such as alkaline phosphatase and horseradish peroxidase to the primers to be labeled.

[0055] The probe is connected to a fluorescent group and / or a quenching group.

[0056] In some embodiments, the fluorescent group includes FAM, FITC, HEX, VIC, TET, JOE, ROX, CY3, CY5, or CY7.

[0057] In a specific embodiment, the fluorescent group is selected from FAM or VIC.

[0058] In some embodiments, the quenching group includes MGB, BHQ1, BHQ2, BHQ3, or DABCYL.

[0059] In a specific implementation, the quenching group is selected from MGB.

[0060] The present invention provides a reagent for detecting parvovirus B19, the reagent comprising the above-described primer-probe combination.

[0061] The reagents also include enzymes for PCR, including DNA repair enzymes, DNA polymerases, and RNA polymerases.

[0062] In some embodiments, DNA repair enzymes include UDG enzyme (uracil-DNA glycosidase), Endonuclease VIII, AP endonuclease, DNA polymerase I, and DNA ligase.

[0063] In a specific implementation, the DNA repair enzyme is selected from UDG enzymes.

[0064] In some embodiments, the DNA polymerase includes, but is not limited to, Taq, Bst, Vent, Phi29, Pfu, Tru, Tth, Tl1, Tac, Tne, Tma, Tih, Tf1, Pwo, Kod, Sac, Sso, Poc, Pab, Mth, Pho, ES4 DNA polymerase, and the Klenow fragment.

[0065] The reagents also include dNTPs, buffer solutions, and Mg. 2+ .

[0066] In some embodiments, the buffer is used to adjust the pH of the sample provided for PCR analysis to 7.0–10.0 (more preferably pH 8.0–9.0). The buffer includes, but is not limited to, polymerase buffer and Tris hydrochloride buffer.

[0067] In some implementations, dNTPs are nucleoside sources for PCR-based DNA amplification, including dATP, dGTP, dCTP, dTTP, etc. Alternatively, dNTPs can be chemically modified for hot-start methods, such as CleanAmp™ dNTPs manufactured by TriLink BioTechnologies, Inc.

[0068] In some implementations, in PCR-based DNA amplification, Mg is used as... 2+ Sources, including but not limited to MgCl2, MgSO4, etc.

[0069] The present invention provides a kit for detecting parvovirus B19, the kit comprising the above-described primer-probe combination or the above-described reagents.

[0070] In some embodiments, suitable amounts of one or more primer probes are provided in one or more containers, or immobilized on a matrix. The primer probes may be provided as a suspension in an aqueous solution, or, for example, as a lyophilized or freeze-dried powder. The container providing the nucleic acid can be any conventional container capable of containing the provided form, such as a microcentrifuge tube, ampoule, or bottle. The kit may contain labeled or unlabeled probes for detecting the nucleotide sequence of parvovirus B19. In some embodiments, one or more primers (as described above) may be provided in pre-measured, single-use amounts in separate, typically disposable tubes or equivalent containers.

[0071] In some implementations, the amount of nucleic acid primers and probes provided in the kit can be any suitable amount, depending on the target market for the product. For example, if the kit is intended for research or clinical applications, the amount of each nucleic acid primer provided can be sufficient to initiate several PCR amplification reactions. The kit may contain more than two primers to facilitate PCR amplification of larger quantities of parvovirus B19 nucleotide sequences.

[0072] In some embodiments, various known fluorescent dyes can be used. Examples include methods using intercalators with marking functions, and methods using probes that bind fluorescent substances to nucleotides that specifically hybridize to relatively amplified DNA sequences. Examples of intercalators include ethidium bromide and SYBR Green I as unsaturated fluorescent dyes, and Resolight and EvaGreen as saturated fluorescent dyes. Preferred intercalators are SYBR Green I as an unsaturated fluorescent dye, and EvaGreen and Resolight as saturated fluorescent dyes; more preferably, EvaGreen and Resolight are saturated fluorescent dyes. The amount used is determined according to the recommendations of the manufacturer or distributor of the fluorescent dye used.

[0073] The kit also includes an instruction manual, which may include guidance on obtaining and processing samples.

[0074] In addition, the kit may contain bacterial genomic DNA as a positive control for PCR and sterile water as a negative control.

[0075] In some implementations, as additional necessary equipment, examples include pipettes, pipette tips, 1.5ml microtubes, and other instruments widely used in molecular biology experiments. As for devices, examples include PCR instruments, clean benches, and tube centrifuges, and other instruments widely used in molecular biology experiments.

[0076] In some implementations, amplification conditions involve a temperature and / or incubation time suitable for obtaining a detectable amount of the target. Therefore, similar amplification conditions mean that, if desired, each target can be assayed at a similar temperature. Similar amplification conditions also mean that, if desired, each target can be assayed at a similar incubation time. In some cases, similar amplification conditions also involve the number of amplification cycles. However, it is well known in the art that the number of cycles is not always strict. For example, some samples may be removed or left to undergo additional amplification cycles before other samples. In other cases, similar amplification conditions also involve the nature of the buffer and amplification reagents (enzymes, nucleotides, salts, etc.) used. Similar amplification conditions also mean that conditions (e.g., time, buffer, number of cycles, temperature, etc.) can be slightly varied or can be the same.

[0077] The method described in this application is a non-diagnostic amplification / detection method. This method can detect parvovirus B19 in samples in a laboratory or any conventional environment. The sources of the samples include, but are not limited to, soil, food, water, and pure virus cultures.

[0078] The invention is further illustrated below with reference to specific embodiments. It should be understood that the specific embodiments described herein are by way of example and are not intended to limit the invention. The main features of the invention can be used in various embodiments without departing from the scope of the invention.

[0079] Example 1: Validation of different primer concentrations (qPCR methodology)

[0080] 1. Experimental materials

[0081] qPCR premix: TaqProbe 2× qPCR-Multiplex premix, Sangon Biotech (Shanghai) Co., Ltd., catalog number: B630005.

[0082] Primers and probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and were reconstituted with enzyme-free water to 100 μM as the stock solution.

[0083] Primers and probes are shown in SEQ ID NO:1-6:

[0084] Upstream primer SEQ ID NO:1: CAGTTATCTGACCACCCCCAT

[0085] Downstream primer SEQ ID NO:2: GTCATGAATCCTTGCAGCACTG

[0086] Probe SEQ ID NO:3: FAM-TGAAGACTTACACAAGCCTG-MGB

[0087] Forward primer SEQ ID NO:4: TGGTGTAATGCACAAAGCTGG

[0088] Forward primer SEQ ID NO:5: TGATTCTCCTGAACTGGTCCC

[0089] Probe SEQ ID NO:6: VIC-CACCACCACTGCTGCT-MGB

[0090] Verification samples: National standards for the second-generation human parvovirus B19 nucleic acid detection reagent, S1 - S5, from the National Institutes for Food and Drug Control, diluted 1:100 with negative plasma; Negative control: RNase / DNase-free deionized water; Positive control: National reference for the second-generation human parvovirus B19 nucleic acid detection reagent, R, diluted 1:10 with negative plasma.

[0091] Instrument: Fluorescent quantitative PCR instrument ABI7500, nucleic acid extraction or purification reagent (Shanghai Berger Medical Technology Co., Ltd., filing number: Shanghai Feng Medical Equipment Preparation No. 20180202).

[0092] 2. Experimental method

[0093] Nucleic acid extraction of verification samples: Use the nucleic acid extraction or purification reagent of Shanghai Berger Medical Technology Co., Ltd. to extract the samples. The loading volume during extraction is 200 μL, and the elution volume is 100 μL; When loading onto the machine, the sample volume is 10 μL for all.

[0094] The amplification system is 25 μL, including: 12.5 μL of 2×Mix solution, 1 μL of UDG enzyme, 10 μL of sample, 1.5 μL of primer-probe mixture. Five concentration groups are set, as shown in Table 1 specifically.

[0095] Table 1 Specific concentration settings

[0096]

[0097] PCR amplification conditions are: The first stage is 50°C for 2 min; The second stage is 95°C for 5 min; The third stage: 95°C, 15 s; 60°C, 30 s; 45 cycles.

[0098] Positive judgment value: For the NS1 channel, if Ct ≤ 40, it is determined as positive for the NS1 gene; if Ct > 40 or there is no Ct, it is determined as negative for the NS1 gene; For the VP1 channel, if Ct ≤ 40, it is determined as positive for the VP1 gene; if Ct > 40 or there is no Ct, it is determined as negative for the VP1 gene.

[0099] Interpretation of results: If both NS1 and VP1 are positive, the result is considered positive for B19 virus; if both genes are negative, the result is considered negative for B19 virus; if either NS1 or VP1 is positive, the test should be repeated once. If the result is positive for both genes or positive for one gene, the result is considered positive for B19 virus; if the result is negative for both genes, the result is considered negative for B19 virus.

[0100] 3. Experimental Results

[0101] Results analysis: The national reference products S1-S5 of the second-generation human parvovirus B19 nucleic acid detection reagents were all positive for both NS1 and VP1 genes, and were judged to be positive for B19 virus; all PC samples were positive for both genes, and all NC samples were negative.

[0102] Comprehensive analysis showed no significant difference in Ct between S1 and S5 of groups 1 to 5. Considering factors such as cost, linearity, and luminescence value, group 4 (primer: 500 nM, probe: 250 nM) was selected as the optimal experimental condition.

[0103] See detailed results Figure 1 Tables 2 and 3.

[0104] Table 2 Validation results of NS1 in samples

[0105]

[0106] Table 3 Validation results of sample VP1

[0107]

[0108] No Ct indicates that there is no Ct value.

[0109] Example 2: Validation of different probe concentrations (qPCR methodology)

[0110] 1. Experimental materials

[0111] qPCR premix: TaqProbe 2× qPCR-Multiplex premix, Sangon Biotech (Shanghai) Co., Ltd., catalog number: B630005.

[0112] Primers and probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and were reconstituted with enzyme-free water to 100 μM as the stock solution.

[0113] Validation samples: National standard S1-S5 of the second-generation human parvovirus B19 nucleic acid detection reagent, from the National Institutes for Food and Drug Control, diluted 1:100 with negative plasma; Negative control: Deionized water without RNA / DNase; Positive control: National reference R of the second-generation human parvovirus B19 nucleic acid detection reagent, diluted 1:10 with negative plasma.

[0114] Instruments: Fluorescent quantitative PCR instrument ABI7500, nucleic acid extraction or purification reagents (Shanghai Berger Medical Technology Co., Ltd., filing number: Shanghai Feng Medical Equipment Preparation 20180202).

[0115] 2. Experimental methods

[0116] Verification of nucleic acid extraction from samples: Use the nucleic acid extraction or purification reagents of Shanghai Berger Medical Technology Co., Ltd. to extract the samples. The loading volume during extraction is 200 μL, and the elution volume is 100 μL; when loading onto the instrument, the sample volume is 10 μL for all.

[0117] The amplification system is 25 μL, including: 12.5 μL of 2×Mix solution, 1 μL of UDG enzyme, 10 μL of sample, 1.5 μL of primer-probe mixture. Five groups of concentrations are set, as shown in Table 4 specifically.

[0118] Table 4 Specific concentration settings

[0119]

[0120] PCR amplification conditions are: the first stage is 50°C for 2 min; the second stage is 95°C for 5 min; the third stage is: 95°C, 15 s; 60°C, 30 s; 45 cycles.

[0121] Positive judgment value: For the NS1 channel, if Ct ≤ 40, it is judged as positive for the NS1 gene; if Ct > 40 or there is no Ct, it is judged as negative for the NS1 gene; for the VP1 channel, if Ct ≤ 40, it is judged as positive for the VP1 gene; if Ct > 40 or there is no Ct, it is judged as negative for the VP1 gene.

[0122] Result interpretation: If both the NS1 and VP1 genes are positive, it is judged as positive for B19 virus; if both genes are negative, it is judged as negative for B19 virus; if NS1 or VP1 is positive, the extraction and detection are repeated once. If the result is positive for both genes or positive for a single gene, it is judged as positive for B19 virus; if the result is negative for both genes, it is judged as negative for B19 virus.

[0123] 3. Experimental results

[0124] Result analysis: For the national reference products S1 - S5 of the second-generation parvovirus B19 nucleic acid detection reagent, both the NS1 and VP1 genes are positive, and it is judged as positive for B19 virus; PC are all positive for both genes, and the NC groups are all negative.

[0125] Comprehensive analysis shows that there is no obvious difference in Ct for S1 - S5 in groups 1 - 5. Considering factors such as cost, linearity, and luminescence value, group 2 (primer: 500 nM, probe: 250 nM) is selected as the optimal experimental condition.

[0126] For detailed results, see Figure 2 , Table 5 and Table 6.

[0127] Verification Results of Sample NS1 in Table 5

[0128]

[0129] Verification Results of Sample VP1 in Table 6

[0130]

[0131] Verification of Different Tm in Example 3 (qPCR Methodology)

[0132] 1. Experimental Materials

[0133] qPCR Premix: TaqProbe 2× qPCR-Multiplex Premix, Sangon Biotech (Shanghai) Co., Ltd., Catalog Number: B630005.

[0134] Primers and Probes: Synthesized by Sangon Biotech (Shanghai) Co., Ltd. and reconstituted to 100 μM as the stock solution using enzyme-free water.

[0135] Verification Samples: National Standard Samples S1 - S5 of the Second Generation Human Parvovirus B19 Nucleic Acid Detection Reagent, from the National Institutes for Food and Drug Control, diluted 1:100 with negative plasma; Negative Control: RNA / DNA-free deionized water.

[0136] Instruments: Fluorescent Quantitative PCR Instrument Q5, Nucleic Acid Extraction or Purification Reagent (Shanghai Berger Medical Technology Co., Ltd., Record Number: Shanghai Feng Bei Equipment 20180202).

[0137] 2. Experimental Methods

[0138] Nucleic Acid Extraction of Verification Samples: Use the nucleic acid extraction or purification reagent of Shanghai Berger Medical Technology Co., Ltd. to extract the samples. The loading volume during extraction is 200 μL, and the elution volume is 100 μL; when loading onto the machine, the sample volume is 10 μL for all.

[0139] The amplification system is 25 μL, including: 12.5 μL of 2× Mix solution, 1 μL of UDG enzyme, 10 μL of sample, and 1.5 μL of primer-probe mixture (primer concentration: 500 nM, probe concentration: 250 nM).

[0140] PCR Amplification Conditions: The first stage is 50 °C for 2 min; the second stage is 95 °C for 5 min; the third stage: 95 °C, 15 s; X °C, 30 s; 45 cycles.

[0141] Six experimental groups are set for Tm (X °C), as shown in Table 7 specifically.

[0142] Table 7 Tm (X℃) Experimental Group

[0143]

[0144] Positive cutoff values: For the NS1 channel, Ct≤40 indicates NS1 gene positivity, and Ct>40 or no Ct indicates NS1 gene positivity; for the VP1 channel, Ct≤40 indicates VP1 gene positivity, and Ct>40 or no Ct indicates VP1 gene positivity.

[0145] Interpretation of results: If both NS1 and VP1 are positive, the result is considered positive for B19 virus; if both genes are negative, the result is considered negative for B19 virus; if either NS1 or VP1 is positive, the test should be repeated once. If the result is positive for both genes or positive for one gene, the result is considered positive for B19 virus; if the result is negative for both genes, the result is considered negative for B19 virus.

[0146] 3. Experimental Results

[0147] Results analysis: The national reference products S1-S5 of the second-generation human parvovirus B19 nucleic acid detection reagents were all positive for both NS1 and VP1 genes, and were judged to be positive for B19 virus; all of them in the NC group were negative.

[0148] Comprehensive analysis showed that there was no significant difference in Ct between S1 and S5 of groups 1 to 5. Considering factors such as cost, linearity, and luminescence value, group 3 (Tm=60℃) was selected as the optimal experimental condition.

[0149] See detailed results Figure 3 Tables 8 and 9.

[0150] Table 8 NS1 Validation Results for Samples

[0151]

[0152] Table 9 Validation results of sample VP1

[0153]

[0154] Example 4: Validation of positive concordance rate, limit of detection, and specificity

[0155] 1. Experimental materials

[0156] qPCR premix: TaqProbe 2× qPCR-Multiplex premix, Sangon Biotech (Shanghai) Co., Ltd., catalog number: B630005.

[0157] Primers and probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and were reconstituted with enzyme-free water to 100 μM as the stock solution.

[0158] Verification samples: The national reference product of the second-generation human parvovirus B19 nucleic acid detection reagent, standard products of influenza A virus, influenza B virus, Streptococcus pneumoniae, measles virus, mumps virus, and adenovirus, were from the National Institutes for Food and Drug Control; healthy human plasma was from Beijing Ditan Hospital, Capital Medical University.

[0159] Instruments: Fluorescent quantitative PCR instrument ABI7500, nucleic acid extraction or purification reagent (Shanghai Berger Medical Technology Co., Ltd., filing number: Shanghai Feng Medical Equipment Preparation 20180202).

[0160] 2. Experimental methods

[0161] Nucleic acid extraction of verification samples: Use the nucleic acid extraction or purification reagent of Shanghai Berger Medical Technology Co., Ltd. to extract the samples. The loading volume during extraction is 200 μL, and the elution volume is 100 μL; when loading onto the machine, the sample volume is 10 μL.

[0162] The amplification system is 25 μL, including: 12.5 μL of 2×Mix solution, 1.5 μL of primer-probe mixture (500 nM for each primer, 250 nM for each probe), 1 μL of UDG enzyme, and 10 μL of sample.

[0163] PCR amplification conditions are: the first stage is 50 °C for 2 min; the second stage is 95 °C for 5 min; the third stage is: 95 °C, 15 s; 60 °C, 30 s; 45 cycles.

[0164] Positive judgment value: For the NS1 channel, if Ct ≤ 40, it is judged as positive for the NS1 gene; if Ct > 40 or there is no Ct, it is judged as negative for the NS1 gene; for the VP1 channel, if Ct ≤ 40, it is judged as positive for the VP1 gene; if Ct > 40 or there is no Ct, it is judged as negative for the VP1 gene.

[0165] Result interpretation: If both the NS1 and VP1 genes are positive, it is judged as positive for B19 virus; if both genes are negative, it is judged as negative for B19 virus; if NS1 or VP1 is positive, the extraction and detection are repeated once. If the result is positive for both genes or single-gene positive, it is judged as positive for B19 virus; if the result is negative for both genes, it is judged as negative for B19 virus.

[0166] 3. Experimental results

[0167] Result analysis: For the national reference product of the second-generation human parvovirus B19 nucleic acid detection reagent, P1 - P8 and L1 - L6 are both positive for the NS1 and VP1 genes, and are judged as positive for B19 virus; other samples are both negative for the two genes and are judged as negative for B19 virus. For the detailed results, see Figure 4 and Table 10.

[0168] Table 10 Sample verification results

[0169]

[0170] No Ct indicates that there is no Ct value.

[0171] The above description of the embodiments is only for understanding the method and core ideas of the present invention. It should be noted that those skilled in the art can make various improvements and modifications to the present invention without departing from the principles of the invention, and these improvements and modifications will also fall within the protection scope of the claims of the present invention.

Claims

1. A primer-probe combination for detecting parvovirus B19, characterized in that, The primer-probe combination has at least 90% identity with the nucleic acid sequence shown in any one of SEQ ID NO: 1-6; Preferably, the primer-probe combination is as shown in SEQ ID NO:1-6.

2. The primer-probe combination according to claim 1, characterized in that, The primers are labeled with a marker substance; Preferably, the labeling substance includes a fluorescent substance, a radioactive isotope, or an enzyme; Preferably, the fluorescent material includes TAMRA, Alexa 555, Alexa 647, Cy3 and Cy5 of the cyanine dye series, and fluorescein; Preferably, the radioactive isotope includes 32 P, 33 P, 35 S; Preferably, the enzyme includes alkaline phosphatase and horseradish peroxidase.

3. The primer-probe combination according to claim 1, characterized in that, The probe is connected to a fluorescent group and / or a quenching group; Preferably, the fluorescent group includes FAM, FITC, HEX, VIC, TET, JOE, ROX, CY3, CY5 or CY7; Preferably, the quenching group includes MGB, BHQ1, BHQ2, BHQ3 or DABCYL.

4. A reagent for detecting parvovirus B19, characterized in that, The reagent comprises the primer-probe combination as described in any one of claims 1-3.

5. The reagent according to claim 4, characterized in that, The reagents also include enzymes for PCR; Preferably, the enzymes used for PCR include DNA repair enzymes, DNA polymerases, and RNA polymerases; Preferably, the DNA repair enzyme is selected from UDG enzymes; Preferably, the reagent further includes dNTPs, buffer solution, and Mg. 2+ ; Preferably, the buffer solution includes polymerase buffer and Tris hydrochloric acid buffer.

6. A kit for detecting parvovirus B19, characterized in that, The kit comprises the primer-probe combination according to any one of claims 1-3 or the reagent according to any one of claims 4-5; Preferably, the kit further includes a fluorescent dye; Preferably, the kit also includes instructions.

7. A method for amplifying the sequence of parvovirus B19, characterized in that, The method includes performing an amplification reaction using the primer-probe combination according to any one of claims 1-3, the reagent according to any one of claims 4-5, or the kit according to claim 6; Preferably, the amplification reaction is performed by PCR. Preferably, the PCR is a multiplex PCR; Preferably, the amplification reaction is carried out under similar amplification conditions.

8. A method for detecting parvovirus B19 in a sample, characterized in that, The method includes detection using the primer-probe combination of any one of claims 1-3, the reagent of any one of claims 4-5, the kit of claim 6, or the method of claim 7.

9. The use of the primer-probe combination according to any one of claims 1-3, the reagent according to any one of claims 4-5, or the kit according to claim 6 in the amplification / detection of parvovirus B19.

10. The use of the primer-probe combination according to any one of claims 1-3, the reagent according to any one of claims 4-5, or the kit according to claim 6 in the preparation of products for amplification / detection of parvovirus B19.

Images