Application of protein glutaminase-based preparation of salt-reduced, fresh-increased and fishy smell-removed fish protein gel product

Abstract

The invention provides application of protein glutaminase to preparation of salt-reduced, fresh-increased and fishy-smell-removed fish protein gel products, and belongs to the field of food processing. A large amount of protein glutaminase PG3 derived from Chryseobacterium is prepared through a heterologous expression technology, the protein glutaminase PG3 is used for carrying out enzymatic deamidation modification on spotted silver carp MP, and finally, a spotted silver carp MP solution obtained after deamidation is heated and refrigerated to prepare the salt-free thermally-induced MP gel. In addition, the contents of substances with fishy smell, such as hexanal, nonanal and 1-octylene-3-alcohol, in the salt-free heat-induced MP gel are remarkably reduced, and the delicate flavor perception is improved. The method not only plays an important role in fishy smell removal and freshness enhancement of the fish protein gel, but also provides scientific basis and technical support for healthy and sustainable development of high-quality salt-reduced MP gel products.

Description

Technical Field

[0001] This invention belongs to the field of food processing, specifically relating to the application of a fish protein gel product prepared based on protein glutaminase, which reduces salt content, enhances flavor, and removes fishy odor. Background Technology

[0002] Global fish resources are extremely abundant, and fish protein possesses numerous advantages, including rich essential amino acids, high net protein utilization, and ideal digestibility, thus being considered a high-quality protein that can meet human nutritional needs. Myofibrillar protein (MP), as a major component of muscle, exhibits the ideal viscoelasticity desired by food manufacturers due to its fibrous flexible structure and diverse side-chain reactive groups, making it a key component in the construction of gel particles. Among these, surimi gel products have attracted widespread attention due to their rich nutritional content and ideal texture properties; however, the gelation ability of MP is significantly limited by ionic strength. Salts (such as NaCl and KCl) not only promote MP extraction but are also closely related to the thermal aggregation and gelation ability of proteins during the processing of gel products. When the ionic strength is below 0.3M, the gel strength of MP is relatively weak, resulting in poor flavor and quality of surimi products. However, many chronic diseases, such as hypertension and heart disease, are closely related to high sodium intake. Therefore, developing products that meet the needs of low-salt products without affecting their gelation behavior and gelling properties has become a current research hotspot.

[0003] Essentially, the "salt-soluble effect" of myosin (MP) is based on the fact that, under NaCl conditions of 0.3M to 1.0M, MP filaments bind to NaCl, forming a negatively charged double layer. This electrostatic shielding effect effectively promotes the dissociation of myosin filaments, thereby dissolving the protein. Currently, adding salt substitutes such as dietary fiber, yeast extract, and hydrocolloids can effectively improve protein solubility to maintain the gel properties of low-salt gel products. However, these methods can, to varying degrees, damage the structure of MP in meat products and even mask their original flavor characteristics. Currently, there are few reports on using mild enzymatic deamidation treatment to improve protein solubility under low-salt conditions and to prepare low-salt gel products. Summary of the Invention

[0004] The technical problem this invention aims to solve is to provide a method for preparing fish protein gel products using an enzymatic process. This method, based on protein glutaminase, achieves salt reduction, enhanced umami, and deodorization. Through an enzymatic "clean label" process, low-salt silver carp myofibrillar protein gel products can be produced. These products not only significantly enhance umami flavor but also effectively reduce the content of fishy and other unpleasant odor components. This invention will provide a scientific basis and technical support for the healthy and sustainable development of high-quality, low-salt MP gel products.

[0005] The present invention provides a *Chlorella vulgaris* protein glutaminase PG3, the amino acid sequence of which is shown in SEQ ID No. 1, and the cDNA sequence of which encodes the gene is shown in SEQ ID No. 2.

[0006] A recombinant expression vector containing the gene encoding the PG3 protein glutaminase of *E. coli*, wherein the expression vector is pET-28a(+)-PG3 *E. coli* expression vector, and the nucleotide sequence of the cloning region of the expression vector is shown in SEQ ID No. 2. A recombinant cell line containing the pET-28a(+)-PG3 *E. coli* expression vector, wherein the recombinant cell line is composed of *E. coli*.

[0007] This invention also provides the application of Chlorella protein glutaminase PG3 in the preparation of fish protein gel products with reduced salt content, enhanced flavor, and deodorized fishy smell.

[0008] Preferably, the method for preparing the salt-reduced, flavor-enhancing, and deodorizing silver carp myofibrillar protein gel product includes the following steps:

[0009] (1) Obtain the PG3 gene of the protein glutaminase (prepared by artificial synthesis);

[0010] (2) The protein glutaminase PG3 gene was ligated to the expression vector pET-28a(+) by a one-step cloning method, and the obtained recombinant plasmid pET-28a(+)-PG3 was transformed into Escherichia coli BL21(DE3) to obtain recombinant Escherichia coli;

[0011] (3) The recombinant Escherichia coli obtained in step (2) is cultured to obtain a culture medium; the recombinant Escherichia coli is induced to express protein glutaminase PG3 by adding IPTG at a final concentration of 0.4-0.6 mM. After induction culture, the induction culture medium is collected, and the supernatant is collected by centrifugation after sonication; then trypsin solution is added to the supernatant, and the hydrolysate is obtained by hydrolysis. The hydrolysate is immediately placed on ice for later use.

[0012] Preferably, the culture in step (3) involves inoculating recombinant Escherichia coli at an inoculum of 1% into LB medium containing 50 ng / mL kanamycin resistance, and culturing at 37°C and 200 rpm until the OD600 is 0.6-0.8 to obtain the culture solution; the induction culture conditions are: temperature 20°C, 200 rpm, and time 10-12 h.

[0013] The volume ratio of the trypsin solution to the supernatant was 5:1, the concentration of the trypsin solution was 0.4–0.6 mg / mL, the hydrolysis temperature was 37°C, and the time was 1 h.

[0014] (4) The hydrolysis solution was further purified by affinity chromatography using a NI-NTA column to obtain protein glutaminase PG3 enzyme solution;

[0015] (5) Preparation of precooling solution: Mix NaCl, MgCl2, EDTA and Tris buffer to obtain a precooling solution; wherein the concentration of NaCl is 0.1 mol / L, the concentration of MgCl2 is 2 mol / L, the concentration of EDTA is 1 mol / L, and the concentration of Tris buffer is 20 mol / L; the temperature of the precooling solution is 0 to 4℃.

[0016] Fresh silver carp back muscle was chopped and minced, and then homogenized with 4 times the volume of pre-cooled solution. The temperature of the pre-cooled NaCl solution was 0-4℃, and the volume ratio of crude myofibrillar protein extract to pre-cooled NaCl solution was 1:4. The precipitate was then collected by centrifugation. The precipitate was used as a sample, and the above operation was repeated 3 times to obtain crude myofibrillar protein extract.

[0017] (6) The crude myofibrillar protein extract was mixed with pre-cooled NaCl solution and washed. After centrifugation, the precipitate obtained was pure myofibrillar protein, which was resuspended in Tris buffer to obtain silver carp myofibrillar protein solution. The pre-cooled NaCl solution was at a temperature of 0-4°C and a concentration of 0.1M. The Tris buffer had a concentration of 20mM and a pH of 7.0.

[0018] (7) The protein glutaminase PG3 enzyme solution is mixed with the silver carp myofibrillar protein solution and subjected to protein deamidation reaction under water bath conditions to obtain the deamidated silver carp myofibrillar protein solution.

[0019] Preferably, the silver carp myofibrillar protein concentration is 9-11 mg / mL, and the mass ratio of the protein glutaminase PG3 enzyme solution to the silver carp myofibrillar protein solution is 1:190-1:210.

[0020] Preferably, the water bath reaction is carried out at 29–31°C and 150–170 rpm for 8–10 hours with shaking.

[0021] (8) The deamided silver carp myofibrillar protein solution is heated and refrigerated to prepare a heat-induced gel, thus obtaining the fish protein gel product.

[0022] Preferably, the heating and refrigeration conditions are heating at 90°C for 20 minutes and maintaining at 4°C for 3 hours, respectively.

[0023] The thermally induced gel was subjected to electronic tongue flavor analysis to investigate changes in umami perception. The electronic tongue flavor analysis procedure was as follows: 5g of myofibrillar protein gel sample was taken, 80mL of deionized water was added, homogenized at 6000rpm for 2min and allowed to stand for 2h, then centrifuged at 10000rpm for 10min at 4℃, the supernatant was collected, and then diluted to 100mL with deionized water to obtain the gel sample solution.

[0024] Furthermore, the taste characteristics of the gel sample solution were analyzed using the TS-5000Z taste sensor system.

[0025] The beneficial effects of this invention are as follows:

[0026] This invention utilizes bioengineering technology to prepare large quantities of *Chlorella vulgaris*-derived glutaminase PG3 using an *E. coli* expression system. The PG3 protein was then used to enzymatically deamidate silver carp myofibrillar protein. Finally, the deamidated silver carp myofibrillar protein solution was subjected to heating and refrigeration treatments to successfully prepare a salt-free heat-induced myofibrillar protein gel. Furthermore, the salt-free heat-induced myofibrillar protein gel exhibits a significant reduction in the content of fishy-smelling substances and an increase in umami flavor. This invention not only plays a crucial role in deodorizing and enhancing the umami flavor of fish protein gels but also provides scientific basis and technical support for the healthy and sustainable development of high-quality, low-salt myofibrillar protein gel products.

[0027] Attached image caption

[0028] Figure 1 This represents the change in the content of volatile flavor compounds that cause off-odors.

[0029] Figure 2 This is a salt-free silver carp myofibrillar protein gel prepared after deamide treatment.

[0030] Figure 3 Changes in umami perception of salt-free silver carp myofibrillar protein gel prepared after deamide treatment. Detailed Implementation

[0031] The present invention will be further described in detail below with reference to specific accompanying drawings and embodiments. These descriptions are for illustrative purposes only and are not intended to limit the scope of the invention. Any operational steps or conditions not described in detail in the following embodiments are implemented according to conventional techniques and conditions in the art.

[0032] Example 1: Construction of an engineered Escherichia coli strain expressing the protein glutaminase PG3

[0033] The amino acid sequence of the protein glutaminase PG3 is shown in SEQ ID No. 1, and the cDNA sequence of the encoding gene is shown in SEQ ID No. 2.

[0034] The artificially synthesized protein glutaminase PG3 gene was ligated to the Nco I and Xho I restriction sites on the pET-28a vector using a one-step cloning method to obtain the recombinant plasmid pET-28a(+)-PG3. The recombinant plasmid was transformed into E. coli BL21(DE3) competent cells using the conventional heat shock transformation method and plated onto Luria-Bertani (LB) solid medium containing 50 ng / mL kanamycin resistance. The cells were incubated overnight in an inverted incubator at 37°C. Single colonies were picked from the plates and colony PCR was performed. The products were verified by 1% agarose gel electrophoresis. The results are shown below. Figure 1 As shown. The successfully transformed colonies were cultured and stored at -20℃ for later use.

[0035] Example 2: Heterologous expression and purification of protein glutaminase PG3

[0036] (1) Preparation of crude enzyme solution

[0037] The recombinant strain, stored at -20℃, was retrieved and activated. It was then inoculated at a 1% inoculum into LB medium containing 50 ng / mL kanamycin resistance and cultured at 37℃ and 200 rpm until OD500. 600 The concentration was 0.6. After adding IPTG to a final concentration of 0.5 mM, the culture was induced overnight at 20°C and 200 rpm. The induced bacterial culture was centrifuged at 6000 rpm and 4°C to remove the supernatant. The bacterial sludge was resuspended in an appropriate amount of Tris-HCl buffer (50 mM, pH 7.2). The suspension was ultrasonically disrupted at 40 kW for 15 min (2.5 s working time, 3 s interval), and then centrifuged at 4°C and 10000 rpm for 20 min to collect the supernatant, which was then placed on ice for later use.

[0038] (2) PG activation and purification

[0039] At a ratio of 5:1 (v / v), 0.5 mg / mL trypsin solution was added to the crude enzyme solution. After hydrolysis at 37°C, the solution was immediately placed on ice. The recombinant protein was purified using NI column affinity chromatography. The crude enzyme solution was added to an NI column, followed by 5 column volumes of wash buffer (50 mM Tris-HCl, 20 mM imidazole, pH 7.2) for impurity removal. Then, 2 column volumes of elution buffer (50 mM Tris-HCl, 150 mM imidazole, pH 7.2) were added to elute and collect the target protein, yielding the protein glutaminase PG3 enzyme solution. The purity of the purified PG was verified by SDS-PAGE electrophoresis on a 5% stacking gel and a 12% separating gel.

[0040] (3) Protein concentration and quantification

[0041] The purified PG enzyme solution was loaded into an ultrafiltration tube (US, Millipore) with a molecular cutoff of 10 kDa and centrifuged at 4°C and 5000 rpm for 25 min. The solution remaining in the centrifuge tube was collected and replaced with 50 mM Tris-HCl buffer at pH 7.2. After repeating the ultrafiltration concentration three times, the protein concentration was quantified using a BCA kit.

[0042] Example 3: Extraction and preparation of silver carp myofibrillar protein

[0043] Preparation of pre-cooled solution A: Mix NaCl, MgCl2, EDTA, and Tris buffer to obtain a pre-cooled solution; wherein the concentration of NaCl is 0.1 mol / L, the concentration of MgCl2 is 2 mol / L, the concentration of EDTA is 1 mol / L, and the concentration of Tris buffer is 20 mol / L; the temperature of the pre-cooled solution is 4℃.

[0044] Fresh silver carp dorsal muscle was collected, skin and red meat removed, and chopped using a chopper. 10.0g of fish meat sample was accurately weighed (the remainder was stored at -20℃), chopped, and its volume measured. The sample was then placed in a clean beaker. Pre-cooled solution A, four times the volume of the fish meat, was added to the beaker, and homogenized at 10,000 rpm for 3 min (homogenization for 30 s, followed by a 30 s interval). The mixture was then centrifuged at 8,000 rpm for 15 min, the supernatant was discarded, and the precipitate was collected. This precipitate was used as the sample, and the above steps were repeated three times. The precipitate was then washed with four times its volume of 0.1M NaCl solution, followed by centrifugation at 8,000 rpm. Finally, the precipitate was washed with eight times its volume of 0.1M NaCl solution, filtered through three layers of gauze, and then centrifuged at 8,000 rpm to collect the precipitate, yielding silver carp myofibrillar protein. The entire extraction process was carried out at 4°C. The extracted myofibrillar protein was protected with nitrogen and stored at 4°C (for use within three days). When ready for use, it was resuspended in 20 mM Tris buffer (pH 7.0) to obtain a silver carp myofibrillar protein solution.

[0045] Example 4: Enzymatic deamide modification and volatile flavor compound analysis of silver carp myofibrillar protein

[0046] The concentration of silver carp myofibrillar protein was adjusted to 10 mg / mL, and protein glutaminase PG3 enzyme solution was added to the myofibrillar protein solution at a mass ratio of 1:200 (enzyme:protein = 1:200). A water bath reaction was then performed. The water bath reaction was conducted at 30°C and 160 rpm with shaking for 9 hours. After the reaction, a deamidated silver carp myofibrillar protein solution was obtained.

[0047] 2g of accurately weighed deamidated silver carp myofibrillar protein solution was placed in a 20mL headspace vial along with 5mL of saturated sodium chloride solution. 5μL (100μg / mL) of 1,2-dichlorobenzene was added as an internal standard. The vial was then incubated in a 60℃ water bath for 20min. Solid-phase microextraction (SPME) fiber (50 / 30μm DVB / CARBOXEN-PD, DIKMA Technologies Inc., Beijing, China) was aged at 250℃ for 5min, followed by adsorption at 60℃ in the headspace of the vial for 30min, and then desorption at 250℃ at the gas chromatograph injection port for 5min. The specific analytical procedure was as follows: the initial oven temperature was set to 40℃ for 5min, then increased to 100℃ at a rate of 3℃ / min, then increased to 160℃ at a rate of 10℃ / min and held for 2min, and finally increased to 250℃ at a rate of 10℃ / min and held for 5min. The mass spectrometry parameters were as follows: electron impact voltage 70 eV, ion source temperature 230 °C, quadrupole temperature 150 °C, and MS scan range 30-550 amu. Based on mass spectrometry similarity matching and retention indices, VOCs in myofibrillar / deamide-treated myofibrillar protein samples were identified using reference standards from the NIST 14.0 spectral database. The relative content of each VOC was determined by calculating the relative peak area, using the following formula:

[0048] C i =A i ×C0×V0 / A0×M1

[0049] In the formula C i Represents the relative concentration (μg / mg) of each volatile compound; C0 is the concentration of IS, mg / mL; A i A0 and M1 are the peak areas of VOCs and IS, respectively; M1 is the mass of the sample; V0 is the volume of IS.

[0050] GC-MS quantitative analysis results are as follows Figure 1 As shown, compared with the untreated group, the overall VOC concentration in the deamidated myofibrillar protein group was significantly reduced, especially for aldehydes, alcohols, and other compounds. The content of odor-causing substances such as hexanal, nonanal, and 1-octen-3-ol was significantly reduced.

[0051] Example 5: Preparation of thermo-induced gel of silver carp myofibrillar protein and flavor perception analysis

[0052] (1) Adjust the silver carp myofibrillar protein to 10 mg / mL, and add protein glutaminase PG3 enzyme solution to the silver carp myofibrillar protein solution at a mass ratio (enzyme: protein = 1:200) and carry out a water bath reaction. The water bath reaction is carried out at 30°C and 160 rpm for 9 hours with shaking. After the reaction, the deamidated silver carp myofibrillar protein solution is obtained.

[0053] (2) The deamidated silver carp myofibrillar protein solution obtained in step (1) was heated in a water bath at 90°C for 20 min, and then refrigerated at 4°C for 3 h to obtain a heat-induced gel sample, denoted as WT3.

[0054] The CK group refers to the sample that was not treated with enzyme solution (protein glutaminase PG3 enzyme solution), and the remaining steps are the same as steps (1)-(2).

[0055] The results are as follows Figure 2 As shown, compared to the control group, the WT3 group treated with enzyme solution obtained stable gel samples.

[0056] Subsequently, 5g of WT3 and CK samples were taken respectively, and 80mL of deionized water was added to each sample. The mixtures were homogenized at 6000rpm for 2min and allowed to stand for 2h. Then, they were centrifuged at 10000rpm for 10min at 4℃, and the supernatant was collected. The volume was then adjusted to 100mL with deionized water. Reference, Negative, and Objective solutions were then added sequentially for correction. The data acquisition and detection times for each sample were set to 120s and 30s, respectively. Washing was performed in 10s cycles, and four repeated detections were conducted. The data from the first acquisition was automatically deleted, and the data from the last three experiments were used for analysis. The results are as follows: Figure 3 As shown, compared with the control group, the umami flavor of the deamided myofibrillar protein gel (WT3) was significantly enhanced.

[0057] Note: The above embodiments are only used to illustrate the present invention and are not intended to limit the technical solutions described in the present invention. Therefore, although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the present invention. All technical solutions and improvements that do not depart from the spirit and scope of the present invention should be covered within the scope of the claims of the present invention.

[0058] Sequence List:

[0059] The amino acid sequence of glutaminase PG3 from Chryseobacterium sp.

[0060] SEQ ID NO.1

[0061] CSDAGANQDQGLNTTESGEIAMKDFGRTVPVGIDEENGTFKVSFIISAQPYTIKASKENEKYISMIRQAVKDESPVHVFLKPNSNEIAKVEKGTDEDIRFFRSALTKEERSDNTARRLATVIPDVATLNSLFAQIKSQSCGTSTASSPCITFRYPVDGCYARAHKMRQILNNAGYECEKQFVYGSLRASTGTCCVSWVYHVAILVSFKNASGIVEKRIIDPSLNSTGPITDTAWRSACTNSTCGSTSVSSYANTAGNVYYRSPSGSLLYDNNYVNTNCVLTTFSSLSGCSPSPAPSVGHCGF

[0062] Protein glutaminase PG3 gene sequence of Chryseobacterium sp

[0063] SEQ ID NO.2

[0064] TGCTCGGATGCAGGTGCTAACCAGGATCAGGGACTGAATACAACAGAGTCCGGCGAAATTGCGATGAAAGACTTCGGCAGAACTGTCCCGGTAGGGATAGATGAAGAGAATGGTACTTTTAAAGTTTCATTTATTATCAGTGCTCAACCTTATACAATAAAAGCAAGTAAGGAAAATGAGAAGTACATTTCAATGATCAGACAGGCTGTAAAGGATGAATCACCGGTTCATGTTTTTCTTAAGCCCAATTCCAATGAGATTGCAAAGGTAGAAAAAGGTACGGATGAAGATATCCGTTTTTTCAGATCTGCTCTAACGAAAGAAGAAAGAAGTGATAATACAGCCAGAAGATTGGCTACTGTTATCCCTGATGTGGCTACTTTAAACAGCTTATTTGCTCAGATCAAAAGCCAGTCTTGCGGGACTTCCACTGCTTCTTCTCCCTGCATCACTTTCAGATATCCTGTAGACG GATGCTATGCAAGAGCTCACAAAATGAGACAAATTCTGAACAATGCAGGATATGAATGTGAAAAGCAATTTGTATATGGTAGCCTGAGAGCGTCTACCGGTACATGCTGTGTATCATGGGTATACCATGTGGCTATCCTTGTAAGCTTTAAAAATGCTTCCGGAATTGTTGAAAAGAGAATCATAGATCCTTCATTAAATTCAACCGGGCCTATTACTGATACGGCATGGAGAAGCGCTTGTACCAATTCCACCTGCGGATCTACTTCTGTTTCTTCTTATGCCAATACTGCAGGAAATGTTTACTACAGAAGCCCTAGCGGTTCTTTATTGTATGATAACAACTATGTAAATACCAATTGTGTATTGACTACGTTCTCGTCTCTTTCCGGATGCTCTCCATCACCTGCACCGAGTGTAGGACACTGCGGATTC

Claims

1. A protein glutaminase PG3, characterized in that, The amino acid sequence of the protein glutaminase PG3 is shown as SEQ ID No. 1, and the cDNA sequence of the encoding gene is shown as SEQ ID No.

2.

2. Use of the protein glutaminase PG3 according to claim 1 in the preparation of a salt-reduced, fresh-tasting and deodorized fish protein gel product.

3. Use according to claim 2, characterized in that, The steps are as follows: (1) The protein glutaminase PG3 encoding gene is connected to the expression vector pET-28a(+) by a one-step cloning method, and the obtained recombinant plasmid pET-28a(+)-PG3 is transformed into Escherichia coli BL21(DE3) to obtain a recombinant Escherichia coli; (2) The recombinant Escherichia coli obtained in step (1) is cultured to obtain a culture solution; the expression of the protein glutaminase PG3 is induced by adding IPTG with a final concentration of 0.4-0.6 mM; after the induction culture, the induction culture solution is collected, ultrasonically broken, and then centrifuged to collect the supernatant; then trypsin solution is added to the supernatant, hydrolyzed, and then immediately ice-bathed to obtain a hydrolysis solution for standby; (3) The hydrolysis solution is further purified by affinity chromatography NI-NTA column to obtain a protein glutaminase PG3 enzyme solution; (4) Prepare a pre-cooled solution: mix NaCl, MgCl2, EDTA and Tris buffer to obtain a pre-cooled solution; the concentration of NaCl is 0.1 mol / L, the concentration of MgCl2 is 2 mol / L, the concentration of EDTA is 1 mol / L, and the concentration of Tris buffer is 20 mol / L; the temperature of the pre-cooled solution is 0-4℃; Fresh silver carp dorsal muscle is chopped and cut into pieces to obtain fish samples; then the pre-cooled solution is added to the fish samples for homogenization, and the precipitate is collected by centrifugation; then the precipitate is used as a sample, and the pre-cooled solution is added repeatedly for several times to obtain a crude myofibrillar protein extract; (5) The crude myofibrillar protein extract is mixed with a pre-cooled NaCl solution for washing, and the obtained precipitate after centrifugation is pure myofibrillar protein, which is resuspended in Tris buffer to obtain a silver carp myofibrillar protein solution; (6) The protein glutaminase PG3 enzyme solution is mixed with the silver carp myofibrillar protein solution, and a protein deamidation reaction is carried out under water bath conditions to obtain a deamidated silver carp myofibrillar protein solution; (7) The deamidated silver carp myofibrillar protein solution is subjected to heating and cold storage treatment to prepare a heat-induced gel, which is a fish protein gel product.

4. Use according to claim 3, characterized in that, In step (2), the recombinant Escherichia coli is inoculated into LB culture medium containing 50 ng / mL kanamycin resistance at an inoculation amount of 1%, and cultured at 37℃ and 200 rpm until OD600 is 0.6-0.8 to obtain a culture solution; the induction culture conditions are as follows: temperature is 20℃, 200 rpm, and time is 10-12 h.

5. Use according to claim 3, characterized in that, In step (4), the volume ratio of the trypsin solution to the supernatant is 5:1, the concentration of the trypsin solution is 0.4-0.6 mg / mL, the hydrolysis temperature is 37℃, and the hydrolysis time is 1 h.

6. Use according to claim 3, characterized in that, The volume ratio of the fish sample to the pre-cooled solution in step (4) is 1:4; the number of repeated operations is 2-3 times.

7. Use according to claim 3, characterized in that, The temperature of the pre-cooled NaCl solution in step (5) is 0-4℃, and the concentration is 0.1M; the concentration of the Tris buffer is 20mM, and the pH is 7.

0.

8. Use according to claim 3, characterized in that, The concentration of the grass carp myofibrillar protein solution in step (6) is 9-11mg / mL; the mass ratio of the protein glutamine enzyme PG3 enzyme solution to the grass carp myofibrillar protein solution is 1:190-1:

210.

9. Use according to claim 3, characterized in that, The water bath reaction conditions in step (6) are 29-31℃, and the rotation speed is 150-170rpm, and the reaction is oscillated for 8-10h.

10. Use according to claim 3, characterized in that, The heating and refrigeration treatment conditions in step (7) are 90℃ water bath for heating for 20min and 4℃ for 3h, respectively.

Images