Application of triticale extract in skin care product
By extracting peptides from black wheat through enzymatic hydrolysis, skincare products with highly effective antioxidant, whitening, and anti-inflammatory effects were prepared. This solved the problem of insufficient application of black wheat in the skincare field, and realized the efficient utilization of black wheat resources and the enhancement of skincare product efficacy.
Patent Information
- Application Number
- CN202511556240.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-29
- Publication Date
- 2026-01-02
AI Technical Summary
In the current technology, there is limited research on the application of black wheat in the field of skin care products. There is a lack of skin care products with effective antioxidant, whitening, barrier repair and anti-inflammatory effects, which limits the utilization of black wheat resources.
Using black wheat as raw material, black wheat oligopeptides are extracted through enzymatic hydrolysis. The extract is prepared by enzymatic hydrolysis using proteases such as papain, bromelain, neutral protease or trypsin, and then applied to skin care products. The specific method includes steps such as dough preparation, enzymatic hydrolysis, centrifugation and ultrafiltration.
It enhances the peptide content and antioxidant, melanin-inhibiting, barrier-repairing, and anti-inflammatory effects of black wheat extract, significantly outperforming ordinary wheat extract. When applied to skincare products, it significantly improves the skin's antioxidant, whitening, barrier-repairing, and anti-inflammatory effects.
Smart Images

Figure CN121243029A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of skin care products, in particular to the application of a black wheat extract in skin care products. BACKGROUND
[0002] Black wheat is rich in protein, amino acids, fat, unsaturated fatty acids, vitamins, minerals and various trace elements, and has very high nutritional value. It also contains polyphenols with high antioxidant activity and no toxic effects, which can be used as a natural antioxidant to replace artificial antioxidants in food.
[0003] The wheat extract prepared by biological enzyme hydrolysis, centrifugation, ultrafiltration, concentration and spray drying processes using wheat gluten as raw material is rich in wheat oligopeptides, which are essentially a mixture of small molecule peptides. Glutamic acid is the most abundant amino acid in the mixture, mostly in the form of glutamine. Glutamine is the most abundant amino acid in the human body and plays an important physiological function, such as antioxidant and intestinal barrier function.
[0004] Currently, research on black wheat is mainly focused on food and health products, and there are few reports on the application of black wheat in the field of skin care products. Therefore, the present application provides the application of a black wheat extract in skin care products, which provides a new direction and theoretical basis for the resource utilization of black wheat. SUMMARY
[0005] The present application provides the application of a black wheat extract in skin care products to solve the above problems.
[0006] The present application achieves the above-mentioned purposes through the following technical solutions: The present application provides the application of a black wheat extract in the preparation of skin care products with antioxidant, whitening, barrier repair and anti-inflammatory effects.
[0007] As a further optimization scheme of the present application, the preparation method of the black wheat extract is as follows: black wheat is used as raw material to prepare dough and washed into gluten, then super pure water is added to the gluten to obtain a mixture, the mixture is subjected to enzymatic treatment to obtain an enzymatic product, and the enzymatic product is subjected to centrifugation and ultrafiltration treatment to obtain a filtrate.
[0008] As a further optimization scheme of the present application, the dough is washed with a 2% sodium chloride solution.
[0009] As a further optimization scheme of the present application, the concentration of the mixture is 0.1 g / ml.
[0010] As a further optimization scheme of the present application, the method of enzymatic treatment is as follows: protease is added to the mixture to obtain a reaction mixture with an enzyme concentration of 500 U / ml, and then heated for enzymolysis.
[0011] As a further optimization scheme of the present application, the protease is any one of papain, bromelain and neutral protease, and the enzymolysis condition is that the pH is 7, the temperature is 55 DEG C, and the enzymolysis time is 2.5 h.
[0012] As a further optimization scheme of the present application, the protease is trypsin, and the enzymolysis condition is that the pH is 8, the temperature is 37 DEG C, and the enzymolysis time is 2.5 h.
[0013] As a further optimization scheme of the present application, the skin care product is an essence, and the essence contains 5% of the black wheat extract, 2% of the nicotinamide and 1% of the hyaluronic acid in percentage by mass.
[0014] As a further optimization scheme of the present application, the skin care product is a mask, and the mask contains 2% of the black wheat extract, 0.5% of the dipotassium glycyrrhizate and 15% of the glycerol in percentage by mass.
[0015] The present application has the following beneficial effects: (1) The present application uses black wheat as raw material, and obtains the black wheat extract rich in black wheat oligopeptide through enzymolysis treatment, and the polypeptide content in the obtained black wheat extract is higher than that in ordinary wheat extract. Through the detection of the antioxidant effect, the melanin inhibition effect, the barrier repair effect and the anti-inflammatory effect of the obtained black wheat extract, it is verified that the black wheat extract is superior to ordinary wheat extract in skin antioxidant, melanin inhibition, barrier repair and anti-inflammatory effects.
[0016] (2) In the process of preparing the black wheat extract with black wheat as raw material, the use of protease for enzymolysis treatment can effectively improve the various effects of the prepared black wheat extract, among which, the neutral protease has the most significant effect on the improvement of polypeptide content and antioxidant effect, and the trypsin has the most significant effect on the improvement of melanin inhibition effect and barrier repair effect. BRIEF DESCRIPTION OF DRAWINGS
[0017] Figure 1 Toxicity detection results of different wheat extracts on HaCaT cells; Figure 2 Influence effect detection results of different wheat extracts on the expression level of keratinocyte barrier factors; Figure 3 Effect detection results of different wheat extracts on the inhibition of NO secretion by RAW264.7 cells; Figure 4 ITA, elasticity, trans-epidermal water loss and redness improvement rates of the skin of the subjects; Figure 5 The left face image collection and analysis diagram of the T group subjects.
[0018] (Note: Figure 4 , 5 In which, W0 refers to before use, W2 refers to after 2 weeks of use, and W4 refers to after 4 weeks of use. DETAILED DESCRIPTION
[0019] It is necessary to point out here that the following detailed description is only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application according to the above application content.
[0020] I. Experimental materials The method used in the present application is a conventional method known to those skilled in the art unless otherwise specified. The reagents and other materials used are commercially available products unless otherwise specified.
[0021] II. Experimental method 1. Preparation of black wheat extract and common wheat extract The black wheat is crushed into fine powder, and 50g of black wheat is precisely weighed and added with 30ml of ultrapure water to knead into a smooth dough. After sealing the bag, it is placed at room temperature for 20 minutes. Then the dough is washed with 2% sodium chloride solution to obtain gluten. The gluten is precisely weighed and divided into 6 parts, denoted as groups A-F. Ultrpure water is added to the gluten in groups A-F to obtain a mixture with a concentration of 0.1g / ml; Protease is added to the mixture in groups A-D to obtain a reaction with an enzyme concentration of 500U / ml, and then heated enzyme hydrolysis is carried out for 2.5h to obtain the enzyme hydrolysis product. The enzyme hydrolysis product is treated by centrifugation and ultrafiltration to obtain the filtrate; The mixtures in groups E and F are placed in a specific temperature condition for 2.5h of standing reaction to obtain the reaction product. The reaction product is treated by centrifugation and ultrafiltration to obtain the filtrate; Based on the preparation conditions of groups A-D, the raw materials therein are replaced with common wheat, and one-to-one corresponding control groups a-f are set. The settings of each group are shown in Table 1.
[0022] Table 1. Reaction condition settings of each group ; Note: "-" means not added 2. Efficacy detection To further study the efficacy of black wheat extract, the prepared black wheat extract and common wheat extract are taken as the measured objects, and the polypeptide content, antioxidant efficacy, melanin inhibition efficacy, barrier repair efficacy and anti-inflammatory efficacy are detected.
[0023] 2.1. Polypeptide content detection The protein polypeptide concentration in the triticale extract of group A-F and the common wheat extract of group a-f was quantitatively detected using a BCA kit (brand: Thermo, item number: 23227), a standard curve of the protein polypeptide concentration of the standard sample was drawn, and the protein polypeptide concentration of the measured substance was calculated; The results are shown in Table 2. As can be seen from Table 2: (1) Under the same preparation method, the polypeptide content in the triticale extract is higher than that in the common wheat extract; (2) In the process of preparing the triticale extract, the use of protease for enzymatic treatment can effectively improve the polypeptide content in the triticale extract obtained, and the effect of neutral protease is the most significant.
[0024] Table 2 Polypeptide content detection results of each group ; 2.2, antioxidant performance detection 2.2.1, DPPH free radical scavenging rate determination DPPH ethanol solution is purple red, and has a maximum absorption wavelength at 519 nm. When a free radical scavenger is added, DPPH free radicals are scavenged, the solution gradually becomes lighter, and the absorbance at 519 nm decreases accordingly. The lighter the solution color, the lower the absorbance value, and the better the effect of the free radical scavenger on scavenging DPPH free radicals.
[0025] The specific method is: using sample solvent to dilute the measured substance into sample solutions of multiple concentrations; using a 96-well plate, setting up experimental holes (T), experimental control holes (T0), DPPH model holes (C) and model control holes (C0), and for each test concentration of each sample, 3 parallel holes are set up for the experimental holes (T), and 3 parallel holes are also set up for the DPPH model holes (C); In the experimental holes (T) and the experimental control holes (T0), 100 μl of sample solution was added, and in the DPPH model holes (C) and the model control holes (C0), 100 μl of ultrapure water was added, respectively. In the experimental holes (T) and the DPPH model holes (C), 100 μl of DPPH working solution (0.5 mmol / L) was added, and in the experimental control holes (T0) and the model control holes (C0), 100 μl of anhydrous ethanol was added instead; After the 96-well plate was placed at room temperature for 30 min in the dark, the absorbance was measured at 519 nm, and the DPPH free radical scavenging rate of each group of measured sample was calculated according to the absorbance value, and the formula is as follows: ; In the formula: Amod-DPPH model hole absorbance; Amod-DPPH model control hole absorbance; A sample-experimental hole absorbance; A sample-experimental control hole absorbance.
[0026] 2.2.2, ABTS radical scavenging rate determination ABTS reacts with potassium persulfate to generate green ABTS+. Substances with antioxidant properties can scavenge ABTS+. ABTS+ has a maximum absorption at 734 nm, and the absorbance is determined, and the magnitude of the absorbance value can quantitatively determine the radical scavenging capacity of the reactant. That is, the lower the absorbance value, the stronger the ability of the substance with antioxidant properties to scavenge ABTS radicals.
[0027] The specific method is: dilute the measured substance with a sample solvent to obtain sample solutions of multiple concentrations; use a 96-well plate to set up experimental wells (T), experimental control wells (T0), ABTS model wells (C), and model control wells (C0). For each test concentration of each sample, 3 parallel wells of experimental wells (T) are set up, and 3 parallel wells of ABTS model wells (C) are also set up. In experimental wells (T) and experimental control wells (T0), 50 μl of sample solution of the same concentration is added, and 50 μl of ultrapure water is added to ABTS model wells (C) and model control wells (C0), respectively; 150 μl of ABTS working solution (7.4 mmol / L ABTS solution and 2.6 mmol / L K2S2O8 solution mixed at a ratio of 1:1, placed for 12 h, and then diluted 20 times) is added to experimental wells (T) and ABTS model wells (C), and 150 μl of ultrapure water is added to experimental control wells (T0) and model control wells (C0) instead; after 6 min at room temperature, the absorbance is measured at 734 nm, and finally the ABTS radical scavenging rate of the measured substance at different concentrations is calculated according to the absorbance value, and the formula is as follows: ; In the formula: Amod-ABTS model well absorbance; Amod-ABTS model control well absorbance; A sample- experimental well absorbance; A sample- experimental control well absorbance.
[0028] 2.2.3, detection results The detection results are shown in Table 3, and it can be seen from Table 3 that: (1) When the preparation method is the same, the antioxidant effect of the obtained triticale extract is better than that of the ordinary wheat extract; (2) In the preparation of triticale extract, enzymatic treatment with protease can effectively improve the antioxidant performance of triticale extract, and the effect of neutral protease is the most significant.
[0029] Table 3: Antioxidant efficacy detection results of each group ; Note: In the table, "-" indicates that the clearance rate corresponding to 100% concentration of the measured substance is still less than 50% 2.3, efficacy detection of inhibiting intracellular melanin 2.3.1, cytotoxicity test Take 96-well plates, and add 100 μl of B16-F10 cell suspension to each well to make the cell density 5000 cells / well, and then place them in a culture box containing 5% CO2for 24 h. Dilute the test substance to 20% (V / V) with DMEM containing 10% FBS, filter it with a 0.22 μm filter membrane to remove bacteria, and then continue to dilute it to 10%, 5%, 2.5%, 1.3%, 0.6%, 0.3%, 0.2%, 0.1%, and 0. Take out the cells cultured for 24 h, discard the culture supernatant, and add different concentrations of the test substance to each well, 3 replicates for each concentration, and continue to place them in a culture box containing 5% CO2for 24 h; Take out the cell culture plate, discard the supernatant, add 100 μl of DMEM culture solution and 10 μl of CCK8 solution to each well, and place it in a culture box containing 5% CO2for 2-4 h. Then detect the absorbance at 450 nm with a microplate reader, and calculate the cell proliferation rate according to the following formula: Cell proliferation rate = OD 实验组 / OD 细胞对照组 × 100%; Among them, different concentrations of the test substance are added in the experimental group, and no test substance is added in the control group.
[0030] The test results show that when the concentration is lower than 20% (V / V), various test substances have no toxic effect on B16 cells.
[0031] 2.3.2, detection of B16 cell melanin expression inhibition level Set up a blank control group (Negative control, NC), a model control group (Model control, MC), a positive control group (Positive control, PC), and a test substance group (T), with 3 parallel groups in each group, and set up as follows: Blank control group (NC): only containing cell culture solution; Model control group (MC): containing 500 nmol / L α-MSH cell culture solution; Positive control group (PC): containing 500 nmol / L α-MSH and 0.01% β-arbutin cell culture solution; Test substance group (T): containing 500 nmol / L α-MSH and different concentrations of test substance (2.5%, 5%, and 10% test substance).
[0032] Test process: take 6-hole plates, add B16-F10 cell suspension (purchased from ATCC, model number CRL-6475) 2mL to each hole to make the cell density 4×104 cells / hole, and then place it in a culture box containing 5% CO2 for 24h of culture. Discard the supernatant, and add different groups of samples 2mL to each hole, and place it in a culture box containing 5% CO2 for continued culture for 72h. Discard the culture supernatant, wash each hole with 1mL of PBS buffer for 2 times. Discard the PBS, add trypsin solution 200µL to each hole to digest for 2min-4min, add 1mL of PBS to each hole to blow the cells, and aspirate the cell suspension into a 1.5mL EP tube, and centrifuge at 300g for 5min. Discard the supernatant, add 150µL of melanin extraction solution to each tube, and place it in a water bath (90℃±5℃) for water bath for 1h until the melanin is completely dissolved. Mix the above solution by blowing, and aspirate 100µL from each tube into the corresponding holes of a 96-hole plate, take the melanin extraction solution as the zero control, detect the OD value at 405nm by an enzyme-labeled instrument, and calculate the melanin inhibition rate, the formula is as follows: ; In the formula, OD MC is the actual measured absorbance value of the model control group, i.e. the absorbance value of the model control group minus the absorbance value of the zero control; OD T / PC is the actual measured absorbance value of the measured group or the positive control group, i.e. the absorbance value of the measured group or the positive control group minus the absorbance value of the zero control.
[0033] The detection results are shown in Table 4: (1) When the same preparation method is used, the effect of the prepared triticale extract on inhibiting melanin is better than that of the ordinary wheat extract; (2) In the process of preparing the triticale extract, enzymatic treatment with protease can effectively improve the effect of the prepared triticale extract on inhibiting melanin production, and the effect of trypsin is the most significant.
[0034] Table 4: Detection results of B16 cell melanin inhibition level of each group ; 2.4, barrier repair efficacy detection 2.4.1, cytotoxicity test Take a 96-well plate and add 100 μl of HaCaT cell suspension to each well to achieve a cell density of 10,000 cells / well. Then, incubate the plate in a 5% CO2 incubator for 24 h. Dilute the test sample to 20% (V / V) with DMEM containing 10% FBS, filter through a 0.22 μm filter membrane for sterilization, and then continue to dilute to concentrations of 10%, 5%, 2.5%, 1.3%, 0.6%, 0.3%, 0.2%, 0.1%, and 0. After 24 h of cell culture, remove the cells, discard the culture supernatant, add different concentrations of the test sample to each well (3 replicates per concentration), and continue to incubate the plate in a 5% CO2 incubator for another 24 h. Remove the cell culture plate, discard the supernatant, add 100 μl of DMEM culture medium and 10 μl of CCK8 solution to each well, and incubate in a 5% CO2 incubator for 2-4 hours. Measure the absorbance at 450 nm using a microplate reader. Calculate the cell proliferation rate using the following formula: Cell proliferation rate = OD experimental group / OD cell control group × 100%; In the experimental group, different concentrations of the analyte were added, while no analyte was added to the control group.
[0035] The results are as follows Figure 1 As shown: When the concentration is below 20% (V / V), the analyte has no toxic effect on skin keratinocytes. 2.4.2 Detection of barrier factors and differentiation factors (1) Cell resuscitation and culture The frozen keratinocytes HaCaT cells were removed from liquid nitrogen, thawed quickly in a 37°C water bath, and then transferred to centrifuge tubes containing preheated culture medium. After centrifugation, the supernatant was discarded, the cells were resuspended in fresh culture medium and seeded into culture dishes, and cultured in an incubator until the cells reached the logarithmic growth phase.
[0036] (2) Cell passage and plating Cells in the logarithmic growth phase were passaged, and the cell density was adjusted to 3 × 10⁻⁶. 5 After obtaining cells / ml, seed them into 6-well plates, 1 ml per well, add an appropriate amount of culture medium to ensure uniform cell distribution, and continue culturing until the cells adhere stably.
[0037] (3) Intervention of test substance After the cells adhered and stabilized, the original culture medium was aspirated, and culture medium containing the test substance was added. A control group was also set up (culture medium was added only, without the test substance), and the cells were cultured for another 24 hours. Multiple replicates were set up for each group to ensure the reliability of the results.
[0038] (4) Detection of barrier factors and differentiation factors Take out the cell culture plate, discard the culture solution, directly add RZ lysis solution of total RNA extraction kit (brand: TIANGEN, model number: DP419) in the culture dish, extract RNA according to the kit operation, and use a micro UV spectrophotometer to determine the RNA concentration. When the RNA quality is good, the next step is performed.
[0039] According to the operation instruction of Starscript II reverse transcription kit (brand: Genstar, model number: A233-10), reverse transcription is carried out in RNase-free PCR tube. According to the operation instruction of 2xSYBR Green Master Mix kit (brand: Bimake, model number: B21203), primers and templates are added. The primer information is as follows: The NCBI accession number of FLG gene is NM_002016.2; The upstream primer of FLG is 5' GACAGTGAGGCATACCCAGAG 3'; The downstream primer of FLG is 5' AAGTGACCATGTTCCTTAGCG 3'; The NCBI accession number of ACTA2 gene is NM_001406471.1; The upstream primer of ACTA2 is 5'-TGGCTCTGGGCTCTGTAAGG-3'; The downstream primer of ACTA2 is 5'-TTTTGCTCTGTGCTTCGTCAC-3'; The NCBI accession number of GAPDH gene is NM_001357943.2; The upstream primer of GAPDH is 5'-TGAAGGTCGGAGTCAACGG-3'; The downstream primer of GAPDH is 5'-CCTGGAAGATGGTGATGGG-3'.
[0040] Real-time fluorescent quantitative PCR is carried out, 20μl system is selected, 1μl template, 1μl upstream primer and 1μl downstream primer are added in each well of 96 well plate, 10μl 2xSYBR Green Master Mix, 7μl deionized water are prepared into mixed reagent, after pasting PCR transparent sealing plate film, centrifugation, PCR instrument, amplification is carried out according to the following table. The collected data is arranged by using Excel or SPSS statistical software, and the 2 -△△ct value, average value, standard deviation and other statistical indexes are calculated. The PCR reaction conditions are shown in Table 5.
[0041] Table 5 PCR reaction conditions ; The detection results are as shown in Table 6 and Figure 6. As can be seen from the figure, compared with the common wheat extract obtained after enzymatic treatment, the triticale extract obtained after enzymatic treatment has a better promoting effect on the expression of the keratinocyte barrier factor FLG, and the triticale extract obtained after treatment with papain, bromelain and trypsin has a better promoting effect on the expression of the keratinocyte barrier factor ACTA2. Figure 2 and Table 6, it can be seen from the figure that, compared with the common wheat extract obtained after enzymatic treatment, the triticale extract obtained after enzymatic treatment has a better promoting effect on the expression of the keratinocyte barrier factor FLG, and the triticale extract obtained after treatment with papain, bromelain and trypsin has a better promoting effect on the expression of the keratinocyte barrier factor ACTA2.
[0042] Table 6 PCR detection results of each group ; 2.5, Anti-inflammatory efficacy detection RAW264.7 cells are one of the most commonly used in vitro models for inflammation research. Lipopolysaccharides (LPS) is a unique component of the cell wall of gram-negative bacteria, and LPS can cause a cascade of immune stimulation and toxic pathophysiological activities in the body. When bacteria invade the human body, they release LPS on their surface. LPS first binds to lipopolysaccharide-binding protein (LBP), which transports LPS to the membrane surface of immune cells and binds to the membrane protein CD14. Subsequently, CD14 transports LPS to the protein complex of Toll-like receptor 4 (TLR4) and myeloid differentiation protein 2 (MD2), activates the expression of downstream cytokines, and induces immune inflammatory response. LPS pre-stimulation can significantly increase the secretion level of cell pro-inflammatory mediator NO, and the detection of NO in the culture medium can reflect the effect of the test substance on inflammation. The specific detection method is as follows: (1) Cell recovery and culture Take the frozen mouse monocyte macrophage leukemia cells RAW264.7 cells from the liquid nitrogen, quickly put them into a 37°C water bath for thawing, then transfer them to a centrifuge tube containing preheated culture medium, centrifuge and discard the supernatant, resuspend the cells with fresh culture medium and inoculate into a culture dish, and place it in a culture incubator for culture until the cells grow to the logarithmic phase.
[0043] (2) Cell passage and plating Passage the logarithmic growth phase cells, adjust the cell density to 1.2x105 cells / mL, inoculate into a 12-well plate, 1ml per well, add appropriate amount of culture medium to ensure uniform distribution of cells, and continue to culture until the cells adhere stably.
[0044] (3) Test substance intervention The control group (only adding culture medium, not adding test substance), model group (cell culture solution containing 10 μg / ml of LPS), positive control group (cell culture solution containing 10 μg / ml of LPS and 100 μg / ml of dexamethasone), and test substance group (cell culture solution containing 10 μg / ml of LPS and different concentrations of test substance) are set. After the cells are adhered and stabilized, the original culture medium is removed, and the above culture solutions are added according to the experimental grouping, and the cells are cultured for 24 h. Multiple replicates are set in each group to ensure the reliability of the results.
[0045] (4) NO content detection The cell culture plate is removed, and 100 μl of culture solution is taken to a 96-well plate for 3 replicates and a control well. 50 μl of 1% sulfanilamide solution (dissolved in 5% phosphoric acid) and 50 μl of 0.1% naphthyl ethylenediamine dihydrochloride solution are added to each well, and mixed well. The control well is added with 100 μl of ultrapure water. Place at room temperature for 10 min, and measure the absorbance at 550 nm. Calculate the NO inhibition rate of each group relative to the cell model group.
[0046] NO inhibition rate = × 100%; The detection results are shown in Table 1: Figure 3 Compared with the model control group, at an experimental concentration of 20% (V / V), all ordinary wheat extracts and black wheat extracts except the ordinary wheat extract treated with neutral protease have the effect of inhibiting NO secretion; at an experimental concentration of 10%, all ordinary wheat extracts and black wheat extracts have the effect of inhibiting NO secretion, and the effect of black wheat extract is significantly better.
[0047] 3. Application of black wheat extract in skin care products 3.1. Preparation materials (1) T group (serum experimental group) The 5% black wheat extract serum contains 5% black wheat extract, 2% nicotinamide, 1% hyaluronic acid (1% aqueous solution), 5% glycerol, 2% pentylene glycol, 0.1% xanthan gum, 0.6% phenoxyethanol, 0.2% ethylhexylglycerin, appropriate amount of triethanolamine (for adjusting pH to 5.5-6.0) and deionized water (the balance to 100%) The specific preparation method is as follows: ① Preparation stage: all containers and equipment are cleaned and sterilized, and ready for use. Accurately weigh each raw material component with an electronic balance.
[0048] ② Aqueous phase preparation: Add approximately 80% of the total formula volume of deionized water to main beaker A, and heat to 75-80℃ in a water bath. Slowly sprinkle in xanthan gum while rapidly stirring with a glass rod or homogenizer to ensure thorough dispersion and dissolution, preventing clumping. Continue stirring for approximately 15-20 minutes until a homogeneous, transparent colloidal solution is formed. Stop heating, add glycerol and pentylene glycol, and stir until completely dissolved and homogeneous.
[0049] ③ Dissolve the active ingredient: Remove beaker A from the water bath and cool to 40-45℃ (slightly warm to the touch). Add nicotinamide and stir until completely dissolved. Add black wheat extract and stir until completely dissolved and homogeneous.
[0050] ④ Dissolving hyaluronic acid: In another small beaker B, pre-disperse and swell the hyaluronic acid with a small amount of room temperature deionized water (or directly use a pre-prepared 1% hyaluronic acid solution) to form a gel. Add the hyaluronic acid gel to the main beaker A and stir thoroughly to mix evenly.
[0051] ⑤ Cooling and pH Adjustment: Continuously stir to cool the solution to room temperature (25-30℃). Add the preservatives phenoxyethanol and ethylhexylglycerin, stirring until completely dissolved. Slowly adjust the pH of the solution with triethanolamine (pre-diluted to a 10% aqueous solution), with a final target of 5.5-6.0. Stir thoroughly and measure the pH after each drop is added to avoid over-adjustment.
[0052] ⑥ Volume Adjustment and Filling: Rinse the container that held the raw materials with the remaining deionized water, and add the washings to the main beaker. Finally, add the remaining volume to 100%, and stir thoroughly for 15-20 minutes to ensure the system is completely homogeneous. After standing to remove foam, it can be filled to obtain the final essence product.
[0053] (2) Group C (Serum Control Group) The 5% black wheat extract-free essence, by weight percentage, comprises 2% niacinamide, 1% hyaluronic acid (1% aqueous solution), 5% glycerin, 2% pentylene glycol, 0.1% xanthan gum, 0.6% phenoxyethanol, 0.2% ethylhexylglycerin, appropriate amount of triethanolamine (for adjusting pH to 5.5-6.0) and deionized water (balance to 100%). The preparation method is similar to that of Group T, except that the step of adding black wheat extract is omitted.
[0054] 3.2 Arrangement of subjects Sixty-six volunteers were selected and randomly divided into two groups of 33 each. The essence of group C and group T was used respectively. The selection criteria for subjects are as follows: (1) Selection criteria: ① Age between 18 and 59 years old; ② Skin ITA ≤ 40 ③The face is noticeably red; ④ Transepidermal water loss (TEWL) value > 15 g / h / m2; ⑤ Able to cooperate well with the test subjects and maintain a regular lifestyle during the research period; ⑥ Be able to read and understand all the contents of the informed consent form and voluntarily sign the informed consent form; ⑦ During the testing period, it is agreed not to use any cosmetics, drugs, or health products that may affect the results; ⑧ Products with the same efficacy as the test samples must not be used during the testing period; ⑨ No other cosmetics or personal care products may be used during the testing period except for the test sample; ⑩ Currently not involved and will not be involved in any other research involving the test area during the research period; ⑪ No cosmetic procedures may be performed during the testing period; ⑫ Other relevant inclusion criteria.
[0055] (2) Exclusion criteria: ① Individuals with skin conditions that may affect their judgment of test results; ② Individuals with a highly allergic constitution; ③Women who are pregnant, breastfeeding, or planning to become pregnant during the trial; ④ Individuals with severe heart, liver, or kidney dysfunction and severe immunodeficiency; ⑤ Individuals with mental illness, severe endocrine disorders, or those taking oral contraceptives; ⑥ Those who participated in drug clinical trials or other trials within the past 30 days, or those who have systematically used drugs that may affect the trial results within the past 2 weeks; ⑦ Individuals who have used oral or topical beauty products within the past two weeks that may affect the test results; ⑧ Those who cannot cooperate with the experiment; ⑨ Those whom the researchers deem unsuitable to participate in this study; ⑩ Other relevant exclusion criteria.
[0056] 3.3 Conduct comparative experiments (1) Experimental setup An open-label test was conducted over four weeks. Instrumental testing was used to evaluate changes in skin ITA, elasticity, transepidermal moisture loss, and redness in subjects after 0, 2, and 4 weeks of product use. The test was used to verify the efficacy of the sample in anti-oxidation, whitening, barrier repair, and anti-inflammation. The test instruments and test items are arranged as shown in Table 7.
[0057] Table 7 Test Instruments and Items ; (2) Testing process ① First visit, test explanation to the subject, and signing of the informed consent form.
[0058] ② Test day, clean face and wait: the subject cleans the face and dries the skin with a dry paper towel, and sits for 30 minutes in a laboratory with a temperature of 21℃±1℃ and a humidity of 50%±10% (RH); ③ Test: the laboratory technician performs image acquisition of the subject's face using ANTERA 3D, and tests the subject's skin for transepidermal water loss (TEWL) value, skin elasticity R2 value, and skin elasticity R7 value; ④ After the test is completed, the subject is given instructions for use, and after the subject listens to the instructions, the product is issued, and the subject uses the test sample at home for 4 consecutive weeks, during which the subject visits the designated place after 2 and 4 weeks of continuous use of the product, and performs the facial test according to steps 2) and 3). The amount of product used is confirmed at the beginning and end of the test; During the entire test process, the test environment conditions are set as follows: temperature 21℃±1℃, humidity 50%±10% (RH).
[0059] (3) Test results and data analysis The test results and data analysis are shown in Figure 4 , 5 and Table 8. As can be seen from the chart: In group C, after 4 weeks of use of the serum without black wheat extract by the subjects (33 people), the test results showed that the skin ITA was improved by 1.22%, the stratum corneum transepidermal water loss was improved by 21.37%, the redness was improved by 20.21%, the elasticity R2 was improved by 29.06%, and the elasticity R7 was improved by 14.25%; In group T, after 4 weeks of use of the serum containing black wheat extract by the subjects (33 people), the test results showed that the skin ITA was improved by 6.81%, the stratum corneum transepidermal water loss was improved by 37.19%, the redness was improved by 27.37%, the elasticity R2 was improved by 34.19%, and the elasticity R7 was improved by 36.64%; The above results show that, compared with week 0, the ITA, elasticity, transepidermal water loss, and redness of the skin of the subjects in group C were improved, indicating that the serum without black wheat extract has the effects of antioxidant, whitening, barrier repair, and anti-inflammatory. However, the serum containing black wheat extract in group T has a significantly better effect on improving the ITA, elasticity, transepidermal water loss, and redness of the skin of the subjects, indicating that black wheat extract has the effects of antioxidant, whitening, barrier repair, and anti-inflammatory, and the serum containing black wheat extract has a better effect on improving the skin of the users.
[0060] Table 8: Test item data of groups C and T ; Note: ** indicates a highly significant difference compared to before use, P < 0.010; * indicates a significant difference compared to before use, 0.010 < P < 0.050; n.s. indicates no significant difference compared to before use, P > 0.050 The above-described embodiments only express several implementation manners of the present application, which are described in a more specific and detailed manner, but should not be understood as a limitation on the patent scope of the present application. It should be noted that, for those skilled in the art, several modifications and improvements can be made without departing from the concept of the present application, which all belong to the protection scope of the present application.
Claims
1. Use of a triticale extract in the preparation of a skin care product having antioxidant, whitening, barrier repair and anti-inflammatory effects.
2. Use according to claim 1, characterized in that, The triticale extract is prepared by preparing a dough from triticale and washing the dough into gluten, adding ultrapure water to the gluten to obtain a mixture, subjecting the mixture to enzymatic hydrolysis to obtain an enzymatic hydrolysis product, and subjecting the enzymatic hydrolysis product to centrifugation and ultrafiltration to obtain a filtrate.
3. Use according to claim 2, characterized in that, The dough is washed with a 2% sodium chloride solution.
4. Use according to claim 2, characterized in that, The concentration of the mixture is 0.1 g / ml.
5. Use according to claim 2, characterized in that, The method of enzymatic hydrolysis comprises adding a protease to the mixture to obtain a reaction mixture having an enzyme concentration of 500 U / ml, and heating for enzymatic hydrolysis.
6. Use according to claim 5, characterized in that, The protease is any one of papain, bromelain or neutral protease, and the enzymatic hydrolysis conditions are pH 7, temperature 55°C and hydrolysis time 2.5 h.
7. Use according to claim 5, characterized in that, The protease is trypsin, and the enzymatic hydrolysis conditions are pH 8, temperature 37°C and hydrolysis time 2.5 h.
8. The use according to claim 1, characterized in that, The skin care product is a serum, and the serum comprises 5% triticale extract, 2% niacinamide and 1% hyaluronic acid by mass percentage.
9. The use according to claim 1, characterized in that, The skin care product is a mask, and the mask comprises 2% triticale extract, 0.5% glycyrrhizic acid dipotassium salt and 15% glycerol by mass percentage.