Targeting PAI-1 thrombolytic peptide and application thereof
By developing peptides P1, P2, P3, and P4 that target and bind to PAI-1, the problems of short therapeutic window, high bleeding risk, and poor efficacy of existing thrombolytic drugs have been solved, achieving highly efficient thrombolytic effects and improved safety.
Patent Information
- Application Number
- CN202511446305.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-11
- Publication Date
- 2026-01-02
AI Technical Summary
Existing thrombolytic drugs such as tPA and uPA have problems such as a narrow therapeutic window, a tendency to cause severe bleeding, and poor efficacy in patients with high PAI-1 expression. Existing PAI-1 inhibitors have problems such as insufficient affinity, poor targeting, and low bioavailability, which limit their widespread use.
We developed peptides P1, P2, P3, and P4 that target the binding sites of PAI-1 and porphyrin. By forming stable hydrogen bonds and electrostatic interactions with PAI-1, these peptides block the inhibitory function of PAI-1 on tPA and uPA, enhance plasminogen activation, reduce the risk of thrombolysis-related bleeding, and prolong the therapeutic window.
Peptides P1, P2, P3, and P4 exhibited significant thrombolytic activity in in vitro and in vivo experiments, significantly reduced PAI-1 protein activity, promoted fibrin degradation, improved vascular patency, reduced inflammatory factor expression, and decreased bleeding risk. Furthermore, when used in combination with low-dose tPA, they enhanced thrombolytic efficiency.
Smart Images
Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedicine, and to an antagonist of plasminogen activator inhibitor-1 (PAI-1), which has in vitro and in vivo thrombolytic activity and can be used to prepare PAI-1 antagonists or thrombolytic agents. Background Technology
[0002] Thrombotic diseases remain a leading cause of death and disability worldwide, especially in the context of aging societies and the high incidence of chronic diseases, where their harm is becoming increasingly prominent. Currently used thrombolytic drugs, such as tissue plasminogen activator (tPA) and urokinase (uPA), can promote thrombus dissolution to some extent, but their widespread application is severely limited by drawbacks such as a narrow therapeutic window, a tendency to cause severe bleeding, and inapplicability to all patients. Therefore, developing novel, highly targeted, and safe thrombolytic drugs has become an important direction of current research.
[0003] PAI-1 is a key factor regulating the activity of the fibrinolytic system. It inhibits fibrin degradation by binding to tPA and uPA, preventing plasminogen activation. Studies have shown that PAI-1 expression levels are significantly elevated in various thrombosis-related diseases, including acute ischemic stroke, myocardial infarction, and deep vein thrombosis, and are closely associated with thrombolysis failure, vascular re-occlusion, and thrombotic recurrence. Therefore, PAI-1 is widely recognized as an important molecular target in thrombolytic intervention, and the development of thrombolytic agents targeting PAI-1 has significant theoretical and clinical value. The PAI-1 protein exists in two conformations: a latent state that cannot bind to plasminogen activator (PA), and an active state that can bind to PA and inhibit its activity. Vitronectin's binding to PAI-1 stabilizes the active state, allowing PAI-1 to fully exert its thrombolytic effect by inhibiting PA.
[0004] Currently used thrombolytic agents primarily focus on activating the plasminogen pathway, exhibiting a single mechanism of action and being susceptible to ineffectiveness due to elevated PAI-1 expression. Although some studies have reported on PAI-1 inhibitors, including small molecule compounds and monoclonal antibodies, most suffer from insufficient affinity, poor targeting, low bioavailability, and strong immunogenicity. No PAI-1-targeted thrombolytic drugs have yet achieved clinical translation. Therefore, screening for novel PAI-1 inhibitors with well-defined structures and mechanisms and highly efficient thrombolytic function is crucial for expanding the range of thrombolytic drugs and improving clinical treatment outcomes. Summary of the Invention
[0005] The purpose of this invention is to provide (or a group of) PAI-1 antagonists with thrombolytic activity and their applications, in order to address the problems of existing thrombolytic drugs, such as short action window, high bleeding risk, and poor efficacy in patients with high PAI-1 expression. The peptides P1, P2, P3, and P4 discovered in this invention, as novel PAI-1-targeting thrombolytic peptides, enrich the research field of thrombolytic drugs targeting PAI-1, and can be used as thrombolytic drugs or lead compounds, and have value for further structural optimization and clinical development.
[0006] To achieve the above objectives, the present invention provides the following technical solution:
[0007] Technical Solution 1: A peptide compound (referred to as P peptide) that targets and binds to the "PAI-1 binding site with telogen effluvium". The structural formula of compound P1 is shown in Formula (1); the structural formula of compound P2 is shown in Formula (2); the structural formula of compound P3 is shown in Formula (3); and the structural formula of compound P4 is shown in Formula (4). Formula (1): Equation (2): Equation (3): Equation (4):
[0008] Technical Solution 2: The application of the polypeptide in the preparation of thrombolytic drugs that inhibit the function of PAI-1 protein.
[0009] Technical Solution 3: A PAI-1 protein inhibitor with thrombolytic activity, wherein the inhibitor comprises the aforementioned polypeptide.
[0010] Furthermore, the thrombolytic effect includes enhancing the activation of plasminogen by tPA and uPA.
[0011] Technical Solution 4: Application of the polypeptide in antagonizing the binding of PAI-1 to fibronectin.
[0012] Technical Solution 5: Application of the polypeptide in prolonging the time window of thrombolytic therapy and reducing the risk of thrombolysis-related bleeding.
[0013] Furthermore, the thrombolytic drug is suitable for the treatment of thrombosis.
[0014] Furthermore, the enhanced fibrinolytic activity includes reducing the inhibition of tPA and uPA by PAI-1, thereby improving the efficiency of fibrin degradation.
[0015] Technical Solution Six: The application of the polypeptide in reducing the binding affinity between PAI-1 and tPA or uPA.
[0016] The present invention discloses the following technical effects:
[0017] Molecular dynamics analysis results of this invention indicate that peptides P1, P2, P3, and P4 exhibit good binding stability to PAI-1 protein, with the binding region located at the interface between PAI-1 and glassin. Simulation data show that both peptides tend to form stable hydrogen bonds and electrostatic interactions with key positively charged residues in PAI-1 protein (such as Lys69 and Arg76), significantly reducing PAI-1 protein activity and effectively blocking its inhibitory function on tPA and uPA.
[0018] In vitro experiments showed that the P-series peptides exhibited good thrombolytic activity in a human plasma clot thrombolysis model constructed in 96-well plates, with a significant dose-dependent effect. In clots at different aging times, the peptide-treated groups significantly promoted fibrin degradation within 30 to 60 minutes, with a thrombolysis rate significantly higher than the PBS negative control group and close to that of the positive control tPA. The peptides showed a significant synergistic effect when combined with low-dose tPA, not only reducing the required tPA dose but also enhancing the overall thrombolytic efficiency, suggesting their potential in reducing bleeding risk.
[0019] The thrombolytic effects of peptides P2, P3, and P4 in a femoral artery thrombosis model of SD rats were systematically evaluated through animal experiments and compared with a urokinase-type plasminogen activator (uPA) positive control group. HE staining results showed that, compared with the model group, the P2, P3, and P4 peptide treatment groups exhibited varying degrees of reduction in intravascular thrombus area and improved vascular patency at multiple time points on days 1, 3, and 7. Among them, the P3 group showed the most significant thrombus clearance on days 3 and 7, with some specimens showing near-normal vascular structure and significantly reduced inflammatory cell infiltration. The P2 group also showed good thrombolytic effects, while the improvement in the P4 group was relatively weaker. The uPA group showed a strong thrombolytic effect, but endothelial damage and mild hemorrhage were observed in some tissue sections.
[0020] RT-qPCR results showed that the expression of inflammatory factors (IL-1β, IL-6, TNF-α) and tissue factor (TF) was significantly upregulated in the vascular tissue of rats in the model group. The treatment groups all showed downregulation of these factors at different time points, especially the P3 group, which showed the most significant inhibition of IL-1β and TF expression on days 3 and 7 (p<0.01). The P2 group showed better downregulation of inflammatory factors on day 1, but its maintenance effect was slightly lower than that of the P3 group in the later stages. The regulatory effect of the P4 group was relatively weak. The uPA group showed good inhibitory effect in the acute phase, but an increase in IL-6 levels was detected in some samples.
[0021] Therefore, the discovery of peptides P1, P2, P3 and P4 in this invention provides a new strategy for the research of PAI-1 targeted thrombolytic agents, and has good efficacy and development value for further structural optimization. Attached Figure Description
[0022] Figure 1 The structural formulas are those of polypeptide compounds P1(A), P2(B), P3(C), and P4(D).
[0023] Figure 2 The primary structures of polypeptide compounds P1(A), P2(B), P3(C), and P4(D) are shown.
[0024] Figure 3 This is a mass spectrometry result of compound P1.
[0025] Figure 4 This is a mass spectrometry result of compound P2.
[0026] Figure 5 This is a mass spectrometry result of compound P3.
[0027] Figure 6 This is a mass spectrometry result of compound P4.
[0028] Figure 7 The binding free energy of P1, P2, P3, P4, and the vitrobin SMB domain to PAI-1 is represented by the maximum and minimum values on the curve. VitroSMB: Vitrobin SMB domain.
[0029] Figure 8 The thrombolytic effects of P1, P2, P3, and P4 on thrombi aged 0.5–24 hours. tPA: tissue plasminogen activator.
[0030] Figure 9 10 -6 Time-effect curves of P1, P2, P3, and P4 on thrombi at concentrations ranging from 0.5 to 24 hours. tPA: tissue plasminogen activator.
[0031] Figure 10 10 -7 Time-effect curves of P1, P2, P3, and P4 on thrombi at concentrations ranging from 0.5 to 24 hours. tPA: tissue plasminogen activator.
[0032] Figure 11 10 -8 Time-effect curves of P1, P2, P3, and P4 on thrombi at concentrations ranging from 0.5 to 24 hours. tPA: tissue plasminogen activator.
[0033] Figure 12 This is a graph showing the transcriptional levels of IL-1β (A), IL-6 (B), TF (C), and TNF-α (D) mRNA in the blood on the first day after drug administration. n = 3, *p < 0.05, **p < 0.01, ***p < 0.005, ****p < 0.001, compared with the model group.
[0034] Figure 13 The graph shows the relative expression levels of IL-1β (A), IL-6 (B), TF (C), and TNF-α (D) in blood mRNA on the first day after drug administration. n = 3, *p < 0.05, **p < 0.01, ***p < 0.005, ****p < 0.001, compared with the model group.
[0035] Figure 14 The levels of IL-1β (A), IL-6 (B), TF (C), and TNF-α (D) in blood mRNA on day 1 after drug administration. n = 3, *p < 0.05, **p < 0.01, ***p < 0.005, ****p < 0.001, compared with the model group.
[0036] Figure 15 HE-stained sections of the femoral artery at different time points (1, 3, and 7 days) after modeling are shown. In the control group, the vascular structure remained intact, with no thrombus formation observed. In the model group, numerous dense thrombi were observed, almost completely obstructing the lumen. In the P2, P3, P4, and UPA-treated groups, the thrombus burden gradually decreased at different time points, and some vascular lumens showed recanalization. UPA: urokinase-type plasminogen activator. Detailed Implementation
[0037] Example 1
[0038] 1 Experimental Methods
[0039] 1.1 Molecular Dynamics Analysis
[0040] Molecular dynamics analysis was performed using GROMACS (2022.5) software, installed on an Ubuntu 22.04LTS system, which supports CUDA hybrid parallel computing. The specific operation was as follows: Based on the size of the complex formed by PAI-1 and the ligand, a cuboid cell with periodic boundaries was defined to ensure that the position of the ligand did not exceed half the long axis of the cell after the compound was completely pulled away from the PAI-1 binding site. The complex formed by PAI-1 and the compound was placed on one side of the cell, with the reference atom set to the closest pair of carbonyl carbon atoms between PAI-1 and the compound located in the central region of the binding site. In this patent, the cell size was 5.8, 6.9, 3.0 nm (x, y, z). 1000 kJ·mol⁻¹ was applied along the reaction axis. -1 ·nm -2 The resonant force, in 10 nm·ns -1 The compounds were pulled away from the complex at a constant rate, and 501 systematic conformation files were generated sequentially. From these conformations, a series of conformation files with a distance of less than 0.2 nm between the pulled compounds were selected for sequence umbrella sampling, and the binding free energy was calculated using the WHAM module. The amount of data for a single umbrella sampling free energy analysis was approximately 107 Gb.
[0041] 1.2 In vitro pharmacological validation
[0042] The in vitro thrombolytic activity of the peptides was evaluated using a 96-well plate thrombolysis model. First, a coagulation mixture containing recombinant tissue factor and calcium chloride (final concentration 67 mM) was prepared and added evenly to the bottom edge of each well in a clear, flat-bottomed, pyrogen-free, tissue-culture-treated sterile 96-well plate (Costar). Then, 25 μL of human plasma was added to each well and slowly dispersed in a ring along the well edge using a P100 pipette to form a ring-shaped clot, keeping the central region clear.
[0043] After sealing the wells, incubate them at 37°C for 30 minutes to 4 hours to obtain fresh or thrombi of varying ages. Then, add 70 μL of the test thrombolytic agent (tPA, uPA, peptide P1–P4, concentration range 10) diluted with HEPES buffer to the center of each well. -11 Up to 10 -5 (mol / L), with a final volume of 100 μL / well.
[0044] Using an ELISA reader, absorbance values at 405 nm were read every 10 minutes with continuous slow shaking. A negative control (PBS-treated thrombus) and a positive control (whole blood PBS mixture without added coagulation mixture) were set up, representing no degradation (A0) and complete degradation (A10), respectively. t The percentage of thrombolysis is calculated using the following formula:
[0045] Dx(t)=100×[Ax(t)-A0(t)] / [A t (t)-A0(t)]
[0046] Each group was set up with 6 replicates. Experimental data were statistically analyzed using GraphPad Prism 10 and expressed as mean ± standard deviation. One-way ANOVA was used to test differences between groups, and P < 0.05 was considered statistically significant.
[0047] 1.3 Pharmacological validation in animals
[0048] (1) Establishment of lipopolysaccharide-induced inflammation model: After 4-week-old SD rats were adapted to feeding for 1 week, they were divided into groups and numbered. The model group and the drug administration group were injected intraperitoneally with 2 mg / kg lipopolysaccharide (LPS); the control group was injected intraperitoneally with 2 mg / kg physiological saline.
[0049] (2) Establishment of a ferric chloride-induced femoral artery thrombosis model: The animal was fasted for 12 hours before the experiment but had free access to water. The dosage of anesthetic was calculated based on the animal's weight. After anesthesia, the animal was fixed on the operating table. The skin was prepared and disinfected, and the femoral artery of the right lower limb was exposed. The femoral artery was covered with filter paper soaked in 6% FeCl3 (for 5 minutes).
[0050] (3) Animal drug administration: After the model was established, animals were administered P2, P3, P4 and uPA at 5 mg / kg via sublingual vein. Samples were collected from the animal groups on the first, third and seventh days after drug administration.
[0051] (4) Blood sample collection: After the animal was euthanized, blood was collected through the carotid artery (treated with 0.5M EDTA).
[0052] Vascular tissue collection: The target femoral artery segment was harvested, fixed in 4% paraformaldehyde, and sectioned in paraffin. Hematoxylin and eosin (HE) staining was used to observe the morphology and size of the thrombus.
[0053] (5) Extraction of total RNA from blood samples: Add 800 μL of RNA extraction buffer (Servicebio G3013) to every 200 μL of fresh blood sample, mix well, and let stand at room temperature. If the blood is preserved in RNA stabilizing solution, centrifuge to remove the preservation solution before adding the extraction buffer. Add chloroform substitute (1-bromo-3-chloropropane) to every 1 mL of extraction buffer, mix thoroughly, let stand, and then centrifuge at 12,000 g for 15 min at 4 °C, transferring the upper aqueous phase. Then add an equal volume of isopropanol to precipitate RNA, and centrifuge again to collect the white precipitate. Wash the precipitate twice with 75% ethanol to remove residual liquid, let stand and air dry for 3-5 min, and then dissolve in water.
[0054] (6) Detection of coagulation markers IL-1β, IL-6, TF, and TNF-α by quantitative real-time PCR:
[0055] Total RNA extracted was transcribed into complementary DNA (cDNA) using a reverse transcriptase kit (SparkJade AG0304) and incubated at 50°C for 15 min. The resulting cDNA was used for subsequent qPCR reactions. In qPCR, specific primers and fluorescent dyes were used to amplify and quantify the target gene, following the instructions of a quantitative real-time qPCR kit (Nearshore Protein E036). Each group was configured with three replicates. Experimental data were statistically analyzed using GraphPad Prism10 and expressed as mean ± standard deviation. One-way ANOVA was used to test for differences between groups, and the Tukey-Kramer test was used for multiple comparisons between groups. P < 0.05 was considered statistically significant.
[0056] The primer fragment sequences designed according to the requirements are shown in Table 1, and synthesized by Sangon Biotech. The quantitative qPCR system is shown in Table 2. Table 1 Primer sequences for quantitative real-time PCR Primer name Primer sequence IL-6-F CGAGCCCACCAGGAACGAAA IL-6-R TGGCTGGAAGTCTCTTGCGG IL-1β-F ATGTCTTGCCCGTGGAGCTT IL-1β-R ATGGGTCAGACAGCACGAGG TF-F CTCCGTCTGATCGCTCGTGT TF-R GGAGGAGTGCCTGCACCAG TNF-α-F CTCATCTCCGCCTTTGTCCCC TNF-α-R CACCGCTCTGACTCTCTCACC Table 2. Quantitative PCR reaction system
[0057] (7) Femoral artery HE staining: Tissue samples were dehydrated sequentially with 75%, 85%, 95%, and 100% graded ethanol solutions for 60 minutes each, then cleared in xylene I and II for 45 minutes each, followed by paraffin permeation in paraffin I, II, and III for 50-60 minutes each. After completion, the samples were embedded and sectioned. Paraffin sections were baked at 65℃ for 30-60 minutes, then sequentially immersed in xylene, anhydrous ethanol, 95%, and 80% ethanol, and then slowly rinsed with tap water to achieve dewaxing to water. For staining, hematoxylin was first stained for 3-5 minutes, and the degree of staining was judged by microscopic observation. After differentiation with 1% hydrochloric acid alcohol, the sections were treated to return to blue, and then rinsed with running water. Subsequently, eosin staining was performed for 30 seconds to 1 minute to complete the staining of the cytoplasm. Afterward, the sections were rapidly dehydrated sequentially with 80%, 95%, and anhydrous ethanol, and then mounted with ultra-clean mounting glue. Finally, images were acquired and analyzed using a microscope.
Claims
1. A group of cyclic peptide compounds, named P1, P2, P3 and P4 respectively, characterized in that... All of them are derived from the core structure "X-Asp-Glu-Leu-Cys-X-Tyr-Tyr-XX-Cys-X" (where the two Cys residues are linked by a disulfide bond, and X represents any type of amino acid), and all of them can target and antagonize "plasminogen activator inhibitor-1" (PAI-1). The structural formula of compound P1 is shown in formula (1); the structural formula of compound P2 is shown in formula (2); the structural formula of compound P3 is shown in formula (3); and the structural formula of compound P4 is shown in formula (4).
2. The application of the compound as described in claim 1 in the preparation of PAI-1 antagonists, characterized in that... The compound can bind to the "PAI-1 binding site for vitronectin" and exert a competitive antagonistic effect.
3. The application of the compound as described in claim 1 in the preparation of thrombolytic agents, characterized in that... The compounds can reduce the activated state of PAI-1 protein and increase the activity of tPA or uPA, thereby exerting a thrombolytic effect.
4. The use of the compound as described in claim 1 in the preparation of an anti-inflammatory agent, characterized in that... The anti-inflammatory agent can reduce the expression levels of IL-1β, IL-6, TNF-α, and TF genes, which are associated with thrombotic pathology.
5. The use of compounds P2, P3, and P4 of claim 1 in the preparation of thrombolytic drugs, wherein the thrombolytic drugs are used to dissolve thrombi in vivo.