High-efficiency mammal protein expression system based on prokaryotic two-component signal transduction system and application of high-efficiency mammal protein expression system
By constructing a high-efficiency protein expression system for mammals based on a prokaryotic two-component signal transduction system, the problem of low protein expression efficiency in mammalian cells has been solved, achieving high-yield protein expression and supporting structural biology research and biomedical production.
Patent Information
- Application Number
- CN202511256669.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-04
- Publication Date
- 2026-01-09
AI Technical Summary
Existing technologies struggle to efficiently express proteins in mammalian cells, resulting in unmet needs for protein structure and function research and biopharmaceutical production. Traditional methods also suffer from low yields and high costs.
We constructed a high-efficiency mammalian protein expression system based on the prokaryotic two-component signal transduction system (TCS). The protein was stably expressed in mammalian cells through the human codon-optimized NarX/L system, and the TCS system continuously activated transcription factors to increase protein expression levels.
This technology enables efficient protein expression in mammalian cells, increases protein yield, meets the needs of structural biology research and biopharmaceutical production, and provides a new approach for therapeutic proteins and antibodies.
Smart Images

Figure CN121294538A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of structural biology and biomedicine, and in particular to a high-efficiency protein expression system for mammalian cells and its applications. Background Technology
[0002] Proteins are key elements for cell growth, metabolism, and function, and studying mammalian proteins is the golden key to unlocking the mysteries of life sciences. Obtaining large quantities of mammalian protein samples with correct folding and bioactivity has always been a focus of biomedical and structural biology research. Currently, there are four main methods for obtaining mammalian protein samples: 1) expression in *E. coli*; 2) expression in yeast; 3) in vitro expression using cell-free protein expression systems; and 4) expression within mammalian cells.
[0003] Proteins derived from mammalian cells often exhibit more complex folding structures and various types of post-translational modifications, making in vitro expression and expression systems in lower organisms such as prokaryotes or yeast insufficient. Mammalian cell lines provide a cellular environment similar to that of natural human proteins, producing proteins with structures and functions more closely resembling their physiological state. While expressing target proteins in mammalian cells offers numerous advantages, traditional methods suffer from low yields, high costs, and complex, uncontrollable technical procedures. Structural biology studies of proteins, such as liquid nuclear magnetic resonance (NMR), X-ray crystallography, and cryo-electron microscopy, require large quantities of protein samples, limiting the study of their structure and function. Statistics show that over 80% of approved therapeutic proteins are produced in mammalian cells, highlighting the promising commercial potential of obtaining high-yield proteins in mammalian cells. Therefore, developing efficient protein expression systems for mammalian cells not only provides technical support for research on the structure and function of proteins in humans and higher organisms but also offers methods for obtaining therapeutic proteins and antibodies in biomedicine, possessing significant scientific and commercial value.
[0004] Protein expression levels in mammalian cells are regulated by a variety of factors, such as the composition of the target gene, the structure of the expression vector, the type of host cell, the transfection method, and cell culture conditions. Modifying the structural elements of expression vectors to increase protein production in mammalian cells is considered one of the most promising strategies. In 2015, Emilio Casanova's team obtained 1 g / L of antibody by modifying the promoter and gene regulatory elements on the BCA vector and scaling up the culture using a bioreactor. In 2018, Yvonne Jones et al. increased the expression levels of proteins such as SOD1 by nearly eight-fold by optimizing the core promoter element of pCAβ-EGFP. Since protein transcription in mammalian cells is a highly complex process regulated by multiple DNA signaling elements and corresponding binding factors, simply modifying transcriptional elements on DNA has limited effect on increasing protein expression levels, making it difficult to meet the research needs of biomedicine and structural biology. The key to constructing more efficient mammalian cell protein expression systems lies in considering both upstream and downstream aspects of transcription, starting from the effective recruitment of transcription-related regulatory factors and the activation of DNA elements.
[0005] In recent years, prokaryotic two-component signal transduction systems (TCS) suitable for the expression of exogenous proteins in mammals have attracted increasing attention. A typical TCS consists of a histidine kinase (HK) and a response regulator (RR). HK can be activated by a ligand and phosphorylate its own histidine residues; the aspartic residues of RR are then activated by accepting the phosphate groups transferred from HK, thereby regulating the expression of downstream genes. The reason this system can be used for exogenous protein expression in mammals is that: 1) The TCS system has not yet been found in higher vertebrates. Its phosphorylation pathway differs from the serine / threonine / tyrosine transmission in higher vertebrates; TCS uses the histidine / aspartic acid pathway for phosphorylation transmission, resulting in a clean background and no crosstalk in mammals; 2) HK is a multifunctional enzyme whose kinase and phosphotransferase activities enable sustained activation of the signal at low ligand concentrations (HK:RR ≈ 1:200), while its phosphatase activity effectively terminates the signal; 3) RR can carry different types and copy numbers of activators, effectively and continuously recruiting and assembling transcription machinery. The prokaryotic TCS system transplanted into mammalian cells can regulate gene expression in multiple ways, thus possessing great potential in developing novel, highly efficient protein expression systems for mammalian cells. Summary of the Invention
[0006] This invention leverages the advantages of prokaryotic TCS in regulating protein expression to construct a system capable of efficiently expressing proteins within mammalian cells. This will provide a new method for the production of therapeutic proteins and antibodies, and offer key technical support for the preparation of mammalian protein samples in research fields such as structural biology. The efficient mammalian protein expression system described in this invention comprises two components: 1) a TCS capable of efficiently recruiting transcription factors; and 2) a vector capable of being induced by the TCS to express the target gene.
[0007] The TCS refers to a system optimized with human codons that can be stably expressed and effectively activated in mammals. It consists of vectors expressing HK and RR, where the RR protein is a recombinant protein with an activation domain (AD) attached to its C-terminus. AD can recruit transcription activators in mammalian cells to initiate transcription. TCS expression involves cloning HK and RR into the multiple cloning site (MCS) region of mammalian constitutive expression vectors such as pcDNA3.1. Activation can be achieved through ligand activation or by designing TCS mutants to maintain continuous activation of the expression system.
[0008] This invention selects the prokaryotic NarX / L system as the object, where NarX is HK and NarL is RR. Through human codon optimization, gene mutation, and recombination techniques, the NarX mutant and NarL-AD recombinant protein were cloned into the multiple cloning site region of pcDNA3.1, respectively. The obtained NarX... hum Mutants and recombinant protein NarL hum -AD can efficiently recruit transcription factors in mammalian cells and induce the expression of target genes, among which NarX hum The mutant is NarX hum The Ala mutation at amino acid position 46 gives the Thr variant (NarX). hum A46T AD is a 4-copy herpes simplex virus particle transcription activation domain (VP64). It encodes NarX. hum The wild-type gene sequence, such as SEQ ID NO.1 and encoding NarX, is shown. hum A46T The mutant's gene sequence is shown in SEQ ID NO.2, encoding NarL. hum The gene sequence of the -VP64 recombinant protein is shown in SEQ ID NO.3.
[0009] The vector capable of expressing the target gene by TCS consists of a cis-acting element that regulates gene expression and a target gene inserted into a multiple cloning site downstream of the promoter, and is a mammalian inducible expression vector. The expression vector carrying the target gene is obtained by modifying conventional protein expression vectors such as pcDNA3.4 or pcDNA3.1 as the backbone vector. The backbone vector described in this invention is pcDNA3.4; The cis-acting elements regulating gene expression include: enhancers, and elements capable of recognizing NarL. hum -VP64 binding site, inducible promoter, multiple cloning site, and other optional elements: introns, post-transcriptional regulatory elements, etc.
[0010] By optimizing and arranging the cis-acting elements, a set of optimized cis-acting elements is obtained, namely... The enhancer is a CMV enhancer; The inducible promoter is the CMV53 promoter, and its nucleotide sequence is shown in SEQ ID NO.4; the promoter capable of recognizing the response regulatory protein NarL... hum The binding site for -VP64 is a tandem binding site for six copies linked upstream of the 5' of the inducible promoter, and its nucleotide sequence is shown in SEQ ID NO.5; The multiple cloning site includes a Kozak sequence, multiple restriction enzyme sites, and a transcription start codon, the nucleotide sequence of which is shown in SEQ ID NO. 6. All the cis-acting elements listed above have been experimentally demonstrated to enhance the expression of the target gene in mammalian cells. The final result can be mediated by NarL... hum -VP64-induced target gene expression vector is p3.4-TCS-MCS.
[0011] This invention also provides a method for obtaining TCS-stable cells, the specific method of which is as follows: Before obtaining stable TCS-transfected cells, this method requires co-transfection of three plasmids into mammalian cells each time. After obtaining stable TCS-transfected cells, only one plasmid (a vector capable of inducing TCS expression of the target gene) needs to be transfected into mammalian cells each time, which significantly simplifies the experimental procedure and further improves protein expression levels. The method for obtaining stable TCS-transfected cells involves simultaneously transfecting two vectors carrying the HK and RR target genes into mammalian cells (preferably HEK239T and CHO cells). Through drug or antibiotic selection, TCS is integrated into the mammalian cell chromosome, resulting in cells that stably express TCS (preferably NarX). hum A46T / NarL hum A stable cell line of VP64.
[0012] This invention also proposes a method for expressing target proteins in mammalian cells.
[0013] The target gene encoding the recombinant protein was inserted into the multiple cloning site region of the expression vector p3.4-TCS-MCS. The resulting recombinant plasmid was then combined with the NarX-carrying plasmid. hum A46T and NarL hum The -VP64 plasmid can be transfected into mammalian cells (preferably HEK239) via transient transfection, or the resulting recombinant plasmid can be directly transfected into NarX. hum A46T / NarL hum In the VP64 stable cell line, cells were cultured at 37°C in a 5% CO2 cell culture incubator for 2-3 days, and then collected for protein function studies.
[0014] The present invention also proposes a method for expressing mammalian cell secretion proteins.
[0015] A secretion tag is attached to the 5' end of the target gene encoding the recombinant protein and inserted into the multiple cloning site region of the expression vector. The resulting recombinant plasmid is then combined with the NarX-carrying plasmid. hum A46T and NarL hum The -VP64 plasmid can be transfected into mammalian cells (preferably HEK239) via transient transfection, or the resulting recombinant plasmid can be directly transfected into NarX. hum A46T / NarL hum In the VP64 stable cell line, high-density culture was carried out in a 5% CO2 cell culture incubator at 37°C for 2-5 days. The cell culture medium was then collected and purified.
[0016] This invention also proposes a method for expressing and isotopically labeling proteins within mammalian cells. Based on the formulation of commercially available DMEM medium, unlabeled amino acids were replaced with the desired labeled amino acids at equal doses to prepare an isotope-labeled medium, with the addition of serum and antibiotics. The intracellular protein TFM (trifluoromethylmethionine) was then used as the medium. 19 Taking F labeling as an example, replace the unlabeled Met in the DMEM medium with the same dose. 19 F-labeled tfmMet, with the addition of 2% (v / v) fetal bovine serum and 1% (v / v) penicillin-streptomycin, yielded 19F-labeled tfm Met cell culture medium. Construct the gene for the target protein to be expressed using the two methods described above and transfect the plasmid. Culture in unlabeled DMEM medium for 18-24 hours, then replace the medium with isotope medium supplemented with fetal bovine serum and penicillin-streptomycin, and continue culturing for 1-3 days. Collect the cells. To increase protein yield per cell, a suitable concentration of cell proliferation inhibitor, such as 3-7 mM valproic acid, can be added within 24 hours of plasmid transfection.
[0017] Based on the above-described invention, this invention also proposes applications based on the aforementioned high-efficiency mammalian protein expression system, as detailed below. Application 1 (Structural Biology): Efficient expression of target proteins within mammalian cells provides ideal mammalian cell protein samples for structural biology studies (X-ray crystallography, cryo-electron microscopy, and nuclear magnetic resonance). For example, by overexpressing proteins in mammalian cells (with a single-cell protein concentration of nearly 500 uM) and selectively labeling them, in-situ NMR detection of proteins can be achieved.
[0018] Application 2 (Biomedical field): Through secretory expression and in vitro purification, high yields of mammalian proteins can be obtained, providing a new method for the production of therapeutic proteins, drug target proteins, and antibodies.
[0019] Compared with the prior art, the beneficial effects of the present invention are as follows: 1. This invention, based on the differences between mammalian and prokaryotic cell environments, modifies prokaryotic NarX / L to obtain NarX / L that can continuously activate gene expression, effectively increasing the expression level of mammalian proteins in cells. The NarX / L-mammalian cell protein high-efficiency expression system created in this invention requires only about 10 µg of plasmid (3.2 µg HK, 3.2 µg RR, 3.2 µg inducible target gene expression vector) in a T75 culture flask to produce nearly 500 μM of protein in a single mammalian cell (HEK293T).
[0020] 2. Based on the NarX / L-mammalian cell protein high-efficiency expression system created in this invention, for the first time, TFM Met labeling of proteins was achieved in mammalian cells, and proteins such as EGFP were collected. 19 The signal of F In-cell NMR.
[0021] 3. This invention applies prokaryotic TCS to a high-efficiency expression system for mammalian proteins, providing a new method for the production of therapeutic proteins, drug target proteins, and antibodies. It also provides key technical support for the preparation of mammalian protein samples in research fields such as biophysics and structural biology, and has important scientific significance for the development of life sciences, the diagnosis and treatment of diseases, and the development of drugs. Attached Figure Description
[0022] Figure 1 This is a schematic diagram of the gene expression induction pathway of NarX / NarL in mammalian cells.
[0023] Figure 2 For NarX hum A46T Significantly enhanced EGFP expression levels. (A) NarX hum Microscopic images of mammalian cells corresponding to the wild type; (B) NarX hum A46T Corresponding mammalian cell microscopic images; both experiments simultaneously transfected cells carrying NarX. hum The carrier, NarL hum The images show the vector for the target gene EGFP and the vector for the target gene. The top two images show the control group transfected with the pDsRed gene, and the bottom two images show the vector that can be transfected with NarX. hum / NarL hum Image of induced EGFP green fluorescence.
[0024] Figure 3 For the assessment of hAK1 expression, the upper image is an SDS-PAGE image of human adenosine kinase 1 (hAK1), and the lower image is a Western blotting image of hAK1 protein (His antibody). The lanes in both images, from left to right, are: control cell lysate transfected with TCS, cell lysate expressing hAK1, protein marker, and hAK1 purified at different concentrations.
[0025] Figure 4 Based on the original NarX kernel hum A46T / NarL hum EGFP expression induced in mammalian cell protein expression systems containing -VP64 19 The results of the in-cell NMR spectrum are shown in Figure 1. (A) is the structural diagram of EGFP (PDB:6ylp), with the position of Met marked with a stick figure; (C) is the EGFP tfm Met diagram. 19F NMR spectra, from bottom to top: EGFP in-cell NMR difference spectrum, cell lysate, purified EGFP, and cell supernatant 1 hour after sampling. 19 F NMR spectrum; (C) The box in the middle indicates the source of the difference spectrum, from bottom to top: transfected NarX hum A46T / NarL hum -VP64 / p3.4-TCS-EGFP (top), transfected with NarX hum / NarL hum -VP64 (middle), and the difference spectrum between the two (bottom); (B) is a structural diagram of SOD1 (PDB:6fn8). The location of Trp is marked with a stick icon; (D) is the SOD1 Trp diagram. 19 F NMR spectra, from bottom to top: SOD1 in-cell NMR differential spectrum, cell lysate, purified SOD1, and cell supernatant 1 hour after sampling. 19 F NMR spectrum; (D) The boxes indicate the sources of the difference spectrum, from bottom to top: transfected NarX hum A46T / NarL hum -VP64 / p3.4-TCS-SOD1 (top), transfecting NarX hum / NarL hum -VP64 (middle), and the difference spectrum between the two (bottom).
[0026] Figure 5 This is a schematic diagram of the TCS-induced expression vector p3.4-TCS-MCS. Detailed Implementation
[0027] The present invention will be further described in detail below with reference to specific embodiments. Unless otherwise specified, the experimental methods described in the embodiments are performed according to conventional molecular biology experimental methods.
[0028] The terminology used in this invention is explained below: “TCS”: Two-component system.
[0029] NarX hum A46T Its key feature is the human codon optimization of the gene sequence of NarX (E. coli), a receptor protein in a two-component system of prokaryotic E. coli, by mutating amino acid position 46 of NarX from Ala to Thr. hum A46T The nucleotide sequence of the gene is shown in SEQ ID NO.2.
[0030] “NarL hum The "-VP64" is characterized by human codon optimization of the gene sequence of NarL (E. coli), a response regulatory protein of prokaryotic Escherichia coli, and the addition of four copies of the herpes simplex virus particle transcription activation domain (VP64) to the C-terminus of the response regulatory protein NarL to form a recombinant protein, as detailed in Example 1, with the nucleotide sequence as shown in SEQ ID NO.3.
[0031] “MCS”: multiple cloning site.
[0032] The characteristic of "p3.4-TCS-MCS" is that it uses the constitutive expression vector pcDNA3.4 as the backbone vector, replaces the original CMV promoter with the CMV53 inducible promoter, and then adds P... CMV53 and NarL hum The gene sequences of the -VP64 binding site and multiple cloning site region MCS are tandemly linked to form a complete expression element (such as...). Figure 5 As shown in the figure, the MCS region of this vector can be used to insert the target protein gene. If the inserted target protein is X, it is named p3.4-TCS-X. If the inserted target protein is EGFP, the vector is named p3.4-TCS-EGFP.
[0033] In the following examples, all cell culture and nucleic acid transfection methods are as follows: 1. Cell Culture Cell resuscitation: 1 mL of frozen HEK293T cells were thawed in a 37°C water bath for 2 min, diluted in 10 mL of cell culture medium (high glucose DMEM medium containing 1% penicillin-streptomycin and 10% fetal bovine serum), and cultured in a 37°C 5% CO2 cell incubator for resuscitation.
[0034] Cell passage: When the cell density reaches approximately 80%, passage is performed. Discard the original culture medium, wash once with PBS, and digest well-adhered cells with 1 mL of trypsin at 37°C for about 1 min. Under a microscope, the cell shape will change from spindle-shaped to spherical. Dilute the cells with 10 mL of cell culture medium (high glucose DMEM medium containing 1% penicillin-streptomycin and 10% fetal bovine serum) to terminate the digestion reaction. Divide the cell suspension into flasks at a 1:2 ratio, add culture medium to make up the difference, mix well, and continue culturing in an incubator. After 3 passages, the cells reach optimal growth. Count the cells under a microscope using a cell counting chamber, and dilute the cells to 2*103. 4 Cells / mL. Transfer 500 µL of cells to each well of a 24-well plate and culture for 24 hours before transfection.
[0035] 2. Nucleic acid transfection The nucleic acid transfection reagent and endotoxin-free cDNA were dissolved and diluted in serum-free and antibiotic-free high-glucose DMEM medium at a volume-to-mass ratio of 1:1 to 1:3 (transfection reagent: cDNA). After incubating at room temperature for 20 min, the mixture was added to each well of a cell culture plate and cultured in a cell culture incubator for 48-72 hours. Cells were observed or collected using a fluorescence microscope for protein expression analysis.
[0036] Example 1 NarX hum A46T and NarL hum - The VP64 system significantly improves protein expression levels.
[0037] 1) NarX hum A46T Construction of the expression carrier.
[0038] The human codon of the E. coli NarX gene (GenBank: CAA48934.1) was optimized, and the resulting gene sequence is shown in SEQ ID NO.1. The 46th position of the sensor domain of NarX was mutated from A to T, and the resulting gene sequence is shown in SEQ ID NO.2. The NarX gene before and after mutation was ligated into the MCS multiple cloning site region of the expression vector pcDNA3.1(+).
[0039] 2) NarL hum Construction of the VP64 expression vector.
[0040] The E. coli NarL gene (GenBank: CAA48935.1) was codon-optimized, and the eukaryotic transcription activator VP64 was ligated to the C-terminus of the NarL gene. The optimized gene sequence after VP64 ligation is shown in SEQ ID NO.3. The constructed recombinant protein NarL was then... hum -VP64 is linked to the multiple cloning site region MCS of the expression vector pcDNA3.1(+).
[0041] 3) NarX before optimization hum and NarL hum Expression vectors and expression vectors carrying the target gene EGFP, or optimized NarX... hum and NarL humBoth the expression vector and the expression vector carrying the target gene EGFP were transfected into HEK293T cells (24-well plates) at a ratio of 200:200:400 ng. Liposome transfection and cell culture were performed as described above. Simultaneously, the plasmid pDsRed (400 ng), which expresses red fluorescent protein, was transfected as a control. Microscopic images were taken 48 hours later. NarX in this embodiment... hum A46T / NarL hum A schematic diagram of the VP64 protein expression system is shown below. Figure 1 As shown. NarX hum A46T / NarL hum -VP64 showed a significantly enhanced EGFP fluorescence intensity compared to pre-mutation induced EGFP, such as Figure 2 The illustration shows NarX hum A46T and NarL hum - The VP64 system can significantly increase the expression level of the target protein.
[0042] Example 2 The target gene expression vector (p3.4-TCS-MCS) can be expressed by NarX. hum A46T and NarL hum -VP64 activation significantly increases protein expression levels.
[0043] Using pcDNA3.4 as a backbone, its CMV enhancer and CMV promoter regions were modified. The modified parts are marked with gray bars and arrows, such as... Figure 1 As shown, a highly efficient expression vector for mammalian proteins that can be induced by NarX / NarL was obtained. The specific steps are as follows: 1) CMV53 starter element The CMV promoter sequence on the pcDNA3.4 expression vector was replaced with the CMV53 promoter via gene synthesis. CMV53 The sequence (585-660 bp) is shown in SEQ ID NO.4. CAACAAAATGTCGTAACAAGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCG (SEQ ID NO. 4).
[0044] 2) NarL hum -VP64 identification element Upstream of the CMV53 promoter 5', 2-6 copies (preferably 6 copies) of NarL are linked via gene synthesis. humThe NarL-VP64 binding site sequence (429-584 bp) is shown in SEQ ID NO.5, where the underlined bases are NarL. hum -Location of the VP64 binding site sequence.
[0045] TACCCCTATAGGGGTA TAGCGCCGGC TACCCCTATAGGGGTA TAGCGCCGGC TACCCCTATAGGGGTA TAGCGCCGGC TACCCCTATAGGGGTA TAGCGCCGGC TACCCCTATAGGGGTA TAGCGCCGGC TACCCCTATAGGGG TA TCCATATGC (SEQ ID NO. 5).
[0046] 3) MCS region sequence The MCS sequence contains the Kozak sequence (bold), multiple restriction enzyme sites (underlined), and transcription start codon. The MCS sequence (661-715 bp) is shown in SEQ ID NO.6. The MCS gene is synthetically linked downstream of the CMV53 promoter.
[0047] CTAGT CTACTACCAGA GCTCATCGCTAGCGCTACCGGT CGCCACCATG (SEQ ID NO.6) NarL in front hum The VP64 binding site sequence, CMV53 promoter, and MCS sequence (multiple cloning site) are tandemly linked to form a complete p3.4-TCS-MCS expression element. Figure 5 As shown.
[0048] Example 3: Protein Expression Level Assessment Linking of the hAK1 (human adenosine kinase 1) gene: The 5' end of the hAK1 cDNA sequence was linked to the Kozak sequence of the p3.4-TCS-MCS expression vector obtained in Example 2 to obtain the p3.4-TCS-hAK1 gene expression vector.
[0049] NarX hum A46T Expression vector, NarL humThe p3.4-TCS-hAK1 expression vector and the p3.4-TCS-hAK1 expression vector were transfected into HEK293T cells (6-well plate) at a dose of 800 ng: 800 ng: 800 ng. The liposome transfection and cell culture methods were as described above. After 48 hours, the cells were digested with trypsin, counted under a microscope, and collected. The cells were dissolved in cell lysis buffer and subjected to SDS gel electrophoresis (SDS-PAGE) and Western blotting experiments to semi-quantitatively measure the protein content in the cells. The hAK1 expression level of a single cell was found to be approximately 516 μM.
[0050] Example 4 19 Preparation and spectral analysis of F-labeled EGFP protein cell samples 1) tfm Met and 6FW EGFP labeling.
[0051] Will carry NarX hum A46T Expression vectors carrying NarL hum The expression vector for -VP64 and the p3.4-TCS-EGFP plasmid were transfected into HEK293T cells at a 1:1:1 ratio using liposome transfection reagent. After 8 hours, the serum-free and antibiotic-free DMEM medium was replaced with serum-containing and antibiotic-containing DMEM medium. After 18-24 hours, the medium was replaced with TFM Met. 19 F-labeled medium. Add 1% antibiotic (penicillin-streptomycin) and 2% serum, and continue culturing for 24 hours.
[0052] 2) 19 Fin-cell NMR spectral acquisition and analysis.
[0053] Forty-eight hours after transfection, cells were collected and resuspended in 180 μL of NMR buffer (DMEM containing 70 mM MEPES, 90 mM glucose, and 20% (v / v) D2O, pH 7.4). The cell samples were then transferred to 3 mm Shigemi tubes and gently centrifuged to allow the cells to settle to the bottom of the tube. After the in-cell NMR experiments, the supernatant was collected to detect any protein leakage signals. Cells were then dissolved in 450 μL of NMR buffer, sonicated, and cell lysis samples were prepared.
[0054] All NMR experiments were conducted in environments equipped with 1 H / 13 C / 15The experiments were conducted on a 600 MHz NMR spectrometer using an N-type three-resonance cryogenic probe. The experimental conditions were: relaxation wait time d1 = 2 s, F1 dimension sampling points = 9088, sampling accumulation count = 1280, and temperature = 310 K. All NMR spectra were obtained by processing with Topspin 4.0.7 and Adobe Illustrate. Figure 4 ).
[0055] Example 5 NarX hum A46T and NarL hum - Obtaining VP64 stable cells Using lentivirus packaging, NarX-carrying viruses are packaged... hum A46T Expression vectors carrying NarL hum The expression vector for -VP64 was simultaneously transfected into CHO cells. 48-72 hours after transfection, selection was performed using antibiotics (10 μg / ml). Regular observation was conducted, with medium changes every 2-3 days for 2-3 weeks. Cells selected for transfection with p3.4-TCS-EGFP showed independent and efficient expression of EGFP in stably transfected cells; these selected cells are considered NarX cells. hum A46T and NarL hum -VP64 stable transgenic cells.
Claims
1. An expression system for mammalian proteins, characterized in that, This includes expression vectors that can stably express the two-component signal transduction system TCS in mammalian cells and vectors that can be induced by TCS to express target genes; The expression vectors for the stable expression of the two-component signal transduction system TCS include an expression vector for histidine kinase HK and an expression vector for the response regulatory protein RR. The expression vector for the histidine kinase HK contains the nucleotide sequence shown in SEQ ID NO.2; the expression vector for the response regulatory protein RR contains the nucleotide sequence shown in SEQ ID NO.
3.
2. The expression system according to claim 1, characterized in that, The vector capable of being induced to express the target gene by TCS includes a cis-acting element that regulates the expression of the target gene and the target gene inserted into a multiple cloning site downstream of the promoter. The cis-acting elements include: the binding site of the response regulatory protein RR, an inducible promoter, a multiple cloning site, an enhancer, and other optional elements such as introns and post-transcriptional regulatory elements.
3. The expression system according to claim 2, characterized in that, The backbone vector is pcDNA3.4, the inducible promoter is CMV53 promoter, and its nucleotide sequence is shown in SEQ ID NO.4; the nucleotide sequence of the binding site of the response regulatory protein RR is shown in SEQ ID NO.5; the multiple cloning site includes a Kozak sequence, multiple restriction enzyme sites and a transcription start codon, and its nucleotide sequence is shown in SEQ ID NO.
6.
4. The expression system according to claim 2, characterized in that, The 3' end of the Kozak sequence of the expression vector is linked to the gene sequence encoding the target protein.
5. A high-efficiency protein expression system for mammalian cells, characterized in that, The invention includes the expression system and host cell as described in any one of claims 1 to 4; the host cell is a mammalian cell; the expression system is used to express the corresponding protein by transfecting a stable expression vector of the two-component signal transduction system TCS and a vector capable of being induced by TCS to express the target gene into a mammalian cell.
6. The expression system according to claim 5, characterized in that, The mammalian cells include HEK239T or CHO cells.
7. The application of a protein sample suitable for structural biology research prepared based on the mammalian cell protein high-efficiency expression system according to any one of claims 5 or 6, characterized in that, The studies include X-ray crystallography, cryo-electron microscopy, or nuclear magnetic resonance.
8. The application according to claim 7, characterized in that, The proteins suitable for nuclear magnetic resonance (NMR) studies are selected by selectively labeling the target proteins, including... 19 F mark, 15 N-mark, 13 C labeling enables nuclear magnetic resonance detection of target proteins in situ within cells.
9. A mammalian cell protein high-efficiency expression system based on any one of claims 5 or 6, capable of being used for the production of human proteins in the biopharmaceutical field, characterized in that, The human-derived proteins include therapeutic proteins, drug-targeting proteins, and antibodies.