Method for preparing coding microspheres based on microarray chip and product and application thereof

By spraying coding sequences onto a microarray chip and preparing coding microspheres using molecular hybridization and PCR amplification techniques, the high cost and difficulty in mass production in existing technologies have been solved, achieving efficient and economical preparation of coding microspheres and supporting the widespread application of single-cell sequencing and spatial transcriptome sequencing technologies.

CN121294623APending Publication Date: 2026-01-09SOUTHEAST UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511472495.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-15
Publication Date
2026-01-09

AI Technical Summary

Technical Problem

Existing methods for preparing encoded microspheres are costly, difficult to prepare, and cannot be mass-produced, which limits the widespread application of single-cell sequencing and spatial transcriptome sequencing technologies.

Method used

The method for preparing encoded microspheres using microarray chips involves spraying the coding sequence onto a glass slide, fixing amplification primers onto the surface of gel microspheres, replicating the coding sequence on the chip onto the surface of the microspheres using molecular hybridization and extension techniques, and preparing complete encoded microspheres by bridging PCR amplification and excision of complementary strands.

Benefits of technology

This technology enables efficient and economical preparation of encoded microspheres, reduces costs, supports the widespread adoption of single-cell sequencing and spatial transcriptome sequencing technologies, and allows for reusable chips, thus reducing raw material consumption.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121294623A_ABST
    Figure CN121294623A_ABST
Patent Text Reader

Abstract

The invention discloses a method for preparing coding microspheres based on a microarray chip and a product and application thereof, and the method comprises the following steps: spraying a coding sequence to the surface of a glass slide to construct a coding microarray chip; arranging the gel microspheres fixed with the amplification primers on the surface of a coding microarray chip in a single layer, so that the microspheres are tightly combined with the surface of the chip; copying a coding sequence on the surface of the chip to the surface of the microsphere by using a molecular hybridization and extension technology; eluting the microspheres with the copied and transferred coding sequences from the surface of the chip, carrying out bridge type PCR amplification reaction, and copying a large amount of the coding sequences transferred from the surface of the chip until the whole microspheres are full of the coding sequences; and after amplification is completed, one complementary chain is cut off, so that the complete coding microspheres are obtained. The chip can be reused, the cost is obviously reduced, the operation is simple, convenient and flexible, and the mass production is high.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a method for preparing coded microspheres based on microarray chips, as well as the products and applications thereof, belonging to the field of biosequencing technology. Background Technology

[0002] In modern life science research, sequencing technologies such as single-cell sequencing and spatial transcriptomics play a crucial role. These technologies can reveal information such as gene expression and genome at the single-cell level, and are of irreplaceable value for a deeper understanding of cell function, development, and the mechanisms of disease occurrence and development. However, both single-cell sequencing and spatial transcriptomics sequencing rely on the encoding of cells, and the preparation of encoding microspheres is a key step in this process.

[0003] While commercially available coded microspheres exist, they suffer from significant drawbacks. These products cannot be obtained independently but are typically part of imported reagent kits, making them extremely expensive and severely limiting their widespread application in research and clinical settings. Literature reports also mention methods for preparing coded microspheres that claim to meet similar requirements. However, in practice, these methods face numerous challenges and are difficult to implement, hindering mass production.

[0004] Currently, single-cell sequencing typically requires around 10,000 cells to meet the requirements of experimental research. However, commercial methods like 10X sequencing are not only costly and uncontrollable, but more importantly, they are mostly based on random sequences with unknown coding sequences. Each experiment uses tens of thousands of microspheres, with a high repetition rate, and the number of probes on the surface of the microspheres is also unknown. Therefore, the capture efficiency of single-cell RNA cannot be controlled. Thus, developing a new, efficient, and economical method for preparing coding microspheres is of great practical significance for promoting the popularization and application of sequencing technologies such as single-cell sequencing and spatial transcriptomics. Summary of the Invention

[0005] Purpose of the invention: The technical problem to be solved by the present invention is to provide a method for preparing coded microspheres based on microarray chips, as well as the products and applications thereof. This method can effectively overcome the problems of high cost, difficulty in preparation and inability to mass-produce coded microspheres in the prior art, thereby promoting the widespread application of sequencing technologies such as single-cell sequencing and spatial transcriptomics.

[0006] Technical Solution: To solve the above technical problems, this invention provides a method for preparing coded microspheres based on microarray chips, comprising the following steps: (1) Spray the coding sequence onto the surface of the modified glass slide to construct a coding microarray chip. Each spot on the microarray (referring to the spot formed on the chip surface after the probe is spotted during the preparation of the microarray) contains multiple of the same coding sequence; (2) Mix the amplification primer pair with the gel microspheres to fix the amplification primer pair on the surface of the gel microspheres; wash the gel microspheres after fixing the primers to remove unbound primers and ensure that only an equal amount of amplification primer pairs are fixed on the surface of the gel microspheres; (4) Arrange the gel microspheres with the amplification primer pairs in a monolayer on the surface of the coded microarray chip described in step (1) so that the gel microspheres are tightly bound to the chip surface; use molecular hybridization and extension technology to copy the coding sequence on the chip surface to the microsphere surface; (5) The gel microspheres with the copied and transferred coding sequence are eluted from the chip surface and bridge PCR amplification reaction is performed to replicate the coding sequence transferred from the chip surface in large quantities until the entire gel microsphere is covered; after the amplification is completed, one complementary strand is removed to obtain the complete coding microsphere.

[0007] In step (1), the size of each spot point is consistent with the size of the microsphere.

[0008] In step (1), the solution sprayed is the coding probe solution. This solution contains all the sequences, which are a single, continuous sequence. Each coding sequence is presented separately in a test tube. The coding sequences do not need to be separated; they are identified through data analysis after subsequent sequencing experiments and do not require physical separation.

[0009] In step (1), the coding sequence usually has 8-12 bases, and different coding sequences can be distinguished from each other during sequencing; the coding sequence can be accurately read by sequencing without errors.

[0010] In step (1), the number of repeated samplings for each encoded sequence is 10. 3 above.

[0011] In step (1), the glass slide is modified with amino, carboxyl, aldehyde or avidin groups.

[0012] In step (2), the upstream primer nucleotide sequence of the amplification primer pair is as shown in SEQ ID NO.97, and the downstream primer nucleotide sequence and the coding sequence have more than 15 complementary bases at the 3' end.

[0013] In step (2), the sequence of the amplification primer pair is related to the sequencing platform. If the Illumina sequencing platform is used, the coding sequence will be linked to the sequencing primer sequence specific to that platform; while if BGI's sequencing platform is selected, it will be linked to its corresponding sequencing primer sequence.

[0014] In step (2), the diameter of the polyacrylamide gel microspheres is 20±20%~50±20% micrometers.

[0015] The bridge PCR amplification system described in step (4) includes PCR buffer, dNTP mix, high-fidelity DNA polymerase and water.

[0016] The present invention also provides a coded microsphere based on a microarray chip prepared by the method.

[0017] The coding sequence of the coded microspheres is copied from the microarray chip.

[0018] The coding sequence density on the surface of the coded microspheres is 10. 4 ~10 6 pcs / mm 2 .

[0019] The present invention also provides the application of the aforementioned microarray chip-based encoded microspheres in single-cell sequencing.

[0020] The specific method for encoding microspheres based on microarray chips is as follows: (1) Fabrication of the coded microarray: The coded microarray is fabricated on a glass or silicon-based planar chip using known methods, such as XY combination coding, or by chemical synthesis followed by spotting, or even direct synthesis on an electrochemical chip. During the fabrication process, it is necessary to ensure that the size of each spot on the microarray is consistent with the size of the microspheres to be fabricated subsequently, and that each spot contains multiple coding sequences of the same type. This step is the foundation of the entire fabrication method, as the spot on the coded microarray will provide a template for the coding of the subsequent microspheres.

[0021] (2) Gel microsphere preparation: Polyacrylamide or agarose gel can be used as raw materials to prepare gel microspheres. The size of the prepared gel microspheres is usually controlled between 20 and 50 micrometers. The key is to make them comparable to the size of the spot on the chip, while ensuring that the microspheres have a high degree of uniformity. High uniformity helps to improve the stability and accuracy of subsequent experiments.

[0022] (3) Primer immobilization: Two equal amounts of amplification primers are immobilized on the surface of the gel microspheres. These two amplification primers are mainly used for the amplification of subsequent coding primers. The immobilization process must ensure the activity of the primers and their uniform distribution on the surface of the microspheres, laying the foundation for the subsequent replication and amplification of the coding sequence.

[0023] (4) Coding sequence replication and transfer: Identical microspheres are arranged in a monolayer on the surface of the coding microarray chip. Specific techniques are used to ensure the microspheres are tightly bonded to the chip surface. Then, molecular hybridization and extension techniques are used to replicate the coding sequence from the chip surface to the microsphere surface. In this process, the step is considered successful if more than one coding sequence is successfully replicated to the microsphere surface. This step realizes the transfer of the coding sequence from the chip to the microspheres and is one of the key steps in the preparation of coding microspheres.

[0024] (5) Coding sequence amplification and microsphere formation: The microspheres containing the replicated and transferred coding sequence are eluted from the chip surface and mixed in a PCR tube. A bridge PCR amplification reaction system is added to the PCR tube to replicate the coding sequence transferred from the chip surface until it covers the entire microsphere. After amplification, one complementary strand is removed, resulting in a complete coding microsphere. At this point, the PCR tube contains thousands or even tens of thousands of distinct coding microspheres, which can be directly used for single-cell sequencing experiments.

[0025] In practical applications, adjustments and optimizations can be made according to specific needs and conditions. The coding microsphere preparation method of this invention enables the efficient and economical preparation of high-quality coding microspheres, providing strong support for the development of sequencing technologies such as single-cell sequencing and spatial transcriptomics.

[0026] Principle of this invention: Figure 4 As shown, the sequence on the microarray chip is copied to the microsphere using the in situ complementary hybridization extension method. The sequence is then amplified by bridge PCR amplification on the microsphere to meet the requirements of current single-cell sequencing and other related experiments.

[0027] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: 1. Chip Reuse: After simple cleaning, used coded microarray chips can be stored for short periods at 4°C or for long periods at -20°C, and can be reused repeatedly. One chip can be used to prepare hundreds of batches of coded microspheres, which greatly reduces the preparation cost of coded microspheres and also demonstrates the economic and environmental benefits of the method of this invention.

[0028] 2. Significantly Reduced Costs: By enabling the reuse of the coded microarray chip, the consumption of raw materials is greatly reduced, resulting in a significant decrease in the fabrication cost of the coded microspheres. Compared to existing coded microsphere fabrication methods, this invention is expected to substantially reduce the cost of single-cell sequencing, enabling single-cell sequencing technology to be more widely applied in life sciences, biomedicine, and other related research fields.

[0029] 3. Simple and flexible operation: The preparation method of this invention is relatively simple in terms of operation process, with close connection between each step and easy implementation. At the same time, this method is more flexible than existing coded microsphere preparation schemes and can better adapt to different experimental needs and conditions.

[0030] 4. Strong mass production capability: The entire preparation process can be scaled up, and the prepared coding microspheres can meet the needs of practical applications in terms of both quality and quantity. This solves the problem that existing methods cannot achieve mass production and provides strong support for the large-scale promotion of single-cell sequencing technology. Attached Figure Description

[0031] Figure 1 This is a typical quality control result for microarray fabrication; Figure 2 This is a typical quality control result for microarray fabrication; Figure 3 Characterization results of primers immobilized on the microsphere surface: A: Characterization results of F primers, B: Characterization results of R primers; Figure 4 The schematic diagram of the coding microarray chip structure is as follows: ① The prepared gel microspheres are laid on the coding microarray chip and tightly bound to the coding sequence on the chip; ② The universal sequence on the microspheres and the coding sequence on the chip are complementary and extended, resulting in a small amount of coding sequence on the microspheres; ③ The small amount of coding sequence is amplified by bridging PCR on the surface of the microspheres, resulting in a large amount of coding sequence on the surface of the microspheres; ④ The double-stranded coding sequence is converted into a single-stranded coding sequence by cleavage. Figure 5 The bar chart shows the decoding results of single-cell sequencing using the coding microspheres prepared in this invention. The lowest sequencing data obtained from different cells is 0.5%, the best is 2%, and most are in the range of 1%, which meets the standard of single-cell mixed sequencing. Figure 6 The results of cell type identification for decoded single cells can effectively distinguish subtypes such as neurons and cholinergic neurons in mouse brain tissue samples; Figure 7 The fluorescence signal characterization results are shown for the three repeated fabrications of coded microspheres using a microarray chip. A shows the fluorescence signal detection results of the coded microspheres, with the signals from the first, second, and third fabrications shown from left to right; B shows the histogram analysis results of the quantified coded microsphere signals. Detailed Implementation

[0032] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0033] (I) Fabrication of Encoded Microarrays 1. Slide Cleaning: First, thoroughly clean the slide with ordinary detergent; then clean the slide with a 1:1 methanol-hydrochloric acid solution (volume ratio) for 30 minutes, rinse with double-distilled water, and allow it to air dry at room temperature; next, soak it in sulfuric acid for 30 minutes, then rinse thoroughly with clean water. Finally, rinse thoroughly with 95% ethanol to remove residual acid from the surface, and allow it to air dry naturally.

[0034] 2. Surface Modification of Glass Slides: Taking silanization modification as an example, first, immerse the cleaned glass slide from step 1 in a silanization solution (a silanizing reagent prepared by mixing 95% ethanol and silane (APTES) at a ratio of 49:1) for 30 minutes. Then, wash with 95% ethanol and rinse with double-distilled water. Next, stand the slide upright and dry it from top to bottom using a bulb syringe or high-pressure nitrogen. Place the slide in an oven at 110°C for 30 minutes. Immerse the silanized slide in 95% ethanol and shake it for 5 minutes on a shaker. Then, wash it four times with double-distilled water, each time for half a minute, and dry it. Dilute the original 25% glutaraldehyde to 5% (i.e., dilute 20 mL of 25% glutaraldehyde to 100 mL) with a pH 7.0, 0.01 mol / L PB solution and immerse the silanized slide for 2 hours. Wash the slide with 0.01 mol / L PB solution to remove residual glutaraldehyde. Finally, wash 2-3 times with double-distilled water and dry with a bulb syringe or nitrogen gas. The slide can be used immediately or stored in a 4°C refrigerator for 7 days.

[0035] 3. Preparation of coding probes: Nucleotide sequences are synthesized using chemical synthesis methods. These sequences consist of three main parts: a polyA sequence (typically 18-30 polyadenylated nucleotides, in this example a 30-A sequence), whose purpose is to be converted into a corresponding polyT sequence after flipping and complementation onto microspheres for single-cell mRNA capture; the middle section is the coding sequence (underlined part), typically 8-12 nt, in this example an 8-nt DNA sequence; 96 different coding sequences are used as examples to illustrate the effectiveness of this invention; the third part is the library construction-related sequence, mainly used for sequencing primer sequences compatible with the sequencing platform. This example uses the Illumina sequencing platform. The 96 amino-modified coding sequences are shown in Table 1-10. Table 1: Encoding Sequences Used for Chip Fabrication

[0036] Table 2 Encoding Sequences for Chip Fabrication

[0037] Table 3 Encoding sequences used for chip fabrication

[0039] Table 4 Encoding Sequences for Chip Fabrication

[0040] Table 5 Encoding sequences used for chip fabrication

[0041] Table 6 Encoding Sequences for Chip Fabrication

[0042] Table 7 Encoding Sequences for Chip Fabrication

[0043] Table 8 Encoding Sequences for Chip Fabrication

[0044] Table 9 Encoding Sequences for Chip Fabrication

[0045] Table 10 Encoding Sequences for Chip Fabrication

[0046] The coding sequences prepared by the above chemical synthesis method were dissolved in carbonate buffer at pH 9.0 to a concentration of 50 μM and then sequentially partitioned into 384-well plates for later use.

[0047] 4. Microarray Preparation: Using a conventional commercial chip spotting instrument (in this example, the CrystalCore® SmartArrayer™ 136 microarray chip spotting system was used), the spray volume was adjusted to 10 nL and the spray spacing to 50 μm. Ninety-six coding sequences were sequentially spotted onto the modified glass slide surface. The spotted microarray chip was incubated in a 37°C hybridization chamber for 2 hours to allow the amino sequences to dehydrate and condense with the aldehyde groups on the chip surface, forming stable covalent bonds. After the reaction, the slide was washed and dried. The diameter of the dried coding sequence spots was approximately 50 μm (with an error of no more than 20%), consistent with the size of the coding microspheres prepared in subsequent experiments, i.e., 50 μm ± 20%.

[0048] 5. Quality Control of the Microarray Chip: Cy3-dUTP (Shanghai Beyotime Biotechnology Co., Ltd., D7332) was transferred to the 3' end of the probe sequence immobilized on the surface of the microarray chip using a terminal transferase reaction system (reaction system shown in Table 11). The reaction system was prepared according to the components in Table 2, mixed thoroughly, and then dropped onto the microarray surface prepared in step 4. A clean coverslip was gently placed over the mixture, and the reaction was carried out at 37°C for 1 hour. After the reaction, the microarray chip was gently rinsed three times with double-distilled water. Then, a commercial scanner (in this example, the LuxScan™ 10K microarray chip scanner) was used to scan the chip and observe the size, uniformity, and signal intensity of the immobilized spots in the coding sequence. Figure 1 The microarray chip has 96 complete fluorescent spots, corresponding to 96 coding sequences, with a signal-to-noise ratio greater than 3, and the size conforms to 50μm±20%. The size and intensity of the fluorescent spots are uniform and consistent, and they can all be used in subsequent preparation processes.

[0049] Table 11: Terminal transferase reaction system

[0050] (II) Preparation of Gel Microspheres Choose a suitable gelling material, such as polyacrylamide or agarose gel. Taking the preparation of polyacrylamide gel microspheres as an example, prepare reagents such as acrylamide, N,N'-methylenebisacrylamide, initiator (e.g., ammonium persulfate), and catalyst (e.g., tetramethylethylenediamine (TEMED)) (the gel microsphere polymerization reaction system is shown in Table 12). Initiate the polymerization reaction rapidly at room temperature to ensure the uniformity and controllability of microsphere formation.

[0051] Table 12: Gel microsphere polymerization reaction system

[0052] Then, the reaction system prepared according to Table 3 was used as the aqueous phase (10 μL of TEMED was added before mixing with the oil phase), and the emulsifier (mineral oil, EM90, and Triton X-100 mixed evenly in a volume ratio of 96:3:1) was used as the oil phase. The mixture was then combined with the aqueous phase at a volume ratio of 1:3. The mixture was shaken at 1400 rpm for 40 seconds on a vortex mixer and allowed to stand for 10 minutes to complete the preparation of gel microspheres. After the microspheres had completely solidified, they were centrifuged at 500 rpm to precipitate the microspheres. The precipitate was then washed three times repeatedly with 1×PBS buffer (pH 7.4). The prepared microspheres were collected, and their size and uniformity were examined under a microscope. Microspheres with a size of approximately 50 μm and uniformity were suitable for subsequent preparations. A typical microscopic quality inspection image of the gel microspheres is shown below. Figure 2 As shown.

[0053] (III) Immobilization of amplification primers on the surface of microspheres Prepare amino-modified upstream and downstream primers (F: NH2-TTTTTTIIITTTTTTTTTTTTTTTTTTTT (SEQ ID NO. 97), R: NH2- GTGACTGGAGTTCAGACGTGTG (SEQ ID NO. 98)), dilute to 50 μM with double-distilled water, mix equal volumes of the two primers, and immobilize them on the surface of gel microspheres according to the following steps. Prepare 0.2 M MES buffer (pH=6), wash the polyacrylamide microspheres twice in it, and then resuspend them in 0.2 M MES buffer. Prepare a 50 mg / mL solution of 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC), mix it with the mixed primers at a 5:3 volume ratio, and then add the mixture to suspended gel microspheres. Incubate at 28°C in a hybridization chamber for 3 hours by rotation. After the reaction, wash twice with PBS and resuspend in an appropriate volume of preservation buffer (50 mL buffer containing 100 μL Tris-HCl buffer (1 M, pH 8.0), 500 μL EDTA (0.5 M, pH 8.0), and 500 μL 10% (vol / vol) Tween-20). In primer F, I represents hypoxanthine nucleotide, used for cleavage and removal of the complementary strand after amplification.

[0054] The complementary sequences of the upstream and downstream primers labeled with Cy3 were synthesized as follows: F: 5'-Cy3-AAAAAAAAAAAAAAA-3' (SEQ ID NO. 99) and R: 5'-Cy3-CACACGTCTGAACTCCAG-3' (SEQ ID NO. 100). The primers immobilized on the microsphere surface were characterized using complementary hybridization, and the results are as follows: Figure 3 As shown, the hybridization signals of the two primers are comparable, and statistical analysis shows no significant difference, so they can be used for subsequent preparation.

[0055] (iv) Coding sequence replication and transfer Remove the prepared microspheres and microarray chip. Depending on the density of the microarray chip, wash and dilute the microspheres with PBS buffer. In this example, the concentration used is 20 microspheres / μL, ensuring the number of microspheres is approximately three times the number of microarray spots. In this example, the chip has 96 array spots, so 15-20 μL of microspheres (300-400 microspheres) are added. Define the microarray chip area using a hybridization frame (a square silicone ring). Drop 15 μL of diluted microspheres into the hybridization frame of the microarray chip, allowing them to settle naturally while simultaneously assisting sedimentation at 500 rpm. Use filter paper to absorb the buffer solution from the chip surface, ensuring the microspheres are arranged in a single layer on the microarray surface and in full contact with the surface, with no overlap between the microspheres.

[0056] Prepare a 100 μL Klenow enzyme extension reaction system (Table 13) and add it dropwise into the hybridization frame of the microarray chip coated with microspheres. Cover with a coverslip and incubate at 37°C for 1 hour. This allows the polyA sequence on the microsphere surface to complement and extend the polyT sequence on the chip, synthesizing a complete coding sequence on the microsphere surface. After the reaction, place the chip at 70°C for 5 minutes, remove the coverslip, remove the hybridization frame, carefully collect the microspheres, and wash with double-distilled water for later use. The microarray chip can also be reused after washing with double-distilled water, or stored at -20°C for up to 3 months.

[0057] Table 13: Klenow enzyme extension reaction system

[0058] (V) Coding sequence amplification and microsphere molding Collect the eluted microspheres into PCR tubes, and add the bridge PCR amplification reaction system shown in Table 14, including PCR buffer, dNTPs, DNA polymerase and other reagents.

[0059] Table 14: Bridged PCR reaction system on microsphere surface

[0060] Place the PCR tube into the PCR instrument and perform the amplification reaction according to the preset program. The amplification program includes pre-denaturation, denaturation, annealing, and extension steps, which are repeated multiple times to ensure that the coding sequence is replicated extensively on the surface of the microspheres. For example, the pre-denaturation temperature is 98℃ for 2 minutes; the denaturation temperature is 98℃ for 10 seconds; the annealing temperature is 62℃ for 30 seconds; the extension temperature is 72℃ for 30 seconds, for a total of 40 cycles. The final extension at 72℃ takes 8 minutes, and the tube is then incubated at 4℃ until the end of the cycle.

[0061] After the amplification reaction is complete, add the endonuclease V reaction system (Table 15) to the PCR tube to remove the coding sequence containing polyT, and obtain complete single-stranded coding microspheres, which can be directly used for single-cell capture and other related applications.

[0062] Table 15: Endonuclease V digestion reaction system

[0063] The prepared coded microspheres underwent quality testing, including further testing under a microscope and scanner. Only microspheres with accurate sequences, uniform amplification, and intact structure were used for single-cell sequencing experiments. After passing quality control, the microspheres were stored in 50 μL of 1×PBS buffer for later use.

[0064] (vi) Encoding microspheres for single-cell sequencing and analysis SPF-grade C57BL / 6 mice aged 8-10 weeks were sacrificed by cervical dislocation, and intact brain tissue was carefully extracted. The brain tissue was then washed with PBS, cut into 1-2 mm² pieces, and digested in 0.25% trypsin-EDTA solution (containing 40 μg / μL DNase I) (ThermoFisher, 25200056) at 37°C for 20 minutes. After the reaction, fetal bovine serum culture medium (Gibco, C0235) was added to terminate the digestion, and the cells were filtered through a 100 μm filter into new centrifuge tubes. After quality control calculations, 100 μL of cell suspension (containing approximately 10 μg / μL DNase I) was collected. 6 Mix 10 cells with 50 μL of the previously prepared coded microspheres and stir at low speed at 4 °C for 30 minutes to ensure that the cells and microspheres are fully combined.

[0065] Next, 30 μL of single-cell lysis buffer (containing 50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1% NP-40 (ethyl phenyl polyethylene glycol), and 0.1% sodium dodecyl sulfate) was added, and the mixture was incubated at room temperature for 5–10 minutes to allow for efficient capture of cellular RNA by the probes on the microspheres. Subsequently, the microspheres were centrifuged at 500 g for 5 minutes to collect the RNA-rich microspheres. The RNA microspheres were then washed with PBS washing buffer (containing 40 U / μL RNA inhibitor).

[0066] The processed microspheres were transferred to new clean PCR tubes, and a pre-prepared reverse transcription reaction system (containing 5×RT Buffer, 200 U reverse transcriptase, 50% PEG8000, 5 U RNase inhibitor, and 10 mM dNTPs) was added. The tubes were incubated at 42°C for 60–90 minutes to synthesize cDNA. Subsequently, the synthesized cDNA containing coding information was heated at 95°C for 5 minutes to detach it from the microspheres, and then centrifuged at 500g for 5 minutes to collect the cDNA-rich supernatant. Using this supernatant as a template, a transcriptome sequencing library was constructed and quality-controlled according to standard methods. Finally, the qualified library was submitted to an Illumina NovaSeq 6000 high-throughput sequencer for sequencing analysis.

[0067] After sequencing is completed and raw sequencing data is obtained, subsequent analyses such as barcode recognition and cell analysis are performed. The data breakdown ratios for different codes corresponding to different cells are shown. For example... Figure 5As shown, in mixed sequencing of 100 cells, the lowest concentration was 0.5%, the highest was 2.0%, and the vast majority were around 1%, achieving a good balance standard for single-cell mixed sequencing. In cell type analysis, the transcriptome data was processed using single-sample gene set enrichment analysis (ssGSEA), and the enrichment scores for different cell types were visualized, as shown below. Figure 6 As shown, it can effectively distinguish subtypes such as neurons and cholinergic neurons in mouse brain tissue samples.

[0068] (vii) Chip reuse Used coded microarray chips were washed with PBS buffer to remove residual microspheres, reagents, and impurities from the chip surface. The cleaned chips can be stored briefly at 4°C or long-term at -20°C.

[0069] Quality control was performed on reusable chips, including testing for the uniformity of spot size and the number of surface probes. Only chips that passed quality control could be used again for the preparation of coded microspheres. Quality control of the number of surface probes on the chips was performed as follows: the washed chips underwent terminal transferase reaction, followed by fluorescence microscopy to observe and determine probe detachment. A signal-to-noise ratio exceeding 3 was sufficient for the next batch of coded microspheres to be prepared. To further determine the chip reuse potential, coded microspheres were prepared three times using the same coded array chip. The quality control fluorescence signals of the coded microspheres were compared, and the fluorescence signal detection results are shown below. Figure 7 As shown, the results indicate that the signal from each microsphere is attenuated to some extent, but it can still achieve the purpose of single-cell binding and can be well used for single-cell sequencing.

Claims

1. A method for preparing coded microspheres based on a microarray chip, characterized in that, Includes the following steps: (1) The coding sequence is sprayed onto the surface of the glass slide to construct a coding microarray chip. Each spot on the microarray contains multiple of the same coding sequence. (2) Mix the amplification primer pairs with polyacrylamide gel microspheres to fix the amplification primer pairs on the surface of the gel microspheres; wash the gel microspheres with the amplification primer pairs fixed to remove unbound primers to ensure that only an equal amount of amplification primer pairs are fixed on the surface of the gel microspheres. (3) Arrange the gel microspheres with the amplification primer pairs in a monolayer on the surface of the coding microarray chip described in step (1) so that the gel microspheres are tightly bound to the chip surface; use molecular hybridization and extension technology to copy the coding sequence on the chip surface to the surface of the gel microspheres. (4) The gel microspheres containing the copied and transferred coding sequence are eluted from the chip surface and subjected to bridge PCR amplification reaction to replicate the coding sequence transferred from the chip surface in large quantities until the entire gel microsphere is covered. After amplification, one of the complementary strands is removed, thus obtaining the complete coding microsphere.

2. The method according to claim 1, characterized in that, The number of repeated samplings for each encoded sequence in step (1) is 10. 3 above.

3. The method according to claim 1, characterized in that, The glass slides described in step (1) are modified with amino, carboxyl, aldehyde or avidin groups.

4. The method according to claim 1, characterized in that, The upstream primer nucleotide sequence of the amplification primer pair described in step (2) is as shown in SEQ ID NO.97, and the downstream primer nucleotide sequence is complementary to the 3' end of the coding sequence described in step (1) by more than 15 bases.

5. The method according to claim 1, characterized in that, The diameter of the polyacrylamide gel microspheres mentioned in step (2) is 20±20%~50±20% micrometers.

6. The method according to claim 1, characterized in that, The bridge PCR amplification system described in step (4) includes PCR buffer, dNTP mix, high-fidelity DNA polymerase and water.

7. A coded microsphere based on a microarray chip, prepared by the method of any one of claims 1-6.

8. The coded microsphere based on a microarray chip according to claim 7, characterized in that, The coding sequence of the coded microspheres is copied from the microarray chip.

9. The coded microsphere based on a microarray chip according to claim 7, characterized in that, The coding sequence density on the surface of the coded microspheres is 10. 4 ~10 6 pcs / mm 2 .

10. The application of the coding microspheres based on microarray chips as described in any one of claims 7 to 9 in single-cell sequencing.