Sensitive skin care composition for soothing nerves and preparation method thereof

Abstract

The invention relates to the technical field of cosmetics, in particular to a sensitive skin care composition for soothing nerves and a preparation method thereof. According to the sensitive skin care composition capable of soothing the nerves, provided by the invention, the acetyl zingerone clathrate compound, the strawberry fruit extract and the 4-tert-butyl cyclohexanol are compounded, and through the dual-channel synergistic effect of transient inhibition of neural signals and long-acting repair of a cell microenvironment, the synergy of immediate soothing and long-term barrier repair is realized; the vicious circle of sensitive skin is effectively blocked.

Description

Technical Field

[0001] This invention relates to the technical field of skincare products, specifically to a nerve-soothing skincare composition for sensitive skin and its preparation method. Background Technology

[0002] Sensitive skin refers to a hyperreactive state of the skin under physiological or pathological conditions, primarily affecting the face. It manifests as subjective symptoms such as burning, stinging, itching, and tightness when stimulated by physical, chemical, or psychological factors, with or without objective signs such as erythema, scaling, and telangiectasia. The causes of sensitive skin are complex, including impaired skin barrier function, epidermal inflammation, and abnormalities in the skin's sensory nervous system.

[0003] Current solutions for sensitive skin problems often employ ingredients with a single mechanism of action, such as using 4-tert-butylcyclohexanol or acetyl gingerone to block transient receptor potential vanillic acid subtype 1 (TRPV1) to quickly relieve stinging, or using anti-inflammatory ingredients such as asiaticoside to suppress inflammation long-term. However, these strategies have significant limitations: while neuroreceptor antagonists can provide immediate relief, they cannot address the root cause of neuroreactivity—chronic inflammation and the oxidative stress microenvironment; and traditional anti-inflammatory ingredients are slow to take effect on acute symptoms, failing to meet users' needs for immediate repair.

[0004] Sensitive skin is essentially a vicious cycle of exacerbated neurological dysfunction, barrier damage, and immune inflammation, which cannot be addressed by a single ingredient targeting multiple points. Therefore, there is an urgent need to research a skincare composition suitable for sensitive skin, constructing a multi-layered mechanism of action to achieve immediate soothing and long-term barrier repair, effectively breaking the vicious cycle of sensitive skin. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art by providing a nerve-soothing skin care composition for sensitive skin and its preparation method. By combining transient nerve regulation, long-lasting microenvironment repair and barrier strengthening ingredients to form a synergistic effect, it aims to overcome the shortcomings of the prior art.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows: In a first aspect, the present invention provides a nerve-soothing skin care composition for sensitive skin, comprising the following components: acetyl gingerone inclusion complex, strawberry fruit extract and 4-tert-butylcyclohexanol, wherein the weight ratio of the acetyl gingerone inclusion complex, strawberry fruit extract and 4-tert-butylcyclohexanol is (0.01-1):(0.1-3):(0.01-2).

[0007] Preferably, the acetyl gingerone inclusion complex is composed of β-cyclodextrin, and its preparation method includes the following steps: (1) Dissolve β-cyclodextrin in deionized water at 60-70℃ to prepare a β-cyclodextrin aqueous solution with a mass fraction of 12-15%, cool it to 50-60℃, and keep it warm for later use; (2) Dissolve acetyl gingerone in anhydrous ethanol to prepare an acetyl gingerone ethanol solution with a mass fraction of 1-5%; (3) The acetyl gingerone ethanol solution was slowly added dropwise to the β-cyclodextrin aqueous solution at 50-60℃ and 500-1000 rpm. The reaction was continued to be stirred at 50-60℃ and 400-600 rpm for 6-12 h. After cooling to room temperature, the mixture was placed in a refrigerator at 4℃ for 8-12 h. The mixture was filtered using a 0.45 μm filter membrane to collect the white or off-white precipitate. The precipitate was washed with cold water and dried under vacuum at 40-50℃ for 36-48 h to obtain the acetyl gingerone inclusion complex.

[0008] The preparation method of the acetyl gingerone inclusion complex yields a solid powder with a microstructure in which acetyl gingerone molecules are embedded within the hydrophobic cavities of β-cyclodextrin. This preparation method solves the instability problem of acetyl gingerone itself in formulations, characterized by volatility and degradation, ensuring the retention rate of active ingredients from raw material storage to the final product. More importantly, the β-cyclodextrin encapsulation makes acetyl gingerone water-soluble, providing a slow and controllable release process upon skin contact. This allows acetyl gingerone to continuously act on TRPV1 receptors on sensory neurons, achieving not only rapid and immediate relief but also prolonging its effect of blocking calcium ion influx and inhibiting pain signal transmission. Simultaneously, this stable release characteristic ensures its long-term effects in regulating neurogenic inflammation and reducing the release of neuropeptides such as substance P and CGRP, thereby more effectively controlling the source of neurosensitivity at the molecular level.

[0009] Preferably, the method for preparing the strawberry fruit extract includes the following steps: S1. Dissolve hydroxypropyl-β-cyclodextrin in deionized water at 60-70℃ to prepare a hydroxypropyl-β-cyclodextrin aqueous solution with a mass fraction of 10-15%, cool it to 45-55℃, and keep it warm for later use. S2. Mix freeze-dried strawberry fruit powder with hydroxypropyl-β-cyclodextrin aqueous solution at a material-to-liquid ratio of 1g:15-20mL and then perform microwave-assisted extraction. The microwave power is 500-800W, the extraction temperature is 40-60℃, and the extraction time is 10-20min. S3. After extraction, cool to room temperature, centrifuge at 800-1200 rpm for 8-10 min, separate and discard the solid residue, and collect the supernatant rich in hydroxypropyl-β-cyclodextrin / active ingredient inclusion complex.

[0010] The method for preparing the strawberry fruit extract involves using hydroxypropyl-β-cyclodextrin, which forms a soluble inclusion complex with the main active ingredient, fisetin. This method offers several advantages: firstly, it significantly improves the apparent solubility of hydrophobic fisetin in the extract and the final formulation, overcoming the core bottleneck of low bioavailability due to poor solubility; secondly, the inclusion complex of cyclodextrin protects the heat-sensitive fisetin molecules, preventing potential degradation due to microwave high temperatures. Therefore, the final extract can more fully realize its multi-pathway anti-inflammatory and antioxidant potential. Specifically, it activates the Nrf2 pathway to scavenge reactive oxygen species closely related to neuroinflammation and effectively inhibits the NF-κB pathway to downregulate the expression of key pro-inflammatory factors such as TNF-α and IL-6, thereby creating a microenvironment with lower oxidative stress and weaker inflammatory signals for sensory neurons, fundamentally reducing the excitability of nerve endings.

[0011] Acetyl gingerone is a compound derived from ginger (a plant in the ginger family). Zingiber officinale The natural active ingredient from the rhizome of Roscoe can be obtained through organic solvent extraction combined with column chromatography. This ingredient, as a highly effective antagonist of transient receptor potential vanillic acid subtype 1 (TRPV1), can specifically block calcium ion channels activated by heat and chemical stimuli, such as capsaicin, thereby rapidly inhibiting the transmission of pain signals to the central nervous system. It can instantly soothe the burning and stinging sensations of sensitive skin, and simultaneously reduce the release of neuropeptides such as substance P and calcitonin gene-related peptide by regulating neurogenic inflammatory pathways, thus alleviating vasodilation and inflammatory responses from a neuroimmunological perspective.

[0012] The main active ingredient in strawberry fruit extract is fisetin, a naturally occurring flavonol compound. Fisetin possesses multidimensional biological activities: First, it can enhance cellular antioxidant defense capabilities by activating the Nrf2-ARE signaling pathway, reducing the damage to the skin barrier caused by reactive oxygen species accumulation; second, this component can specifically inhibit the activation of the NF-κB inflammatory pathway, reducing the expression of pro-inflammatory factors such as tumor necrosis factor-α and interleukin-6; third, studies have confirmed its significant anti-aging activity, selectively clearing senescent cells and reducing the damage to surrounding tissues caused by the aging-associated secretory phenotype (SASP).

[0013] 4-Tert-butylcyclohexanol is a synthetic organic compound prepared by Friedel-Crafts alkylation of cyclohexanol and tert-butyl halides in the presence of an acidic catalyst. This ingredient exhibits significant immediate soothing effects in sensitive skin care. Its mechanism of action differs from traditional neurotransmitter antagonists; instead, it stabilizes overexcited sensory neurons by regulating the fluidity of the lipid bilayer of neuronal cell membranes, thereby rapidly reducing skin sensitivity to external stimuli (such as lactic acid and heat). Clinical trials show that using skincare products containing this ingredient can significantly improve subjective discomfort such as stinging and itching. Its molecular structure also gives it good skin permeability and makes it less likely to cause irritation. When combined with plant extracts, it effectively compensates for the slower onset of action of natural ingredients, creating favorable conditions for subsequent long-lasting repair ingredients to function.

[0014] More preferably, the weight ratio of the acetyl gingerone inclusion complex, strawberry fruit extract and 4-tert-butylcyclohexanol is (0.1-0.5):(1-2):(0.5-1.5).

[0015] More preferably, the weight ratio of the acetyl gingerone inclusion complex, strawberry fruit extract and 4-tert-butylcyclohexanol is 0.2:1.5:1.

[0016] A second aspect of the present invention provides the use of the sensitive skin skincare composition containing the acetyl gingerone inclusion complex described in the first aspect in the preparation of skincare products.

[0017] Preferably, the skin care product is at least one of toner, lotion, cream, mask, serum or spray.

[0018] Preferably, the sensitive skin skincare composition is added in an amount of 0.5%-3% of the total weight of the skincare product.

[0019] In a third aspect, the present invention provides an emulsion comprising the following ingredients by weight percentage: 0.5%-3% of the sensitive skin care composition described in the first aspect, 0.05%-0.3% of a thickener, 0.5%-10% of a moisturizer, 1%-5% of an emulsifier, 1%-10% of an oil, 0.5%-5% of a preservative, and a suitable amount of a pH adjuster, with the balance being deionized water.

[0020] Preferably, the thickener includes at least one of xanthan gum, carbomer, hydroxyethyl acrylate / sodium acryloyldimethyl taurate copolymer, ammonium acryloyldimethyl taurate / VP copolymer, and sclerotium gum.

[0021] Preferably, the moisturizer comprises at least one of allantoin, betaine, β-glucan, trehalose, caprylyl glycol, dipropylene glycol, sodium hyaluronate, 1,3-butanediol, glycerin, D-panthenol, and ceramide.

[0022] Preferably, the emulsifier comprises at least one of C14-22 alcohol, C12-20 alkyl glucoside, cetearyl glucoside, and sucrose stearate.

[0023] The oil includes at least one of the following: caprylic / capric triglyceride, isononyl isononanoate, pentaerythritol tetraester, polydimethylsiloxane, stearyl alcohol, hydroxystearic acid, polymethylsilsesquioxane, and pentaerythritol distearate.

[0024] Preferably, the preservative includes at least one of 1,3-propanediol, 1,2-hexanediol, and p-hydroxyacetophenone.

[0025] Preferably, the pH adjuster includes at least one of arginine and tromethamine.

[0026] A fourth aspect of the present invention provides a method for preparing the emulsion described in the third aspect, comprising the following steps: A1. Mix the humectant, thickener and deionized water, heat to 85°C, homogenize at 13000 rpm for 4 min to obtain pre-prepared component A, and keep warm for later use. A2. Mix the emulsifier and oil, heat to 85°C to form a homogeneous liquid, and obtain the pre-prepared component B. Keep it warm for later use. A3. Mix the preservatives and heat to 60°C to melt them, to obtain pre-prepared component C; A4. At 80℃ and 13000rpm, add pre-prepared component A to pre-prepared component B and homogenize for 4 min. Then, cool down to 60℃ and add pre-prepared component C while stirring at 250 rpm. Continue stirring for 10-15 min. Then, cool down to 40℃, add the sensitive skin care composition and stir for 8 min. Finally, add the remaining pH adjuster to adjust the pH to 6.0, then stop stirring, discharge the product, and obtain the emulsion.

[0027] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention provides a nerve-soothing skincare composition for sensitive skin, which constructs a multi-layered mechanism of action by incorporating acetyl gingerone inclusion complex, strawberry fruit extract, and 4-tert-butylcyclohexanol. First, 4-tert-butylcyclohexanol and the acetyl gingerone inclusion complex can block pain signal transmission within minutes by inhibiting TRPV1 receptors and regulating calcium ion channels, respectively, rapidly relieving burning and stinging. Second, fisetin in strawberry fruit extract reduces the release of inflammatory mediators at the source by clearing senescent cells, inhibiting the NF-κB pathway, and activating the Nrf2 antioxidant pathway, repairing the microenvironment surrounding nerves. Furthermore, the neuroprotective properties of fisetin can further stabilize sensory neurons and reduce their excitability. Finally, all ingredients are derived from natural sources, ensuring the safety and gentleness of the formula. The combination of these three ingredients achieves synergistic effects of immediate soothing and long-term barrier repair, effectively breaking the vicious cycle of sensitive skin. Attached Figure Description

[0028] Figure 1 The image shows a transmission electron microscope (TEM) image of the acetyl gingerone inclusion complex prepared in the specific embodiment. Figure 2 The images show the improvement in facial erythema in volunteers using the lotion for 0 days and 28 days in Test Example 3, comparing the effects of the lotion on volunteers using Example 1 and the blank application example. Detailed Implementation

[0029] To better illustrate the purpose, technical solution, and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0030] The sources of the raw materials used in the following examples and comparative examples are as follows: Acetyl gingerone was purchased from Sytheon under the trade name Synoxyl ® AZ; β-Cyclodextrin was purchased from Solarbio, product number C8511; The strawberry powder was purchased from Xi'an Tianguangyuan Biotechnology Co., Ltd., and its product name is freeze-dried strawberry powder. tert-Butylcyclohexanol was purchased from Symrise (Shanghai) Co., Ltd., under the trade name SymSitive. ® 1609; The commercially available strawberry fruit extract was purchased from Anhui Bensentang Biotechnology Co., Ltd., and its product name is Strawberry Extract.

[0031] Unless otherwise specified, all other materials and reagents used in the examples are commercially available.

[0032] Acetyl gingerone inclusion complex Its preparation method includes the following steps: (1) Dissolve β-cyclodextrin in deionized water at 65°C to prepare a β-cyclodextrin aqueous solution with a mass fraction of 13%, cool it to 55°C, and keep it warm for later use; (2) Dissolve acetyl gingerone in anhydrous ethanol to prepare a 3% acetyl gingerone ethanol solution; (3) The acetyl gingerone ethanol solution was slowly added dropwise to the β-cyclodextrin aqueous solution at 55℃ and 800 rpm. The reaction was continued with stirring at 55℃ and 500 rpm for 8 h. After cooling to room temperature, the mixture was refrigerated at 4℃ for 12 h. The mixture was then filtered using a 0.45 μm filter membrane, and the white precipitate was collected. The precipitate was washed with cold water and dried under vacuum at 45℃ for 48 h. After sieving, the acetyl gingerone inclusion complex was obtained (e.g., ...). Figure 1 (As shown).

[0033] Strawberry fruit extract Its preparation method includes the following steps: S1. Dissolve hydroxypropyl-β-cyclodextrin in deionized water at 65°C to prepare a 12% (w / w) aqueous solution of hydroxypropyl-β-cyclodextrin, cool it to 50°C, and keep it warm for later use. S2. The freeze-dried strawberry fruit powder was mixed with the above-mentioned hydroxypropyl-β-cyclodextrin aqueous solution at a material-liquid ratio of 1g:18mL and then subjected to microwave-assisted extraction. The microwave power was 650W, the extraction temperature was 50℃, and the extraction time was 15min. S3. After extraction, cool to room temperature, centrifuge at 1000 rpm for 10 min, separate and discard the solid residue, and collect the supernatant rich in hydroxypropyl-β-cyclodextrin / fisetin inclusion complex to obtain the strawberry fruit extract.

[0034] The component composition (parts by weight) of the sensitive skin care compositions of Examples 1-5 and Comparative Examples 1-6 in this invention is shown in Table 1 below. Each component was weighed according to the formula amount, mixed and homogenized to obtain each composition.

[0035] Table 1. Components and their weight parts of the compositions in Examples 1-5 Group Acetyl gingerone inclusion complex (parts by weight) Strawberry fruit extract (parts by weight) 4-tert-butylcyclohexanol (parts by weight) Example 1 0.2 1.5 1 Example 2 0.1 1 1.5 Example 3 0.5 2 0.5 Example 4 0.01 0.1 0.01 Example 5 1 3 2 Comparative Example 1 The difference between Comparative Example 1 and Example 1 is that Comparative Example 1 does not add acetyl gingerone inclusion complex, and uses strawberry fruit extract and 4-tert-butylcyclohexanol in a weight ratio of 1.5:1 to make up for the missing amount.

[0036] Comparative Example 2 The difference between Comparative Example 2 and Example 1 is that: no strawberry fruit extract was added in Comparative Example 2, and the missing amount was made up by acetyl gingerone inclusion complex and 4-tert-butylcyclohexanol with a weight ratio of 0.2:1.

[0037] Comparative Example 3 The difference between Comparative Example 3 and Example 1 is that 4-tert-butylcyclohexanol was not added in Comparative Example 3, and the missing amount was made up by acetyl gingerone inclusion complex and strawberry fruit extract with a weight ratio of 0.2:1.5.

[0038] Comparative Example 4 The difference between Comparative Example 4 and Example 1 is that an equal amount of acetylshogaol was used to replace the acetylshogaol inclusion complex in Comparative Example 4.

[0039] Comparative Example 5 The difference between Comparative Example 5 and Example 1 is that an equal amount of commercially available strawberry fruit extract was used to replace the strawberry fruit extract in Comparative Example 5. The preparation method of the commercially available strawberry fruit extract is as follows: freeze-dry and pulverize strawberries purchased from the market, pass them through an 80-mesh sieve, and add them to a 70% ethanol aqueous solution at a material-to-liquid ratio of 1 g: 20 mL. Ultrasonic extraction is performed at a temperature of 60℃, a power of 500W, and a time of 60 min. After extraction, centrifuge the solution, collect the supernatant, concentrate and dry it to obtain the commercially available strawberry fruit extract.

[0040] Comparative Example 6 The difference between Comparative Example 6 and Example 1 is that Comparative Example 6 uses acetyl gingerone inclusion complex, strawberry fruit extract and 4-tert-butylcyclohexanol in a weight ratio of 1.5:0.2:1.

[0041] The total weight of each component in the sensitive skin skincare compositions of Examples 1-5 and Comparative Examples 1-6 above is the same.

[0042] Test Example 1: TRPV1 Inhibition Test of the Composition Activation of the TRPV1 capsaicin receptor in sensitive skin leads to neurosensory signals such as stinging, burning, and itching. By detecting the inhibitory ability of a composition on TRPV1 receptor activation, the strength of its efficacy in "shutting down" this oversensitive alarm and blocking the transmission of uncomfortable nerve signals can be directly reflected. This effect study investigates the inhibitory effect of the sensitive skin care compositions prepared in Examples 1-5 and Comparative Examples 1-6 on the TRPV1 neural pathway.

[0043] Preparation of culture medium for sample groups: The sensitive skin care compositions prepared in Examples 1-5 and Comparative Examples 1-6 were first dissolved in 10 times their mass of dimethyl sulfoxide, and then added to cell DMEM culture medium to dilute to 1% v / v of the composition in DMEM culture medium. The test conditions were: incubator temperature 37±1℃, humidity 90±5%, carbon dioxide 5±1%; Experimental steps: (1) Human keratinocyte HaCaT suspension (Beina Biotechnology) was seeded into a 96-well cell culture plate at a density of 2000 cells / well. 100 μL of DMEM culture medium was added to each well and cultured for 24 h. (2) Discard the supernatant. The blank group was given 100 μL of DMEM medium, the control group was given 100 μL of DMEM medium containing 20 μg / mL capsaicin (2105341, Gibco), and the sample group was given DMEM medium containing 20 μg / mL capsaicin and a 1% v / v combination. After incubation for 24 h, the cells were collected. (3) Total RNA was extracted from cells using TRIzol reagent, and cDNA was synthesized using the PrimeScript RT reverse transcription kit. Relative quantitative analysis of mRNA expression was then performed using a CFX96 Touch Real-Time PCR detection system (Bio-Rad, Hercules, CA, USA). The PCR conditions were: initial denaturation at 95℃ for 5 min, followed by 40 cycles, each cycle consisting of 95℃ denaturation for 15 s, 60℃ annealing for 30 s, and 72℃ extension for 30 s. After normalization to GAPDH transcript levels, cDNA was analyzed using 2... -ΔΔCt The relative cDNA expression level was calculated using the following method; primer sequences are shown in Table 2. (4) The gene expression inhibition rate of the thermal pain receptor TRPV1 was calculated according to the following formula. The lower the expression level of the thermal pain receptor TRPV1 in each group, the stronger the nerve-soothing effect of the corresponding composition product. The experiment was repeated three times according to the parallel design principle. The experimental data are presented as average values. The test results are shown in Table 3. TRPV1 gene expression inhibition rate (%) = [(relative cDNA expression level of control group - relative cDNA expression level of sample group) / (relative cDNA expression level of control group - relative cDNA expression level of blank group)] × 100%; Table 2 Primer Sequences Gene Primer sequence (5'→3') TRPV1-F CTGGACCTGGTCAACCTCAT TRPV1-R GATGGGGATCTTGGTGTCAG GAPDH-F GAGTCAACGGATTTGGTCGT GAPDH-R TTGATTTTGGAGGGATCTCG Test Example 2: Neuroinflammation Inhibition Test of the Composition Substance P and CGRP are core mediators of skin vasodilation, inflammatory cell infiltration, and sensitivity symptoms. By detecting the inhibitory effect of the composition on substance P and calcitonin gene-related peptide (CGRP), the efficacy of the product in inhibiting neuroinflammation can be accurately reflected at the molecular level. This experiment directly evaluates the inhibitory effect of the sensitive skin care compositions prepared in Examples 1-5 and Comparative Examples 1-6 on the neuropeptides substance P and CGRP in the rat adrenal pheochromocytoma cell line PC12 by simulating the key pathological process of neuropeptide release after nerve ending stimulation in sensitive skin, thereby providing feedback on their ability to inhibit neurogenic inflammation.

[0044] Preparation of sample group culture medium: The sensitive skin care compositions prepared in Examples 1-5 and Comparative Examples 1-6 were first dissolved in 10 times their mass of dimethyl sulfoxide, and then added to RPMI-1640 culture medium to dilute to RPMI-1640 culture medium containing 1% (v / v) of the sample. The cell line used was the rat adrenal pheochromocytoma cell line PC12 (Pronosai Biotechnology). This cell line can differentiate into a neuronal phenotype under the induction of nerve growth factor, expressing the complete TRPV1 receptor and exhibiting neuropeptide secretion function. Cells were cultured in RPMI-1640 medium containing 10% (v / v) horse serum, 5% fetal bovine serum (v / v), and 1% penicillin-streptomycin (v / v) and incubated at 37℃ in a 5% CO2 incubator. Before the experiment, cells were treated with 50 ng / mL β-nerve growth factor for 5-7 days to induce neuronal-like differentiation. Cells were cultured and treated according to the groupings, followed by testing. The testing methods are as follows: (1) Differentiated PC12 cells were fed with 1×10 4 Cells were seeded at a density of 96-well plates and cultured for 24 hours to allow the cells to adhere completely. (2) Discard the original culture medium and set up the following groups: Blank control group: add 100 μL of RPMI-1640 culture medium without irritants and test samples; Model control group: add 100 μL of RPMI-1640 culture medium containing 1 μM capsaicin; Sample group: add 100 μL of RPMI-1640 culture medium containing 1 μM capsaicin and 1% (v / v) sample. (3) The cells were cultured for another 6 hours, and the supernatant was collected for the detection of neuropeptide content. The concentrations of substance P and CGRP in the cell supernatant of each group were determined by enzyme-linked immunosorbent assay (ELISA): The collected supernatant was centrifuged at 3000 rpm for 10 minutes at 4℃, and the clear supernatant was taken. The detection was carried out strictly according to the instructions of the rat substance P ELISA kit (Jianglai Biotechnology, JL12596) and the rat CGRP ELISA kit (Jianglai Biotechnology, JL10569). The absorbance of each well was measured at a wavelength of 450 nm, and the concentrations of substance P and CGRP were calculated according to the standard curve. The experiment was repeated 3 times according to the parallel design principle, and the experimental data were presented as average values. The inhibition rate was calculated by the following formula: Neuropeptide inhibition rate (%) = [(Concentration of model control group - Concentration of sample group) / (Concentration of model control group - Concentration of blank group)] × 100%; The higher the inhibition rate, the stronger the inhibitory effect of the test composition on capsaicin-induced neuropeptide release, reflecting the more significant its effect of alleviating neurogenic inflammation by regulating the TRPV1 pathway. The calculated results are shown in Table 3. Table 3. Data from TRPV1 inhibition and neuroinflammation suppression trials. Group TRPV1 inhibition rate (%) Inhibition rate of substance P (%) CGRP inhibition rate (%) Example 1 81.74 73.21 66.75 Example 2 80.63 72.54 65.63 Example 3 79.02 72.19 65.29 Example 4 72.68 70.97 63.47 Example 5 76.55 70.24 62.54 Comparative Example 1 36.13 32.77 25.11 Comparative Example 2 38.27 32.19 27.25 Comparative Example 3 33.09 27.48 22.91 Comparative Example 4 50.45 44.86 40.73 Comparative Example 5 52.74 47.42 40.46 Comparative Example 6 57.53 53.17 46.53 As shown in Table 3, the TRPV1 inhibition rate, substance P inhibition rate, and CGRP inhibition rate of Example 1 and Comparative Examples 1-3 indicate that the sensitive skin skincare composition prepared by combining acetyl gingerone inclusion complex, strawberry fruit extract, and 4-tert-butylcyclohexanol significantly improves the TRPV1 inhibition rate, substance P inhibition rate, and CGRP inhibition rate compared to the sensitive skin skincare composition prepared by combining any two of these three components. This suggests that acetyl gingerone inclusion complex, strawberry fruit extract, and 4-tert-butylcyclohexanol have a synergistic effect.

[0045] Based on the data of TRPV1 inhibition rate, substance P inhibition rate, and CGRP inhibition rate in Example 1 and Comparative Examples 4-5 in Table 3, it can be concluded that the acetyl gingerone inclusion complex and strawberry fruit extract prepared by the method of the present invention, combined with 4-tert-butylcyclohexanol, have good TRPV1, substance P, and CGRP inhibition effects, i.e., neuroinflammatory inhibition effects.

[0046] The data in Table 3 regarding the inhibition rates of TRPV1, substance P, and CGRP in Examples 1-3 and Comparative Example 6 show that the composition exhibits good inhibition effects on TRPV1, substance P, and CGRP when the weight ratio of acetyl gingerone inclusion complex, strawberry fruit extract, and 4-tert-butylcyclohexanol is (0.01-1):(0.1-3):(0.01-2). Furthermore, the composition demonstrates the best effect when the weight ratio of acetyl gingerone inclusion complex, strawberry fruit extract, and 4-tert-butylcyclohexanol is 0.2:1.5:1.

[0047] Application Example 1-5 and Comparative Application Example 1-6 The compositions of Examples 1-5 and Comparative Examples 1-6 were added to the emulsion at a concentration of 3 wt% to obtain the emulsions of Application Examples 1-5 and Comparative Application Examples 1-6. The formulations are shown in Table 4.

[0048] The methods for preparing emulsions in Application Examples 1-5 and Comparative Application Examples 1-6 include the following steps: A1. Mix the humectant, thickener and deionized water, heat to 85°C, homogenize at 13000 rpm for 4 min to obtain pre-prepared component A, and keep warm for later use. A2. Mix the emulsifier and oil, heat to 85°C to form a homogeneous liquid, and obtain the pre-prepared component B. Keep it warm for later use. A3. Mix the preservatives and heat to 60°C to melt them, to obtain pre-prepared component C; A4. At 80℃ and 13000rpm, add pre-prepared component A to pre-prepared component B and homogenize for 4 min. Then, cool down to 60℃ and add pre-prepared component C while stirring at 250 rpm. Continue stirring for 12 min. Then, cool down to 40℃, add the sensitive skin care composition and stir for 8 min. Finally, add the remaining pH adjuster to adjust the pH to 6.0, stop stirring, and discharge the product to obtain the emulsion.

[0049] Table 4. Emulsion formulations of Application Examples 1-5 and Comparative Application Examples 1-6

[0050] Blank application example The difference between the blank application example and application example 1 is that the lotion in the blank application example does not contain the sensitive skin care composition, but uses an equal amount of deionized water instead of the sensitive skin care composition, and the preparation method is the same as that in application example 1.

[0051] Test Example 3: Test to soothe redness, improve skin barrier, and reduce sensitivity in sensitive skin This test case verifies the soothing redness relief, barrier improvement, anti-aging, and sensitivity reduction effects of the lotion in Application Examples 1-5, Comparative Application Examples 1-6, and Blank Application Example. Samples: Emulsions prepared in Application Examples 1-5, Comparative Application Examples 1-6, and Blank Application Examples; Experimental Methods: Volunteers were enrolled according to the general principles of safety testing in the *Cosmetic Safety Technical Specifications*. Forty-eight Asian adults aged 18-60 years with self-reported skin sensitivity and a lactic acid stinging score ≥3 were selected and randomly divided into 12 groups of 4 participants each. On the day of the trial, volunteers washed their faces with water without applying any product and sat quietly for 20 minutes in an air-conditioned room with a temperature of 21±1℃ and humidity of 50±10%. A Tewameter™ transdermal moisture loss test probe was used. Hex test was performed on the transcutaneous water loss (TEWL) of the cheekbone. Then, the VISIA instrument was used to photograph the subjects' faces to assess the degree and area of ​​facial redness. A 10% lactic acid solution was applied to the nasolabial folds of each subject's face (using 0.8cm diameter double-layered filter paper) for 5 minutes, after which the solution was removed to assess facial sensitivity to lactic acid stimulation. A 4-point questionnaire was used to assess sensitivity scores: 0 - no sensation, 1 - slight stinging, 2 - significant stinging, 3 - severe stinging. Subjects used the lotion twice daily, morning and evening, and were followed up before and after 28 days of use to test various indicators. The improvement effect on the skin barrier was represented by the TEWL improvement rate; the improvement effect on the degree of redness was represented by the a* value improvement rate; the improvement effect on the area of ​​redness was represented by the redness area improvement rate; and the improvement effect on skin sensitivity was represented by the lactic acid stinging improvement rate. Improvement rate = (mean before use - mean after use) / mean before use * 100%; The calculation results are shown in Table 5.

[0052] Table 5 Test data of emulsions from Application Examples 1-5, Comparative Application Examples 1-6, and Blank Application Example Groups / Indicators TEWL Improvement Rate (%) a* value improvement rate (%) Improvement rate of redness area (%) Improvement rate of lactic acid stinging (%) Application Example 1 25.83 29.45 36.78 47.71 Application Example 2 23.61 28.86 34.82 45.13 Application Example 3 24.04 28.13 34.57 45.68 Application Example 4 22.89 25.92 30.66 41.52 Application Example 5 21.95 26.01 31.48 42.19 Comparative Application Example 1 9.69 11.94 15.19 20.46 Comparative Application Example 2 10.88 14.89 18.84 21.18 Comparative Application Example 3 12.27 12.03 12.46 17.34 Comparative Application Example 4 14.84 17.71 21.92 32.09 Comparative Application Example 5 15.20 19.38 23.35 34.24 Comparative Application Example 6 17.37 20.46 25.12 35.39 Blank control group 3.12 4.14 3.28 5.63 The data in Table 5, including the improvement rate of TEWL, a* value, redness area, and lactic acid stinging, from Application Example 1 and Comparative Application Examples 1-3, and... Figure 2 It is known that acetyl gingerone inclusion complex, strawberry fruit extract and 4-tert-butylcyclohexanol have a synergistic effect. The skin care composition for sensitive skin prepared by the combination of the three has a high TEWL improvement rate, a* value improvement rate, redness area improvement rate and lactic acid stinging improvement rate.

[0053] Based on the data in Table 5 regarding the improvement rates of TEWL, a* value, redness area, and lactic acid stinging in Application Example 1 and Comparative Application Examples 4-5, it can be concluded that the acetyl gingerone inclusion complex prepared by the method of this invention, combined with strawberry fruit extract and 4-tert-butylcyclohexanol, results in a better TEWL improvement rate, a* value improvement rate, redness area improvement rate, and lactic acid stinging relief effect when used in the composition.

[0054] The data in Table 5 regarding the improvement rates of TEWL, a* value, redness area, and lactic acid stinging in Application Examples 1-3 and Comparative Application Example 6 show that when the weight ratio of acetyl gingerone inclusion complex, strawberry fruit extract, and 4-tert-butylcyclohexanol is (0.01-1):(0.1-3):(0.01-2), the composition exhibits better improvement in TEWL, a* value, redness area, and lactic acid stinging. Furthermore, the composition shows the best effect when the weight ratio of acetyl gingerone inclusion complex, strawberry fruit extract, and 4-tert-butylcyclohexanol is 0.2:1.5:1.

[0055] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A neurocalming, sensitive skin skincare composition characterized in that, The composition comprises acetyl gingerone inclusion compound, strawberry fruit extract and 4-tert-butylcyclohexanol, and the weight ratio of the acetyl gingerone inclusion compound, the strawberry fruit extract and the 4-tert-butylcyclohexanol is (0.01-1):(0.1-3):(0.01-2). The acetyl gingerone inclusion compound is prepared by β-cyclodextrin inclusion, and the preparation method comprises the following steps: (1) β-cyclodextrin is dissolved in deionized water at 60-70 °C to prepare a β-cyclodextrin aqueous solution with a mass fraction of 12-15%, and then the temperature is lowered to 50-60 °C for standby; (2) acetyl gingerone is dissolved in anhydrous ethanol to prepare an acetyl gingerone ethanol solution with a mass fraction of 1-5%; (3) The acetyl gingerone ethanol solution is slowly added to the β-cyclodextrin aqueous solution at 50-60 °C and 500-1000 rpm, and the reaction is continued under the condition of 50-60 °C and 400-600 rpm for 6-12 h. After the temperature is lowered to room temperature, it is stored in a 4 °C refrigerator for 8-12 h. The white or white-like precipitate is collected by filtration with a 0.45 μm filter membrane, washed with cold water, and dried at 40-50 °C under vacuum for 36-48 h to obtain the acetyl gingerone inclusion compound; The preparation method of the strawberry fruit extract comprises the following steps: S1, hydroxypropyl-β-cyclodextrin is dissolved in deionized water at 60-70 °C to prepare a hydroxypropyl-β-cyclodextrin aqueous solution with a mass fraction of 10-15%, and then the temperature is lowered to 45-55 °C for standby; S2, the freeze-dried strawberry powder is mixed with the hydroxypropyl-β-cyclodextrin aqueous solution at a solid-liquid ratio of 1 g:15-20 mL, and then microwave-assisted extraction is performed, wherein the microwave power is 500-800 W, the extraction temperature is 40-60 °C, and the extraction time is 10-20 min; S3, after the extraction is completed, the temperature is lowered to room temperature, and centrifugation is performed at 800-1200 rpm for 8-10 min. The solid residue is separated and discarded, and the supernatant containing hydroxypropyl-β-cyclodextrin / active ingredient inclusion compound is collected to obtain the strawberry fruit extract.

2. The neurologically sensitive skin care composition of claim 1, wherein, The weight ratio of the acetyl gingerone inclusion compound, the strawberry fruit extract and the 4-tert-butylcyclohexanol is (0.1-0.5):(1-2):(0.5-1.5).

3. The neurologically sensitive skin care composition of claim 1, wherein The weight ratio of the acetyl gingerone inclusion compound, the strawberry fruit extract and the 4-tert-butylcyclohexanol is 0.2:1.5:

1.

4. Use of the sensitive skin care composition of any one of claims 1-3 in the preparation of a skin care product.

5. Use of the neurocalming, sensitive skin care composition according to claim 4 for the manufacture of a skin care product, characterized in that, The skin care product is one of lotion, emulsion, cream, mask, serum and spray, and the addition amount of the sensitive skin care composition is 0.5%-3% of the total weight of the skin care product.

6. An emulsion characterized in that, The composition comprises the following raw materials by weight percentage: 0.5%-3% of the sensitive skin care composition of any one of claims 1-3, 0.05%-0.3% of a thickening agent, 0.5%-10% of a humectant, 1%-5% of an emulsifier, 1%-10% of an oil, 0.5%-5% of a preservative, and an appropriate amount of a pH adjuster, and the balance is deionized water.

7. The emulsion of claim 6, wherein, The raw materials are selected from at least one of (a)-(f): (a) The thickening agent comprises at least one of xanthan gum, carbomer, hydroxyethyl acrylate / acryloyl dimethyl taurate sodium copolymer, ammonium acryloyl dimethyl taurate / VP copolymer, and sclerotium gum; (b) The humectant comprises at least one of allantoin, betaine, beta-glucan, trehalose, caprylyl glycol, dipropylene glycol, sodium hyaluronate, 1,3-butanediol, glycerin, D-panthenol, and ceramide; (c) The emulsifier comprises at least one of C14-22 alcohol, C12-20 alkyl glucoside, cetyl stearyl glucoside, and sucrose stearate; (d) The oil comprises at least one of caprylic / capric triglyceride, isononyl isononanoate, pentaerythrityl tetraester, dimethicone, stearyl alcohol, hydroxystearic acid, polymethylsilsesquioxane, pentaerythrityl distearate; (e) The preservative comprises at least one of 1,3-propanediol, 1,2-hexanediol, and p-hydroxyacetophenone; (f) The pH regulator comprises at least one of arginine and tromethamine.

8. A process for the preparation of an emulsion as claimed in claim 7, characterized in that, The steps include: A1, mix the humectant, thickening agent, and deionized water, heat to 85°C, homogenize at 13000 rpm for 4 min to obtain a pre-prepared A component, and keep warm for standby; A2, mix the emulsifier and oil, heat to 85°C to form a uniform liquid to obtain a pre-prepared B component, and keep warm for standby; A3, mix the preservative, heat to 60°C to melt, and obtain a pre-prepared C component; A4, under the conditions of 80°C and 13000 rpm, add the pre-prepared A component to the pre-prepared B component and homogenize for 4 min, then cool to 60°C, add the pre-prepared C component under stirring at 250 rpm, and continue stirring for 10-15 min; Continue to cool to 40°C, add the sensitive skin care composition and stir for 8 min, finally add the remaining pH regulator to adjust the pH to 6.0, stop stirring, discharge, and obtain an emulsion.

Images