Application of ZmTCP5 gene in regulation and control of heat resistance of corn

The creation of the ZmTCP5 gene mutant in maize using CRISPR/Cas9 gene editing technology solves the problem of gene regulation in maize's high-temperature stress response, enhances maize's high-temperature resistance, and provides the possibility of heat-resistant gene resources and new variety breeding.

CN121344077APending Publication Date: 2026-01-16UNIV OF SCI & TECH BEIJING +2
View PDF 0 Cites 2 Cited by

Patent Information

Application Number
CN202511897360.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-16
Publication Date
2026-01-16

AI Technical Summary

Technical Problem

Current technologies lack research on gene regulation of maize's response to high-temperature stress, which affects maize yield and growth. There is an urgent need to explore heat-resistant gene resources to improve maize's high-temperature resistance.

Method used

ZmTCP5 gene knockout and overexpression mutants were created using CRISPR/Cas9 gene editing technology. Different mutants and overexpression materials were constructed in maize through gene editing and transgenic technology, subjected to high temperature stress, and the changes in related physiological indicators were observed and detected.

Benefits of technology

The application of the ZmTCP5 gene in regulating maize high-temperature resistance was clarified, providing gene resources for the breeding of new heat-resistant maize varieties. It enhanced maize's tolerance to high temperatures, reduced leaf scorching symptoms and ROS content, and improved ROS scavenging enzyme activity and photosynthetic efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121344077A_ABST
    Figure CN121344077A_ABST
Patent Text Reader

Abstract

The invention relates to the field of gene engineering and molecular breeding, and discloses application of a ZmTCP5 gene in regulation and control of heat resistance of corn. According to the invention, three types of knockout mutants of the gene are obtained by using a CRISPR / Cas9 technology, and three overexpression materials are created. At normal temperature (25-28 DEG C), the material has no obvious phenotypic difference with a wild type; however, under high temperature stress (45 DEG C), the ZmTCP5 knockout mutant has enhanced heat resistance, reduced reactive oxygen species (ROS) accumulation, and significantly increased ROS scavenging enzyme activity, chlorophyll content and photochemical efficiency; on the contrary, the ZmTCP5 overexpression strain is more sensitive to heat stress, which indicates that the ZmTCP5 negatively regulates the heat resistance of the corn. The research provides a theoretical basis for analyzing a heat-resistant molecular mechanism of the corn, and also provides an important gene resource for creating a new germplasm of the heat-resistant corn.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering breeding and molecular breeding, specifically relating to maize. ZmTCP5 Application of genes in regulating maize's resistance to high-temperature stress. Background Technology

[0002] Environmental stress severely impacts crop production. Globally, approximately 50% of yield losses in major crops are caused by abiotic stress. [1] Among these, high-temperature stress is one of the most destructive and threatening stresses to plants, directly affecting their physiological and biochemical processes, such as photosynthesis, osmotic regulation, antioxidant responses, and hormone regulation. [2] In China, for every 1°C increase in extreme heat, corn yield will decrease by 226.62 kg / hm². [3-4] Therefore, analyzing the response mechanisms of crops under high-temperature stress and identifying key heat-resistant genes has become a core issue in ensuring food security.

[0003] High temperature stress at different growth stages of maize can have adverse effects on its growth and development, ultimately affecting yield. [5] High temperature stress directly affects the physiological and biochemical processes and overall gene expression of maize, involving changes in membrane structure and function, tissue water content, primary and secondary metabolites, and protein and lipid composition. This leads to physiological, molecular, and biochemical changes in the plant and impairs its normal growth and development. [6] Furthermore, high temperatures can induce reactive oxygen species explosions, exacerbate membrane lipid peroxidation, and lead to increased malondialdehyde (MDA) content, ultimately affecting grain filling and grain weight. [7] Therefore, elucidating the physiological, genetic, and molecular mechanisms by which maize responds to high-temperature stress has significant guiding and practical value for improving crop yield.

[0004] The TCP transcription factor family refers to a class of plant-specific transcription factors containing the conserved TCP domain. TCP family genes can be divided into two main classes: Class I and Class II, which differ significantly in the number of residues in the basic region, the composition of the loop and helix, and the length of helix II. [8-9] Studies have shown that members of the TCP family are involved in plant growth and development processes. [10-12] In contrast, research on the role of the TCP gene in plant stress resistance started relatively late, with only a few reports currently showing an association between TCP and plant stress resistance. Overexpression in rice... OsTCP19 The gene can induce the expression of typical genes in multiple hormone signaling pathways such as ABA and CK, reduce water loss, decrease the accumulation of lipid droplets and oxygen ions, and improve the tolerance of transgenic plants to high salt treatment and mannitol treatment.

[13] Under high-salt conditions, transferPeTCP10 Arabidopsis thaliana improves the antioxidant capacity of transgenic plants and enhances their tolerance to H2O2 by promoting catalase activity.

[14] Rice OsTCP19 Heterologous expression in Arabidopsis thaliana reduces plant water loss and reactive oxygen species, and increases lipid droplet accumulation, ultimately improving the stress resistance of transgenic plants during the seedling and maturity stages.

[13] Furthermore, overexpression in rice OsTCP21 This increases the plant's sensitivity to low temperatures, while RNAi technology can... OsTCP21 After gene silencing, the plant's tolerance to low temperatures increases.

[15] However, there are currently no reports on the TCP regulation of the high-temperature stress response in maize.

[0005] This invention utilizes CRISPR / Cas9 (Clustered, Regularly Interspaced, Short Palindromic Repeats-associated Endonuclease 9) gene editing technology to create three different mutation types. ZmTCP5 Gene knockout mutants. And using transgenic technology, they were created. ZmTCP5 Overexpression lines. Wild-type and overexpression strains were cultured in an artificial climate chamber for 14 days after germination. ZmTCP5 The above-mentioned knockout mutants and overexpression seedlings were subjected to high-temperature stress treatment at 45 °C. Compared with the wild type, the above-mentioned... ZmTCP5 The mutant exhibited decreased sensitivity to high-temperature stress, milder leaf scorching symptoms, significantly reduced ROS content, and significantly increased activity of ROS-scavenging enzymes (catalase, superoxide dismutase, and peroxidase). Chlorophyll content and photochemical efficiency were also elevated. ZmTCP5 Overexpression materials are more sensitive to high-temperature stress, exhibiting significant leaf scorching symptoms, a significant increase in ROS content, a decrease in ROS scavenging enzyme activity, and reductions in chlorophyll content and photochemical efficiency, indicating that maize... ZmTCP5 Genes play a negative regulatory role in maize's heat resistance. This invention provides potential gene resources for the discovery of heat-resistant genes in maize and the breeding of new heat-resistant maize varieties. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to clarify ZmTCP5 Its application in regulating maize's resistance to high-temperature stress provides genetic resources and new germplasm for the breeding of new heat-tolerant maize varieties. The specific technical solution is as follows: 1. Maize inbred line X249 ZmTCP5 Sequence analysis, the ZmTCP5 The nucleotide sequence of the gene is shown in SEQ ID NO.1.ZmTCP5 The amino acid sequence encoded by the gene is shown in SEQ ID NO.2. Appropriate sites were selected for gene editing target design.

[0007] 2. Constructing using CRISPR / Cas9 gene editing technology ZmTCP5 Gene-editing vectors were introduced into the callus tissue of the maize inbred line X249 using Agrobacterium-mediated transformation. After obtaining T0 generation transgenic plants, they were crossed with wild-type X249 to obtain F1 generation seeds. After self-pollination and genotyping to obtain homozygous non-transgenic gene-edited seeds, these seeds were germinated and grown in soil in an artificial climate chamber for 14 days. Then, they were subjected to a 45 °C high-temperature treatment. Changes in leaf scorch, ROS content, ROS scavenging enzyme activity, chlorophyll content, and photochemical efficiency were investigated and measured.

[0008] 3. Overexpression vectors were constructed and introduced into callus tissue of maize inbred line X249 using Agrobacterium-mediated transformation. After obtaining T2 generation homozygous positive seeds, the seeds were germinated and grown in soil in an artificial climate chamber for 14 days, followed by high-temperature treatment at 45 °C. Changes in leaf scorch, ROS content, ROS scavenging enzyme activity, chlorophyll content, and photochemical efficiency were investigated and detected.

[0009] This invention utilizes CRISPR / Cas9 technology to study corn. ZmTCP5 Site-specific gene editing yielded three mutants with different editing types for this gene, all of which exhibited a phenotype with significantly increased tolerance to high-temperature treatment. This led to the creation of maize... ZmTCP5 Overexpression materials showed a phenotype where plants were more sensitive to high-temperature treatment. This suggests... ZmTCP5 Negative regulation of corn's heat tolerance. Attached Figure Description

[0010] Figure 1 ,corn pCas9-ZmTCP5 Knock out the carrier.

[0011] Figure 2 , ZmTCP5 Analysis of gene sequence variations in knockout events.

[0012] Figure 3 ,corn ZmTCP5 Overexpression vector map ( Figure 3 a) and ZmTCP5 Expression level detection ( Figure 3 b).

[0013] Figure 4 ,corn ZmTCP5 Phenotypic and physiological analysis of knockout mutants under high temperature stress.

[0014] ab. Wild type (WT) and ZmTCP5Knockout mutant ( ZmTCP5-KO c. Differences after 14 hours of high-temperature treatment at 45℃; ZmTCP5 Differences in reactive oxygen species (ROS) content (NBT staining) in the first leaf of the knockout mutant after 3 hours of high-temperature treatment at 45°C; d. Wild type and ZmTCP5 Comparison of reactive oxygen species scavenging enzyme activities in the second leaf of the knockout mutant after 3 hours of high-temperature treatment at 45℃; e. Wild type and ZmTCP5 Comparison of chlorophyll content, actual photochemical efficiency, and maximum photochemical efficiency of the second leaf after 45℃ high-temperature treatment of the knockout mutant with those before treatment. An asterisk (*) in the bar chart indicates a significant difference (p<0.05) in the t-test.

[0015] Figure 5 ,corn ZmTCP5 Phenotypic and physiological analysis of overexpression plants under high temperature stress.

[0016] ab. Wild type (WT) and ZmTCP5 Overexpression plants ( ZmTCP5-OE c. Differences after 14 hours of high-temperature treatment at 45℃; ZmTCP5 Differences in reactive oxygen species (ROS) content (NBT staining) in the first leaf of overexpression plants after 3 hours of high-temperature treatment at 45℃; d. Wild-type and ZmTCP5 Comparison of reactive oxygen species scavenging enzyme activities in the second leaf of overexpression plants after 3 hours of high-temperature treatment at 45℃; e. Wild type and ZmTCP5 Comparison of chlorophyll content, actual photochemical efficiency, and maximum photochemical efficiency of the second leaf after overexpression treatment at 45℃ with those before treatment. An asterisk (*) in the bar chart indicates a significant difference (p<0.05) in the t-test. Detailed Implementation

[0017] Example 1: Creation using the CRISPR / Cas9 method ZmTCP5 mutant materials To clarify ZmTCP5 The role of mutants in maize's tolerance to high-temperature stress: This invention utilizes gene cloning and vector construction technologies to create mutants through gene editing. ZmTCP5 The mutant was investigated, and its function in maize was examined. In this invention, the maize inbred line X249 was selected as the recipient material for gene editing. ZmTCP5 The 19 bases at positions 773-791 of the CDS sequence (5'-CCGCCAAGTTTGGCAATGC-3') and the 19 bases at positions 915-933 of the CDS sequence (5'-CAGTTTTTCCATGTCCTCG-3') are used as target regions for CRISPR / Cas9 gene editing.

[0018] MT1 (SEQ ID NO.3): CCGCCAAGTTTGGCAATGC MT2 (SEQ ID NO.4): CAGTTTTTTCCATGTCCTCG 1. ZmTCP5 Construction of knockout vector The gene editing vector of the present invention is pBUE411-ZmTCP5-Cas9 The basic carrier of this carrier is / / 原内容中“pBUE411-”后面似乎缺少了一些东西,按照要求保留原文形式翻译 pBUE411- The intermediate carrier is Cas9 This invention provides gRNA. The specific construction process involves designing target sites on primers, obtaining MT-sgRNA via PCR, and then ligating it into a basic vector via enzyme digestion. The details are as follows.

[0019] (1) Design of target gRNA. pCBCmT1T2 The conserved gene sequence was input into the website http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR for target design. The sgRNA backbone sequence of this invention was obtained directly from the intermediate vector.

[0020] (2) MT-sgRNA was obtained by designing target sites on primers and performing PCR amplification. Primers ZmTCP5 (SEQ ID NO. 5) and primers [[ID=5-3]]ZmTCP5-MT1-F (SEQ ID NO.6) Amplification intermediate vector ZmTCP5-MT1-R This is used to obtain sgRNA fragments containing the first and second targets. The PCR system and conditions are as follows: template DNA (intermediate vector) pCBCmT1T2 ≥30 ng / μL) 1.2 μL; Primer F / R: 1.2 μL each; Sterile ddH2O: 11.4 μL; 2X MCLAB enzyme (product number: I5HMb00): 15 μL. The PCR temperature program was as follows: ① 98 ℃ for 2 min; ② 98 ℃ for 10 s; ③ 58 ℃ for 30 s; ④ 72 ℃ for 30 s; ⑤ Cycle 33 times from ② to ④; ⑥ 72 ℃ for 5 min; ⑦ 25 ℃ for 10 min. The PCR products were recovered after agarose gel electrophoresis.

[0021] The primer base sequences required for vector construction are shown in SEQ ID NO.5 and SEQ ID NO.6.

[0022] pCBCmT1T2 (SEQ ID NO.5): 5'-AATAATGGTCTCAGGCGACCGCCAAGTTTGGCAATGCGTTTTAGAGCTAGAAATAGC-3'; ZmTCP5-MT1-F (SEQ ID NO.6): 5'-ATTATTGGTCTCTAAACCAGTTTTTCCATGTCCTCGTGCTTCTTGGTGCCGC-3'; (3) Construct the backbone vector by enzyme digestion and ligation. ZmTCP5-MT1-R Vectors and recovered target-carrying sgRNA fragments are used pBUE411-Cas9 Digestion was performed, and T4 ligase was added to ligate the vector and sgRNA fragment. The enzyme digestion and ligation system is as follows: sgRNA fragment: 2 μL; pBUE411-Cas9 vector (≥60 ng / μL): 2 μL; 10 x NEB Buffer: 1.5 μL; BsaI Endonuclease (product number: #R3733S): 1 μL; T4 ligase (product number: #M0202M): 1 μL; ddH2O: 6 μL.

[0023] The constructed maize pCas9-ZmTCP5 vector map is shown below. BsaI As shown.

[0024] 2. Agrobacterium-mediated genetic transformation of maize The transformation recipient is maize inbred line X249, carrying 1 [transformation receptor]. Figure 1 copy.

[0025] The above-constructed ZmTCP5The vector was transferred into Agrobacterium EHA105 via heat shock, identified by PCR, and the bacterial culture was stored at -80℃ with glycerol. Freshly peeled immature embryos of the inbred line X249, approximately 1.5 mm in diameter, were used as recipient material. The peeled corn embryos were placed in 2 mL plastic centrifuge tubes containing 1.8 mL of suspension for no more than 1 hour, with approximately 100 embryos per tube. The suspension was removed, and the embryos were washed twice with fresh suspension, leaving a small amount at the bottom of the tube to submerge them. The tubes were then heat-shocked at 43℃ for 2 min, followed by an ice bath for 1 min. The remaining wash solution was aspirated using a pipette, and 1.0 mL of Agrobacterium infection solution was added. The tubes were gently shaken for 30 seconds and then incubated in the dark for 8 min. Next, the embryos and infection solution were poured onto a co-culture medium, mixed well, and excess infection solution was aspirated using a pipette. All embryos were incubated with their scutes facing upwards at 23℃ in the dark for 3 days. After co-culture, the immature embryos were transferred to recovery medium using sterile forceps and cultured at 28 °C for 14 days, during which time any emerging shoots should be removed promptly. After recovery culture, the immature embryos were placed on selection medium containing 1.5 mg / L Bialaphos for three rounds of selection, each round lasting two weeks. Then, they were transferred to 2 mg / L Bialaphos selection medium for two rounds of selection, each round lasting two weeks. The resistant callus was transferred to propagation medium and cultured in the dark at 28 °C for two weeks. Subsequently, the propagated resistant callus was transferred to induction medium and cultured in the dark at 28 °C for two weeks. Then, it was transferred to differentiation medium and cultured under light at 25 °C and 5000 lux for two weeks. After the culture is completed, the differentiated seedlings are separated into individual seedlings and placed in a rooting medium. They are then cultured at 25 ℃ and 5000 lux light until they take root. The seedlings are then transferred to small nutrient pots for growth. Once they have survived, they are transplanted into a greenhouse and the offspring seeds are harvested after 3-4 months.

[0026] 3. Detection of knockout mutation results in T0 generation plants To determine the knockout mutation results in the T0 generation plants, the following steps were taken: This invention uses the CTAB method to extract DNA from maize leaves. The specific method is as follows: Cut seedling leaves approximately 2 cm in length and place them in a 2 mL centrifuge tube containing steel balls; immerse the centrifuge tube containing the leaves in liquid nitrogen for 5 minutes, then use a grinder to break up the leaf sample; add 700 μL of CTAB extraction buffer (containing 1%...) to the centrifuge tube. β(-mercaptoethanol), mix vigorously, preheat in a 65 ℃ water bath for 20-30 min (invert once during this period); after the centrifuge tube cools to room temperature, add 700 μL of chloroform:isoamyl alcohol (24:1) extraction solution, shake vigorously for 30 s, and let stand at room temperature for a while; centrifuge at 12000 rpm for 5 min at 4 ℃, and take 500 μL of supernatant into a new 1.5 mL centrifuge tube; add an equal volume of isopropanol to the centrifuge tube containing the supernatant, gently shake to mix, and let stand at room temperature for about 10 min; then place the centrifuge tube containing the sample in a 4 ℃ centrifuge, centrifuge at 12000 rpm for 10 min, gently aspirate the supernatant, discard the supernatant, and retain the precipitate; add 800 μL of 75% ethanol, wash the precipitate twice, centrifuge at 10000 rpm for 5 min, and discard the supernatant; place the sample to air dry at room temperature for 2-4 days. h, the DNA precipitate was obtained, and an appropriate amount of sterile water was added to dissolve it. The mixture was gently shaken to fully dissolve the DNA. The DNA sample was stored at -20 °C. The DNA concentration was detected using Nanodrop, and the sample was diluted to 10 ng / L for use as a PCR template.

[0027] Then according to pCas9-ZmTCP5 Design PCR primers based on gene sequence.

[0028] Target: MT1; Product size: 513 bp; Primer sequences are shown in SEQ ID NO.7 and SEQ ID NO.8: ZmTCP5-1-TF (SEQ ID NO.7): 5'-TAGGCAGTCGTGGCATCAG-3'; ZmTCP5-1-TR (SEQ ID NO. 8): 5'-CTCCTGCCCTTCTCCTTCAT-3'.

[0029] Amplify using the following PCR parameters: Reaction system: 15 μL MIX conventional PCR system, 0.5 μL forward primer, 0.5 μL reverse primer, 1 μL DNA, 5.5 μL sterile ddH2O, 7.5 μL 2x Taq mix (product number: 10103ES). Reaction procedure: Conventional PCR: annealing at 58℃, extension for 30s, 32 cycles.

[0030] The PCR product was then recovered and ligated into a T vector for sequencing. By sequencing the DNA sequences of the target regions of multiple T0 generation independent positive transformation events, it was determined whether gene editing had occurred in the target regions.

[0031] Using X249 as the recipient of the transgenic plant, three mutation types were obtained: ZmTCP5-KO#1, ZmTCP5-KO#2, and ZmTCP5-KO#3. ZmTCP5 Mutant type plants in ZmTCP5-KO#1 A 143bp deletion occurs at positions 776-918 in the gene coding region. Z-mTCP5 Mutant type plants in ZmTCP5-KO#2 The gene coding region has a 1 bp deletion at position 775 and a 1 bp insertion at position 923; ZmTCP5 exist ZmTCP5-KO#3 A 63 bp insertion and a 205 bp deletion were performed at position 776 in the gene coding region. ZmTCP5 ).

[0032] 4. Genotyping of F2 generation plants Because maize T0 generation plants grown in greenhouses often exhibit uncoordinated development of female and male ears, this invention uses wild-type pollen from the maize inbred line X249 to propagate T0 generation plants and ensure the inheritance of the obtained gene-edited type. Figure 2 and ZmTCP5-KO#1, ZmTCP5-KO#2 T0 generation plants are pollinated to obtain F1 generation seeds, and the resulting plants are F1 generation plants. Self-pollination yields mutants with homozygous genetic background.

[0033] The F2 offspring obtained from self-pollination of F1 plants include two segregation types, one of which is... ZmTCP5-KO#3 - Positive plants (transgenic plants), another type is Cas9 - To prevent the continuous editing of the X249 wild-type allele introduced by hybridization by sgRNA and Cas9, which would lead to complex mutation types, we need to select plants from the F2 generation that do not contain sgRNA or Cas9 through genotyping. Cas9 Genes, but containing T0 generation mutant types of plants, these plants can be self-pollinated to obtain homozygous non-transgenic gene-edited seeds. The genotyping steps for F2 generation plants are as follows.

[0034] After extracting leaf DNA using the CTAB method described above, the first step is to utilize... Cas9 Gene-specific primers were used for PCR amplification, and the base sequences are shown in Cas9-F (SEQ ID NO.9) and Cas9-R (SEQ ID NO.10): Cas9-F (SEQ ID NO.9): 5'-CCCGGACAATAGCGATGT-3'; Cas9-R (SEQ ID NO. 10): 5'-GAGTGGGCCGACGTAGTA-3'.

[0035] The PCR reaction system was the same as above; the reaction procedure was as follows: standard PCR: annealing at 58℃, extension for 30 seconds, 32 cycles. After agarose gel electrophoresis, the PCR products were distinguished based on the results. Cas9 -positive plants and Cas9 -Negative plants.

[0036] Further targeting Cas9 - Positive plants, tested Cas9 The gene target MT1 was targeted using the primers described above. ZmTCP5 F and ZmTCP5-T- After purification of the PCR product, it was ligated into a T vector and sequenced. The genetic information of the T0 generation mutation type was determined based on the sequencing results.

[0037] Selecting plants from the F2 generation that do not contain ZmTCP5-T-R Plants containing the T0 generation mutation were self-crossed to obtain homozygous non-transgenic gene-edited seeds, which were then used for the next step of high-temperature tolerance testing.

[0038] Example 2: Corn Cas9 Construction of overexpression vectors and phenotypic screening of transgenic plants ZmTCP5 Construction of overexpression vectors (1) Acquisition and amplification of the target gene. The coding sequence of maize ZmTCP5 (V3: GRMZM2G089361; V4: Zm00001d013119; V5: Zm00001eb213430) was obtained from the public database MaizeGBD (https: / / www.maizegdb.org / ). Specific primers ZmTCP5-OE-F (SEQ ID NO.11) and ZmTCP5-OE-R (SEQ ID NO.12) were designed and amplified by PCR using high-fidelity DNA polymerase. 1. ZmTCP5 Precursor fragments. The PCR system and conditions were as follows: template DNA (X249 genomic DNA) 1.2 μL; Primer F / R: 1.2 μL each; sterile ddH2O: 11.4 μL; 2X MCLAB enzyme (product number: I5HMb00): 15 μL. The PCR temperature program was as follows: ① 98 ℃ for 2 min; ② 98 ℃ for 10 s; ③ 58 ℃ for 30 s; ④ 72 ℃ for 30 s; ⑤ Cycle 33 times from ② to ④; ⑥ 72 ℃ for 5 min; ⑦ 25 ℃ for 10 min. The PCR products were recovered after agarose gel electrophoresis.

[0039] The primer base sequences required for vector construction are shown in SEQ ID NO.11 and SEQ ID NO.12.

[0040] ZmTCP5-OE-F (SEQ ID NO.11): GTACCGCGGGCCCGGGATCCATGGAGGCAGCAGCCGT ZmTCP5-OE-R (SEQ ID NO.12): CGGCAGCAGCCGGATCCCGCTCCTGCCCTTCTCCTTCA (2) The vector was constructed into a backbone vector via enzyme digestion and ligation. The plant expression vector pBI121-Ubi, containing the maize ubiquitin promoter, was selected to drive the efficient expression of ZmTCP5. The vector was double-digested with restriction endonucleases XmaI and SmaI, and the linearized vector fragment was recovered. This was to prepare for the insertion of the miR319A precursor. Recombinant ligase was added to ligate the vector and the target fragment. The enzyme digestion and ligation system was as follows: pri-miR319A fragment: 2 μL, pBI121-Ubi vector (≥60 ng / μL): 2 μL, DNA recombinant ligase (product number: 7E682G2): 1 μL.

[0041] The ligation product was transformed into competent Escherichia coli (DH5α), and positive clones were screened on a medium containing the antibiotic kanamycin. After plasmid extraction, the correct insertion of the ZmTCP5 precursor was confirmed by sequencing.

[0042] After construction ZmTCP5 Expression carriers such as ZmTCP5 As shown in a. The Z-shaped structure will be constructed. Figure 3 The overexpression vector was transformed into Agrobacterium EHA105 by heat shock, and after identification by PCR, it was transformed into maize embryos using the Agrobacterium-mediated maize genetic transformation method described in Example 1.

[0043] (3) T0 generation mTCP5 Detection of Overexpression Plant Results To determine whether the T0 generation plants were positive seedlings, we used the Basta resistance gene to screen for positive seedlings. The specific method is as follows: A 0.1% concentration of Basta solution is prepared and evenly applied to the leaves of T0 generation plants to screen for positive events. Significant phenotypic differences typically begin to appear within 3-7 days after application. Plants that successfully express the bar / pat gene show green, healthy leaves after application, or only slight, temporary chlorosis / scorching (especially under higher concentrations or strong light), but recover quickly.

[0044] T0 generation positive plants (heterozygous) were self-pollinated to obtain T1 generation seeds (due to segregation, T1 generation seeds included homozygous, heterozygous, and wild-type seeds). Twenty of these T1 generation seeds were then sown and self-pollinated to harvest T2 generation seeds. These 20 seed samples were then sown to produce 50 plants. The Basta resistance gene screening method described above was used to select positive seedlings. T2 generation seeds from all 50 positive plants were identified as homozygous transgenic seeds; otherwise, they were identified as heterozygous transgenic seeds or wild-type seeds. The selected T2 generation homozygous transgenic seeds were then sown and their tolerance to high-temperature stress was tested.

[0045] 2. ZmTCP5 In overexpressing plants ZmTCP5 Transcription level detection Seeds were harvested from the T0 generation positive plants after self-pollination. Twenty seeds were sown in 20cm x 20cm pots filled with nutrient soil for germination and growth (T1 seedlings). After 14 days, 0.1% Basta was applied to the upper part of the second leaf of each T1 seedling. The positivity of the plants was observed one week later. Nine Basta-positive T1 seedlings from different lines were selected, with the third leaf from each group of three leaves combined as one sample. Three samples from each line were ground in liquid nitrogen and total RNA was extracted using the Trizol method. cDNA reverse transcription was performed according to the instructions of the FastKing cDNA First-Strand Synthesis Kit (catalog number KR116) from Tiangen Biotech (Beijing) Co., Ltd., and detection was performed using the company's Real-Time PCR Kit (catalog number FP205) and the following primer sequences. ZmTCP5 transcript levels, ZmTCP5 As an internal reference, it is calculated using the relative quantification method. ZmTubilin5 Expression levels in different overexpression lines.

[0046] in, ZmTCP5 The primer sequences required for transcript level detection are shown in SEQ ID NO.13 to SEQ ID NO.14, and the primer sequences for transcript detection of the internal reference gene are shown in SEQ ID NO.15 to SEQ ID NO.16. qZmTCP5-F(SEQ ID NO.13): CCATCCAGTTTCTACGACCTG qZmTCP5-R(SEQ ID NO.14): GCTGCTGCTGCTTATCATTG qZmTubilin5-F(SEQ ID NO.15): GCCGTTGCCGAGGTGTTC qZmTubilin5-R(SEQ ID NO.16):GTCCTTCTCAAGAGCAGCCAAGT Different overexpression lines ZmTCP5 level of expression, such as ZmTCP5 As shown in b. Select Figure 3 ZmTCP5-OE#1, ZmTCP5-OE#2, The strains were used for further comparison of phenotypic and physiological indicators.

[0047] Example 3 Corn ZmTCP5-OE#; Phenotypic observation and physiological comparison of knockout mutants and overexpression plants under high temperature treatment

[0048] 1. Planting of corn materials Choose wild-type X249 with plump, uniformly sized kernels. / / 原内容中“ZmTCP5-OE#;”这里的分号可能有误,按照要求保留原文形式翻译 mutant ( ZmTCP5 ZmTCP5 Seeds and overexpression ZmTCP5-KO#1, The seeds were sown in small pots measuring 20 cm × 20 cm and germinated and grew normally for 14 days (until the second leaf was fully expanded) in an artificial climate chamber (16 hours of light / 8 hours of darkness, temperature 25℃, humidity 50%, light intensity 1000µE).

[0049] 2. Observation of plant heat tolerance phenotype Select wild-type plants with uniform growth. ZmTCP5-KO#2, ZmTCP5-KO#3 The mutants and overexpressing plants were placed in a preheated 45 °C artificial climate chamber (16 hours light / 8 hours dark, temperature 45 °C, humidity 50%, light intensity 1000 µE) for 14 hours of heat stress treatment. Afterwards, they were removed and returned to an artificial climate chamber with normal growth temperature (16 hours light / 8 hours dark, temperature 25 °C, humidity 50%, light intensity 1000 µE) to recover growth. Three days later, the entire plant was photographed to observe the scorching effect, and the second intact leaf was photographed to observe the leaf scorching effect. Simultaneously, the corresponding material that had not undergone high-temperature treatment was used as a control for phenotypic photography.

[0050] To investigate changes in physiological indicators, wild-type plants with uniform growth were selected. ZmTCP5-OE#1, ZmTCP5-OE#2, ZmTCP5-OE#3 The mutants and overexpressing plants were placed in a preheated 45 °C artificial climate chamber (16 hours light / 8 hours darkness, temperature 45 °C, humidity 50%, light intensity 1000 µE) for 3 hours of heat stress treatment. Afterwards, the first leaf was taken and stained with NBT staining solution. The second leaf was removed, ground with liquid nitrogen, and the activities of catalase, superoxide dismutase, and peroxidase were detected by colorimetric method using a multi-functional microplate reader. Corresponding materials that had not undergone high-temperature treatment served as controls.

[0051] Chlorophyll content, actual photochemical efficiency, and maximum photochemical efficiency were measured using a SPAD-520 chlorophyll meter and a FluorPen FP110 portable chlorophyll fluorescence meter, respectively. Six to ten plants of each material were selected, and measurements were taken on the upper-middle part of the second leaf (avoiding the midrib). Each sample was measured three times, and the average value was calculated. The chlorophyll content, actual photochemical efficiency, and the ratio of maximum photochemical efficiency before and after high temperature were calculated for each leaf.

[0052] Phenotypic studies showed that after heat treatment at 45°C, compared to the wild type (WT), ZmTCP5 , ZmTCP5 and ZmTCP5-KO#1 The leaves of the material showed less wilting, curling, and water loss; conversely, ZmTCP5-KO#2 ZmTCP5-KO#3 and ZmTCP5-OE#1, The leaves of the material showed more severe phenotypic effects than the wild type. ZmTCP5-OE#2 a, b; / / 原内容中“ZmTCP5-OE#2”后面似乎缺少了一些东西,按照要求保留原文形式翻译 a, b). Further analysis revealed that before heat treatment, wild type, Z... ZmTCP5-OE#3 mutants and Figure 4 There was no significant difference in NBT staining results among overexpressing plants; after heat treatment, Figure 5 The area of ​​the blue-stained region in the material was significantly smaller than that in the wild type, while the area of ​​the overexpression material was significantly larger than that in the wild type. mTCP5-KO c); ZmTCP5-OE c), indicating that after heat stress ZmTCP5-KO The mutants showed reduced accumulation of stress-associated reactive oxygen species (ROS), while overexpressing plants showed increased ROS accumulation. Comparison of ROS-scavenging enzyme activities showed that, compared to the wild type, Figure 4 The activities of catalase (CAT), superoxide dismutase (SOD), and peroxidase (POD) were all significantly increased in the mutant. Figure 5 d), and ZmTCP5 The activities of all three enzymes were significantly reduced in overexpressed plants. ZmTCP5 d), indicating that under thermal stress conditions, Figure 4 The mutant exhibited a stronger ROS scavenging ability, while the overexpressing plants showed a weaker ROS scavenging ability. Furthermore, comparing the changes in chlorophyll content, actual photochemical efficiency, and maximum photochemical efficiency before and after heat treatment revealed… ZmTCP5 The mutant maintained higher photosynthetic parameters than described above even after heat stress. Figure 5 e), while overexpressing plants showed significantly lower levels than wild-type (e). ZmTCP5 e), indicating that under heat stress, ZmTCP5 The mutant can maintain a high photosynthetic capacity, while the photosynthetic capacity of the overexpressing plant is significantly impaired.

[0053] Therefore, by knocking out Figure 4 Figure 5 ZmTCP5 ZmTCP5The obtained maize material exhibits significantly enhanced heat tolerance, specifically reflected in improved reactive oxygen species (ROS) scavenging efficiency and maintained photosynthetic performance. This material demonstrates outstanding agronomic advantages under high-temperature stress conditions, possessing significant production application value and theoretical innovation significance. At the production level, this gene provides a key target for breeding new heat-resistant maize varieties, which can be directly applied to molecular design breeding to create superior germplasm capable of withstanding extreme high temperatures, thereby ensuring food security and stable yields in the context of global climate change, and potentially expanding the suitable planting areas for maize. At the theoretical level, this study breaks through the traditional cognitive boundaries of the TCP transcription factor family, revealing for the first time its core role in plant heat stress responses and elucidating a novel heat stress regulatory pathway mediated by the TCP gene. This discovery deepens the understanding of the complexity of plant stress resistance molecular networks, provides a new strategy for systematically improving complex crop traits by manipulating "master switch" type regulatory factors, and points to a new direction for future stress resistance breeding research.

[0054] References: Ge Feifan, Mao Kebiao, Jiang Yuelin. Characteristics of extreme high temperatures in East China during summer and their impact on vegetation. Chinese Journal of Agricultural Meteorology, 2017, 38(1):42-51. Ma Juan, Liu Xiaofeng, Bai Yinshuang, Wang Gaoke, Liu Hua. Research progress on the effects of high temperature stress on plants and the microbial-mediated mechanisms of plant response to high temperature stress. Bulletin of Microbiology, 2025, 52(04):1399-1414. Zhao C, Liu B, Piao S, et al. Temperature increase reduces globalyields of major crops in four independent estimates. Proc Natl Acad Sci USA, 2017, 114: 9326-9331. Zhang Miao, Li Hongping, Qi Hongzhi, et al. Effects of high temperature stress before and after pollination on agronomic traits and yield of different maize hybrid combinations. Henan Agricultural Sciences, 2021, 50(4):22-30. Li Xiaofan, Shao Jingyi, Yu Weizhen, Liu Peng. Effects of combined high temperature and drought stress on yield and photosynthetic characteristics of summer maize. Chinese Journal of Agricultural Science, 2022, 55(18):3516-3529. Sharma L, Priya M, Kaushal N, Bhandhari K, Chaudhary S, Dhankher OP, Prasad PVV, Siddique KHM, Nayyar H. Plant growth-regulating molecules asthermoprotectants: functional relevance and prospects for improving heattolerance in food crops. Journal of Experimental Botany, 2020, 71(2): 569-594. Wang Haitang, Zhang Fujun. Effects of high temperature stress during the grain-filling stage on grain filling and yield of maize. Tropical Agricultural Science, 2021, 41(3):11-16. Feng Zhijuan, Xu Shengchun, Liu Na. Research progress on the mechanism of action and application of plant TCP transcription factors. Journal of Plant Genetic Resources, 2018, 19(1):112-121. Lin YF, Chen YY, Hsiao YY, Shen CY, Hsu JL, Yeh CM, Mitsuda N, Ohme-Takagi M, Liu ZJ, Tsai WC. Genome-wide identification and characterization ofTCP genes involved in ovule development of Phalaenopsis equestris. Journal of Experimental Botany, 2016, 17:5051-5066. Crawford BC, Nath U, Carpenter R. CINCINNATA controls both cell differentiation and growth in petal lobes and leaves of Antirrhinum. PlantPhysiology, 2004, 135(1):244-253. Cubas P, Coen E, Zapater J M M. Ancient asymmetries in the evolutionof flowers. Current Biology, 2001, 11(13):1050-1052. Doebley J, Stec A, Gustus C. Teosinte branched 1 and the origin ofmaize: evidence for epistasis and the evolution of dominance. Genetics, 1995,141(1):333-346. Mukhopadhyay P, Tyagi A K. OsTCP19 influences developmental andabiotic stress signaling by modulating ABI4-mediated pathways. ScientificReport, 2015,5: 9998-10008. Xu Y, Liu H, Gao Y. The TCP transcription factor PeTCP10 modulatessalt tolerance in transgenic Arabidopsis. Plant Cell Report, 2021, 40:1971-1987. Wang ST, Sun XL, Hoshino Y. MicroRNA319 positively regulates coldtolerance by targeting OsPCF6 and OsTCP21 in rice (Oryza sativa L.) . PLoSOne, 2014, 9:e91357。

Claims

1. ZmTCP5 The use of genes in regulating heat tolerance in maize, characterized by, Knockout in corn ZmTCP5 Genes that cause plants to become less sensitive to high-temperature stress, overexpression ZmTCP5 This increases the sensitivity of corn to high-temperature environments; ZmTCP5 The nucleotide sequence of the gene is shown in SEQ ID NO.

1. ZmTCP5 The amino acid sequence encoded by the gene is shown in SEQ ID NO.

2. ZmTCP5 The nucleotide sequence of the gene also includes nucleotide sequences that have substituted one or more nucleotides but encode the same amino acid sequence as SEQ ID NO.

2.

2. A method of creating a high temperature sensitive maize material, characterized in that, By transgenic technology to improve the expression of the gene of claim 1 ZmTCP5 Obtained more sensitive to high temperature corn material; or using the obtained transgenic lines by crossing, backcrossing method, obtain different genetic background of high temperature sensitive corn material.

3. A method of creating high temperature tolerant maize material, characterized by, knock out the gene of claim 1 using CRISPR / Cas9 gene editing technology or RNA interference technology ZmTCP5 Corn materials with a significantly increased sensitivity to high temperature stress are obtained.

4. The method of claim 3, wherein, The CRISPR / Cas9 gene editing selects 19 bases at the 773-791 bases of the ZmTCP5 CDS sequence and 19 bases at the 915-933 bases of the CDS sequence as the target region of the CRISPR / Cas9 gene editing, and the DNA sequences of the two CRISPR / Cas9 carrier targets are shown as SEQ ID NO. 3 or SEQ ID NO.

4.

5. A product obtained by the process of claim 4 ZmTCP5 mutated genes ZmTCP5-KO#1, ZmTCP5-KO#2 and ZmTCP5-KO#3 ; characterized in that, As claimed in claim 1 ZmTCP5 The nucleotide sequence of the gene is SEQ ID NO. 1 ZmTCP5-KO#1 deletion of 143 bp at position 776-918 in the coding region; ZmTCP5-KO#2 deletion of 1 bp at position 775 and insertion of 1 bp at position 923 in the coding region; ZmTCP5-KO#3 insertion of 63 bp and deletion of 205 bp at position 776 in the coding region.

Citation Information

Cited By

  • Method for regulating and controlling heat resistance of corn and application of method

    CN122189080A

  • Method for improving heat resistance of corn and application thereof

    CN122189081A