SNP (Single Nucleotide Polymorphism) molecular marker related to total antioxidant capacity of sperms in fresh sperms of local breeding rabbits in Fujian and application of SNP molecular marker

By developing SNP molecular markers related to the total antioxidant capacity of sperm in fresh semen of Fujian local rabbit breeds and their detection methods, the problem of low quality of fresh semen in Fujian local rabbit breeds has been solved, enabling efficient screening of high-quality semen, improving the quality of frozen semen and the conception rate of female rabbits, and protecting the genetic resources of Fujian local rabbit breeds.

CN121344205APending Publication Date: 2026-01-16INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511412469.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-29
Publication Date
2026-01-16

AI Technical Summary

Technical Problem

The quality of fresh semen from local rabbit breeds in Fujian is generally low, resulting in low quality of frozen semen that is difficult to meet the requirements for long-term preservation. Furthermore, there is insufficient research on SNP markers to effectively screen semen with high antioxidant capacity.

Method used

To develop SNP molecular markers related to the total antioxidant capacity of sperm in fresh semen of local Fujian rabbit breeds and their detection methods, by designing specific primer pairs and kits, and using PCR amplification and next-generation sequencing technology to screen individuals with high total antioxidant capacity.

Benefits of technology

This technology enables the early, efficient, and low-cost screening of high-quality fresh semen, improves the success rate of frozen semen production and the conception rate of female rabbits, and protects the genetic resources of local rabbit breeds in Fujian.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121344205A_ABST
    Figure CN121344205A_ABST
Patent Text Reader

Abstract

The invention relates to an SNP (Single Nucleotide Polymorphism) molecular marker related to total antioxidant capacity of fresh semen sperms of local breeding rabbits in Fujian and application of the SNP molecular marker. The nucleotide sequence of the SNP molecular marker is shown as SEQ ID No: 1; in the nucleotide sequence of the SNP molecular marker, the 72nd basic group from the 5'end is represented by M, M represents C or T, and the locus is related to the total antioxidant capacity of fresh semen sperms of local breeding rabbits in Fujian; the total antioxidant capacity of fresh semen and sperms of the local breeding Fujian rabbits with the genotype of homozygous TT at the site is remarkably lower than that of the local breeding Fujian rabbits with the genotype of homozygous CC and heterozygous CT at the site. The SNP molecular marker disclosed by the invention is closely related to the total antioxidant capacity of fresh semen sperms of the local breeding rabbits in Fujian, and can be effectively used for molecular marker-assisted breeding of the local breeding rabbits in Fujian. The detection method established by the invention can be used for rapidly, efficiently and accurately detecting the total antioxidant capacity of the fresh semen sperms of the Fujian local breeding rabbits.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of DNA marker technology and application in animal molecular biology, specifically involving a SNP molecular marker related to the total antioxidant capacity of sperm in fresh semen of Fujian local rabbit breeding rabbits, primer pairs for detecting the aforementioned SNP marker, the use of the aforementioned SNP marker primer pairs in the conservation of Fujian local rabbit breeding rabbit resources, and a method for detecting the total antioxidant capacity of sperm in fresh semen of Fujian local rabbit breeding rabbits. Background Technology

[0002] Located in a mountainous and hilly region, Fujian Province's unique geographical conditions have fostered several local meat rabbit breeds, primarily including the Fujian Yellow Rabbit, the Southwestern Fujian Black Rabbit, and the Fujian White Rabbit. These breeds are prized for their ability to thrive on roughage, excellent meat quality, strong adaptability, and good disease resistance, making them popular among local people and an indispensable traditional ingredient in Fujian's wedding and funeral banquets. However, with socio-economic development, the introduction of foreign breeds, and changes in the ecological environment, the population of Fujian's local rabbit breeds has been declining continuously, posing a serious threat to their genetic diversity. Therefore, it is urgent to take scientific and effective measures for their protection and utilization.

[0003] As an important agricultural genetic resource, the Fujian local rabbit breed possesses a unique genetic background and excellent environmental adaptability. Semen cryopreservation technology, as a key means of long-term preservation of germplasm resources, is particularly important in its conservation efforts. However, the main problem currently is that the quality of fresh semen from Fujian local rabbit breeds is generally low, resulting in low-quality frozen semen that cannot meet the requirements for long-term preservation. The root cause of this problem lies in the fact that the freezing-thawing process induces oxidative stress, producing excessive reactive oxygen species (ROS), which attack polyunsaturated fatty acids in sperm cell membranes, causing lipid peroxidation, and consequently leading to acrosome damage, DNA breakage, and decreased sperm motility. Therefore, screening for fresh semen with high total antioxidant capacity is crucial. This capacity directly determines whether sperm can effectively mitigate oxidative damage through their internal antioxidant balance system, maintain high post-thawing semen motility, and ultimately affect the conception rate of breeding does.

[0004] In recent years, the development of single nucleotide polymorphism (SNP) molecular marker technology has provided a new approach for rabbit breeding. As a third-generation DNA molecular marker, SNPs have advantages such as wide distribution, genetic stability, and suitability for high-throughput detection. By identifying SNP sites closely related to traits such as total antioxidant capacity in the sperm of Fujian local rabbits, a molecular marker-assisted selection system can be established. This allows for early and efficient assessment of the genetic potential of breeding rabbits, thereby selecting high-quality breeding rabbits and improving the success rate of frozen semen preparation and the conception rate of female rabbits.

[0005] Currently, research on SNP markers related to the conservation of local rabbit breeds in Fujian is still in its preliminary stage, with limited available molecular markers. There is an urgent need to conduct in-depth screening and validation of SNPs associated with functional traits such as semen quality and antioxidant capacity. Systematically advancing research on the selection of SNP markers in the semen of local rabbit breeds will not only help overcome key technical bottlenecks in frozen semen preservation but also be of great significance for protecting biodiversity and promoting the sustainable development of the rabbit industry. Summary of the Invention

[0006] The purpose of this invention is to propose an SNP molecular marker that is related to the total antioxidant capacity of sperm in fresh semen of Fujian local rabbit breeds and can be effectively used for the quality selection of semen of Fujian local rabbit breeds.

[0007] The objective of this invention is achieved through the following technical solution:

[0008] This invention provides an SNP molecular marker related to the total antioxidant capacity of fresh semen from Fujian local rabbit breeds. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID No:1, with a full length of 189 bases. The nucleotide sequence shown in SEQ ID No:1 is as follows:

[0009] 5'-AAATTTCCAGGCCGGTGCTTCGGCTCACTAGGCTAATCCTCCGCCTACGGCGCCGGTATTCTGGGTTCTAGMCCTGGTTGGGGCGCCGGTTCTGTCCCGGTTGCTCCTCTTCCAGTCCAGCTCTCTGCTGTGCCGGGAAGGCAGTGGAGGATGGCCCAAGTGCTTGGGGCTCTGCACTAGCGTGGGAGAC-3' (SEQ ID No: 1);

[0010] The nucleotide sequence of the SNP molecular marker is represented by M at the 72nd base from the 5' end, where M represents C or T.

[0011] The M at the 72nd base from the 5' end of the nucleotide sequence of the SNP molecular marker is associated with the total antioxidant capacity of fresh semen from Fujian local rabbit breeds.

[0012] Therefore, the present invention also provides the application of the aforementioned SNP molecular markers in molecular marker-assisted breeding of local Fujian rabbit breeds.

[0013] The application of the SNP molecular marker in the selection of semen quality in local Fujian rabbit breeds.

[0014] According to the application described, the M at the 72nd base from the 5' end in the nucleotide sequence of the SNP molecular marker is associated with the total antioxidant capacity of fresh semen sperm from Fujian local rabbit breeds; the total antioxidant capacity of fresh semen sperm from Fujian local rabbit breeds with the homozygous TT genotype at this locus is significantly lower than that from Fujian local rabbit breeds with the homozygous CC genotype and the heterozygous CT genotype at this locus.

[0015] The present invention also provides a primer pair for detecting the aforementioned SNP molecular marker, the nucleotide sequence of which is as follows:

[0016] Upstream primer: 5'-AAATTTCCAGGCCGGTGCT-3' (SEQ ID No:2)

[0017] Downstream primer: 5'-GTCTCCCACGCTAGTGCAG-3' (SEQ ID No:3).

[0018] The application of the primer pair in molecular marker-assisted breeding of local rabbit breeds in Fujian.

[0019] The application of the primer pair in the selection of semen quality in local Fujian rabbit breeds.

[0020] The present invention also provides a kit for detecting the SNP molecular markers, the kit comprising the primer pairs and / or a standard positive template for the SNP molecular markers.

[0021] This invention also provides the application of the kit in molecular marker-assisted breeding of Fujian local rabbit breeds. Furthermore, the kit is used in the selection of semen quality in Fujian local rabbit breeds.

[0022] This invention also provides a method for identifying the total antioxidant capacity of sperm in fresh semen from Fujian local rabbit breeds using the aforementioned primer pair, comprising the following steps:

[0023] (1) Collect genomic DNA from local rabbit breeds in Fujian;

[0024] (2) PCR amplification reaction: The primers were used to perform three rounds of PCR amplification on the genomic DNA of the Fujian local rabbit breed to be tested, and the amplification products were collected;

[0025] (3) Library mixing and purification: Transfer the PCR amplification products to the same U-shaped trough for mixing, transfer the mixture to a round-bottom centrifuge tube, vortex for 30 seconds, and then fix the centrifuge tube on a shaker overnight; load the mixed library onto an electrophoresis plate, recover the gel containing the target fragment after electrophoresis, and recover it using a purification kit. The recovered product is temporarily stored at 4°C.

[0026] (4) Genotyping and analysis: The purified products were genotyped by next-generation sequencing (NGS) using the ILLumina X-10 sequencing platform; the sequencing results were used for image recognition, genotyping and statistical analysis using Illumina RTA and Illumina bcl2fastq software.

[0027] (5) Association Analysis

[0028] The model for trait-marker association analysis is: Y ijkl =μ+G i +B j +P k +e ijkl, Among them, Y ijkl G represents the observed trait value, μ is the mean, and G is the mean. i For genotype effect, B j For variety effect, P k Due to batch effect, e ijkl The error is random; the analysis results were verified using Bonferrroni multiple comparisons.

[0029] The specific method of step (2) is as follows:

[0030] The first round of PCR amplification reaction system consisted of: 1 μL of 10× buffer, 1 μL each of 50 nM upstream and downstream primers, 0.8 μL of 2.5 mM dNTP, and 100 mM MgSO₄. 2+ 1 μL, 0.5 U hot-start Taq enzyme, 2 μL template DNA, ddH2O added to bring the total to 10 μL.

[0031] The first round of PCR amplification reaction program was: 95℃ for 15 min; followed by 4 cycles (94℃ for 30 s, 60℃ for 10 min, 72℃ for 30 s); and then 20 cycles (94℃ for 30 s, 60℃ for 1 min, 72℃ for 30 s).

[0032] Second-round PCR amplification reaction system: Take 3 μL of the first-round PCR product as template, add 1 μL of 10× buffer, 0.8 μL of 2.5 mM dNTP, and 100 mM MgSO₄. 2+ Add 1 μL of hot-start Taq enzyme 0.5 U and ddH2O to a final volume of 10 μL.

[0033] The second round of PCR amplification reaction program was as follows: 95℃ for 15 min; followed by 4 cycles (94℃ for 30 s, 60℃ for 10 min, 72℃ for 30 s); and then 40 cycles (94℃ for 30 s, 60℃ for 1 min, 72℃ for 30 s).

[0034] The third round of PCR amplification reaction system: Take 10 μL of the second round PCR product as a template, add 2 μL of 10× buffer, 3.6 μL of 2 μM barcode primers, 0.8 μL of 2.5 mM dNTPs, and 100 mM MgSO4. 2+ Add 1 μL of hot-start Taq enzyme 0.5 U and ddH2O to a final volume of 20 μL.

[0035] The third round of PCR amplification reaction program: 95℃ for 15 min; then 4 cycles (94℃ for 30 s, 60℃ for 4 min, 72℃ for 30 s); then 40 cycles (94℃ for 30 s, 60℃ for 1 min, 72℃ for 30 s).

[0036] After amplification, the PCR products were subjected to electrophoresis. 5 μL of the PCR product was loaded onto a 3% agarose gel, and the uniformity of the electrophoretic bands and the presence of any extraneous bands were observed.

[0037] Compared with the prior art, the advantages of the present invention are as follows:

[0038] 1. The SNP molecular markers of this invention are closely related to the total antioxidant capacity of sperm in fresh semen of Fujian local rabbit breeders, and can be effectively used for marker-assisted breeding of Fujian local rabbit breeders. Furthermore, based on the actual needs of frozen semen production, early screening of the total antioxidant capacity of sperm in fresh semen of Fujian local rabbit breeding materials can be performed, thereby effectively improving the success rate of frozen semen production and the fertilization rate of female rabbits, better meeting the needs of long-term preservation of Fujian local livestock and poultry genetic resources. In addition, using the SNP markers of this invention for marker-assisted breeding of Fujian local rabbit breeders has the advantages of early screening, time saving, low cost, and high accuracy.

[0039] 2. The primer pairs of the present invention can effectively detect the SNP molecular markers of the present invention that are related to the total antioxidant capacity of sperm in fresh semen of Fujian local rabbit breeds.

[0040] 3. The method of the present invention for detecting the total antioxidant capacity of sperm in fresh semen of Fujian local rabbit breeders can quickly, efficiently and accurately detect the total antioxidant capacity of sperm in fresh semen of Fujian local rabbit breeders. This method can be effectively used for molecular marker-assisted selection of Fujian local rabbit breeders, thereby helping to achieve the early, short-term, low-cost and high-accuracy selection of superior individuals of Fujian local rabbit breeders with high-quality semen. Attached Figure Description

[0041] Figure 1 This is an electrophoresis image of the amplification product. The target fragment size is 189bp. Lane 1 is the DL2000 marker, and lane 2 is the target band for PCR amplification.

[0042] Figure 2This is a sequencing result diagram of DNA from different genotypes at position 72 of the SEQ1 sequence of the present invention; wherein, there is a C / T allele mutation at position M at position 72 of the SEQ1 sequence of the present invention, and the mutation position is marked with * in the diagram, which is the molecular marker screened by the present invention.

[0043] Figure 3 This invention presents a genotyping diagram of SNP sites related to the total antioxidant capacity of sperm in fresh semen from local Fujian rabbit breeds. Detailed Implementation

[0044] This invention provides an SNP molecular marker related to the total antioxidant capacity of fresh semen from Fujian local rabbit breeds. The SNP molecular marker is the nucleotide sequence shown in SEQ ID No:1 (189 bases in total length), with M representing C or T at the 72nd base from the 5' end. The nucleotide sequence shown in SEQ ID No:1 is as follows:

[0045] 5'-AAATTTCCAGGCCGGTGCTTCGGCTCACTAGGCTAATCCTCCGCCTACGGCGCCGGTATTCTGGGTTCTAGMCCTGGTTGGGGCGCCGGTTCTGTCCCGGTTGCTCCTCTTCCAGTCCAGCTCTCTGCTGTGCCGGGAAGGCAGTGGAGGATGGCCCAAGTGCTTGGGCTCTGCACTAGCGTGGGAGAC-3' (SEQ ID NO: 1).

[0046] The inventors discovered that the total antioxidant capacity of fresh semen sperm from Fujian local rabbit breeders with the homozygous TT genotype at this locus was significantly lower than that of Fujian local rabbit breeders with the homozygous CC genotype and the heterozygous CT genotype. By detecting the aforementioned SNP in Fujian local rabbit breeders, the total antioxidant capacity of their fresh semen sperm can be effectively determined. Specifically, as mentioned above, the total antioxidant capacity of fresh semen sperm from Fujian local rabbit breeders with the homozygous TT SNP locus is significantly lower than that of Fujian local rabbit breeders with the homozygous CC genotype or the heterozygous CT genotype. For example, if the genotype of this SNP locus is TT, then the tested Fujian local rabbit breeder can be identified as an individual with low total antioxidant capacity in fresh semen sperm. Therefore, the inventors determined that the SNP marker of this invention is closely related to the total antioxidant capacity of fresh semen sperm from Fujian local rabbit breeders and can be effectively used for molecular marker-assisted breeding of Fujian local rabbit breeders. This allows for early selection of Fujian local rabbit breeding stock with high total antioxidant capacity in fresh semen based on actual requirements for frozen semen production and female rabbit conception rates. This further effectively improves the efficiency of frozen semen production and female rabbit mating rates, meeting the long-term preservation needs of Fujian's local livestock resources. Furthermore, according to some embodiments of the present invention, using the SNP markers of this invention for molecular marker-assisted breeding of Fujian local rabbits offers advantages such as early screening, time saving, low cost, and high accuracy.

[0047] The present invention will now be described in detail with reference to the accompanying drawings and embodiments:

[0048] Example 1: A method for identifying the total antioxidant capacity of fresh semen from Fujian local rabbit breeds.

[0049] 1. Source of laboratory animals

[0050] The Fujian local rabbit breed used in this embodiment is as follows:

[0051] Fujian Yellow Rabbit, purchased from Lianjiang Yuhuashan Natural Ecological Agriculture Experimental Farm.

[0052] The Minnan Black Rabbit from Southwest Fujian was purchased from Dehua County Jisheng Black Rabbit Breeding Co., Ltd.

[0053] The Minnan Black Rabbit (Minxi Group) was purchased from Longyan Tongxian Rabbit Industry Development Co., Ltd.

[0054] Fujian White Rabbit, purchased from Fujian Xuechun Agriculture and Animal Husbandry Co., Ltd.

[0055] 2. Rabbit genomic DNA extraction

[0056] Blood was collected from the ear vein of local Fujian rabbit breeds, anticoagulated with EDTA, and leukocytes were isolated. A blood / cell / tissue genomic DNA extraction kit was used. Total DNA was extracted from leukocytes of local Fujian rabbit breeds, dissolved in TE buffer, and stored at -20°C for later use. The specific method for extracting rabbit genomic DNA using the kit is a routine procedure and will not be elaborated upon here.

[0057] 3. SNP site screening

[0058] 3.1 Primer Design

[0059] Primer pairs related to the SNP molecular marker were designed based on the rabbit nuclear factor E2-related factor 2 (NFE2L2) gene to detect the gene fragment containing the aforementioned SNP site. The primer pairs have the nucleotide sequences shown in SEQ ID No: 2-3, and their specific sequences are as follows:

[0060] SEQ ID No: 2 (upstream primer): 5'-AAATTTCCAGGCCGGTGCT-3',

[0061] SEQ ID No: 3 (downstream primer): 5'-GTCTCCCACGCTAGTGCAG-3'.

[0062] The primer pair was synthesized by Shanghai Yingjun Biotechnology Co., Ltd.

[0063] 3.2 PCR amplification reaction

[0064] Using the extracted DNA as a template, the genomic DNA of the Fujian local rabbit breed (SEQ No: 2-3) was amplified by three rounds of PCR using the primers described above. The PCR reaction system and conditions for the three rounds of PCR amplification are as follows:

[0065] (1) First round of PCR

[0066] Reaction system (10 μL): 1 μL 10× buffer, 1 μL each of 50 nM forward and reverse primers, 0.8 μL 2.5 mM dNTP, 100 mM MgSO₄. 2+ 1 μL, 0.5 U hot-start Taq enzyme, 2 μL template DNA, ddH2O added to bring the total to 10 μL.

[0067] Reaction program: 95℃ for 15 min; followed by 4 cycles (94℃ for 30 s, 60℃ for 10 min, 72℃ for 30 s); then 20 cycles (94℃ for 30 s, 60℃ for 1 min, 72℃ for 30 s).

[0068] (2) Second round of PCR

[0069] Reaction system (10 μL): Take 3 μL of the first round PCR product as template, add 1 μL of 10× buffer, 0.8 μL of 2.5 mM dNTP, and 100 mM MgSO4. 2+ Add 1 μL of hot-start Taq enzyme 0.5 U and ddH2O to a final volume of 10 μL.

[0070] Reaction program: 95℃ for 15 min; followed by 4 cycles (94℃ for 30 s, 60℃ for 10 min, 72℃ for 30 s); then 40 cycles (94℃ for 30 s, 60℃ for 1 min, 72℃ for 30 s).

[0071] (3) Third round of PCR (with barcode)

[0072] Reaction system (20 μL): Take 10 μL of the second-round PCR product directly as template, add 2 μL of 10× buffer, 3.6 μL of 2 μM barcode primers, 0.8 μL of 2.5 mM dNTPs, and 100 mM MgSO4. 2+ Add 1 μL of hot-start Taq enzyme 0.5 U and ddH2O to a final volume of 20 μL.

[0073] Reaction program: 95℃ for 15 min; followed by 4 cycles (94℃ for 30 s, 60℃ for 4 min, 72℃ for 30 s); then 40 cycles (94℃ for 30 s, 60℃ for 1 min, 72℃ for 30 s).

[0074] The Barcode primers are existing primers, provided by Shanghai Yihe Applied Biotechnology Co., Ltd.

[0075] After amplification, the PCR products were subjected to electrophoresis. 5 μL of the PCR product was loaded onto a 3% agarose gel, and the uniformity of the electrophoretic bands and the presence of any extraneous bands were observed. The electrophoresis pattern of the amplified products is shown below. Figure 1 As shown, sequencing was performed, and the sequencing results are as follows. Figure 2 As shown.

[0076] 3.3 Library pooling and purification

[0077] Transfer 5 μL of each PCR amplification product to the same U-shaped trough and mix. Transfer 200 μL of the mixture to a round-bottom centrifuge tube and vortex for 30 seconds. Then, fix the centrifuge tube on a shaker and incubate overnight. Load the mixed library onto an electrophoresis apparatus. After electrophoresis, recover the gel containing the target fragment and use a purification kit to recover the product. Store the recovered product at 4°C.

[0078] 4. Genotyping and Analysis

[0079] Step 3.3 The purified product was subjected to next-generation sequencing (NGS) using the Illumina X-10 sequencing platform. Sequencing results were analyzed using Illumina RTA and Illumina bcl2fastq software for image recognition, genotyping, and statistical analysis. Genotyping of SNPs related to total antioxidant capacity in fresh semen from Fujian local rabbit breeds is shown below. Figure 3 .

[0080] 5. Association analysis between SNP molecular markers and total antioxidant capacity of fresh semen from Fujian local rabbit breeds

[0081] Analysis of variance was performed using a trait-marker association analysis model to analyze the association between each genotype of polymorphic sites and the total antioxidant capacity of fresh semen from Fujian local rabbit breeds.

[0082] The model for trait-marker association analysis is: Y ijkl =μ+G i +B j +P k +e ijkl

[0083] Among them, Y ijkl G represents the observed trait value, μ is the mean, and G is the mean. i For genotype effect, B j For variety effect, P k Due to batch effect, e ijkl The error is random. The analysis results were validated using Bonferrroni multiple comparisons, and the results are shown in Table 1.

[0084] Table 1 shows that the mean total antioxidant capacity of fresh semen from TT genotype individuals was significantly different from that of CC and CT genotype individuals (P<0.01). This further demonstrates that the nucleotide sequence shown in SEQ ID No:1, with C or T at the 72nd base from the 5' end, is significantly correlated with the total antioxidant capacity of fresh semen from Fujian local rabbit breeds (P<0.01), indicating it is a SNP marker associated with the total antioxidant capacity of fresh semen from Fujian local rabbit breeds. The total antioxidant capacity of fresh semen from TT genotype individuals with this SNP marker was significantly lower than that from CC and CT genotype individuals.

[0085] Table 1. Genotype frequencies of SNP loci and their association with total antioxidant capacity of fresh semen from breeding rabbits.

[0086]

[0087] Note: Different lowercase superscript letters indicate highly significant differences (P<0.01).

[0088] The method for detecting the total antioxidant capacity of fresh semen from Fujian local rabbit breeding rabbits provided by this invention, as described in the embodiments of this invention, involves detecting the SNP markers in the Fujian local rabbit breeding rabbits to determine the total antioxidant capacity of the fresh semen. Specifically, the Fujian local rabbit breeding rabbits to be tested can be subjected to PCR amplification and sequencing using reagents such as the primer pairs described above, which are capable of detecting SNP markers related to the total antioxidant capacity of fresh semen from Fujian local rabbit breeding rabbits according to this invention. This allows for the detection and determination of the genotype of the aforementioned SNP markers in the Fujian local rabbit breeding rabbits to be tested, and the total antioxidant capacity of the fresh semen from the Fujian local rabbit breeding rabbits to be tested can be effectively determined based on the obtained genotype. As mentioned above, the total antioxidant capacity of fresh semen from Fujian local rabbit breeding rabbits with a homozygous TT genotype at the SNP marker site is significantly lower than that of Fujian local rabbit breeding rabbits with a homozygous CC genotype and a heterozygous CT genotype at the same site. For example, when the genotype at this site is TT, the Fujian local rabbit breeding rabbits to be tested belong to individuals with low total antioxidant capacity of fresh semen. Therefore, the method for detecting the total antioxidant capacity of sperm in fresh semen of Fujian local rabbit breeders according to the present invention can quickly, efficiently and accurately detect the total antioxidant capacity of sperm in fresh semen of Fujian local rabbit breeders. This method can be effectively used for molecular marker-assisted selection of Fujian local rabbit breeders, thereby helping to achieve the early, short-term, low-cost and high-accuracy selection of superior individuals of Fujian local rabbit breeders with high-quality semen.

[0089] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A SNP molecular marker related to the total antioxidant capacity of fresh semen sperm of Fujian local rabbit breed rabbits, characterized by: The nucleotide sequence of the SNP molecular marker is as follows: 5'-AAATTTCCAGGCCGGTGCTTCGGCTCACTAGGCTAATCCTCCGCCTACGGCGCCGGTATTCTGGGTTCTAGMCCTGGTTGGGGCGCCGGTTCTGTCCCGGTTGCTCCTCTTCCAGTCCAGCTCTCTGCTGTGCCGGGAAGGCAGTGGAGGATGGCCCAAGTGCTTGGGCTCTGCACTAGCGTGGGAGAC-3'; The M at the 72nd base from the 5' end in the nucleotide sequence of the SNP molecular marker represents C or T.

2. The SNP molecular marker of claim 1, wherein: The M at the 72nd base from the 5' end in the nucleotide sequence of the SNP molecular marker is related to the total antioxidant capacity of fresh semen sperm of Fujian local rabbit breed rabbits.

3. The SNP molecular marker of claim 1 is applied in molecular marker assisted breeding of Fujian local rabbit breed rabbits.

4. The SNP molecular marker of claim 1 is applied in semen quality selection of Fujian local rabbit breed rabbits.

5. Use according to claim 3 or 4, characterized in that: The M at the 72nd base from the 5' end in the nucleotide sequence of the SNP molecular marker is related to the total antioxidant capacity of fresh semen sperm of Fujian local rabbit breed rabbits; the total antioxidant capacity of fresh semen sperm of Fujian local rabbit breed rabbits with the genotype of homozygous TT at this site is significantly lower than that of Fujian local rabbit breed rabbits with the genotype of homozygous CC and heterozygous CT at this site.

6. A primer pair for detecting the SNP molecular marker of claim 1, wherein the primer pair comprises: a forward primer of SEQ ID NO: 1 or 3; and a reverse primer of SEQ ID NO: 2 or 4. The nucleotide sequences of the primer pair are as follows: Upstream primer: 5'-AAATTTCCAGGCCGGTGCT-3', Downstream primer: 5'-GTCTCCCACGCTAGTGCAG-3'.

7. The primer pair of claim 6 is applied in molecular marker assisted breeding of Fujian local rabbit breed rabbits.

8. The primer pair of claim 6 is applied in semen quality selection of Fujian local rabbit breed rabbits.

9. A method for identifying the total antioxidant capacity of fresh semen sperm of Fujian local rabbit breed rabbit using the primer pair of claim 6, characterized by: It comprises the following steps: (1) Collecting genomic DNA of Fujian local rabbit breed rabbits; (2) PCR amplification reaction: using the primer pair to perform three rounds of PCR amplification on the genomic DNA of the Fujian local rabbit breed rabbits to be tested, and collecting the amplification products; (3) Library mixing and purification: transferring the PCR amplification products to the same U-shaped groove to mix, transferring the mixture to a round-bottom centrifuge tube, vortexing for 30S, and then fixing the centrifuge tube on a shaker for overnight shaking; electrophoresis after mixing the library, recovering the gel block containing the target fragment, recovering by a purification kit, and storing the recovered product at 4°C temporarily; (4) Genotyping and analysis: the purified product is subjected to next-generation sequencing (NGS, Next-generation sequencing) by ILLumina X-10 sequencing platform.

10. The method of claim 9, wherein: In the step (2), the PCR reaction system and the PCR reaction program of the three rounds of PCR amplification are as follows: First round of PCR: Reaction system (10 μL): 1 μL of 10x buffer, 1 μL of 50 nM upstream and downstream primers, 0.8 μL of 2.5 mM dNTP, 1 μL of 100 mM Mg 2+ 1 μL, 0.5 U of hot-start Taq enzyme, 2 μL of template DNA, and ddH2O to 10 μL. Reaction program: 95°C 15 min; followed by 4 cycles (94°C 30 s, 60°C 10 min, 72°C 30 s); then 20 cycles (94°C 30 s, 60°C 1 min, 72°C 30 s); Second round of PCR: Reaction system (10 μL): Take 3 μL of the first round PCR product as template, add 1 μL of 10 x buffer, 0.8 μL of 2.5 mM dNTP, 1 μL of 100 mM Mg 2+ 1 μL, 0.5 U of hot-start Taq enzyme, and ddH2O to 10 μL; Reaction program: 95°C 15 min; followed by 4 cycles (94°C 30 s, 60°C 10 min, 72°C 30 s); then 40 cycles (94°C 30 s, 60°C 1 min, 72°C 30 s); Third round of PCR (with Barcode): Reaction system (20 μL): 10 μL of the second round PCR product was directly taken as template, 2 μL of 10x buffer, 3.6 μL of 2 μM Barcode primer, 0.8 μL of 2.5 mM dNTP, 1 μL of 100 mM Mg 2+ 1 μL, 0.5 U of hot-start Taq enzyme, and ddH2O was added to 20 μL. Reaction program: 95°C 15 min; followed by 4 cycles (94°C 30 s, 60°C 4 min, 72°C 30 s); then 40 cycles (94°C 30 s, 60°C 1 min, 72°C 30 s).