Saccharomyces cerevisiae engineering strain for producing naringenin, construction method and application

Abstract

The invention belongs to the technical field of biology, and discloses a saccharomyces cerevisiae engineering strain for producing naringenin, a construction method and application, the saccharomyces cerevisiae engineering strain contains tyrosine ammonia lyase gene TAL, 4-cumaric acid: coenzyme A ligase gene 4CL, chalcone synthase gene CHS, chalcone isomerase gene CHI, oligopeptide gene RIADn-RGGm and oligopeptide gene RIDD; the ARO10 gene, the FDC1 gene, the PAD1 gene and the PDC5 gene are knocked out. The engineering strain disclosed by the invention can be used for synthesizing naringenin by taking L-tyrosine as a substrate, and the engineering strain is stable in hereditary character and excellent in naringenin yield which can reach 27.45 mg / L; and the fermentation production of the product can be carried out through relatively simple method conditions, so that the method has a very wide application prospect.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology, and particularly relates to a naringenin-producing Saccharomyces cerevisiae engineering strain, a construction method and application thereof. BACKGROUND

[0002] Naringenin belongs to dihydroflavonoids, is one of important skeletons of flavonoids, has various pharmacological activities such as antioxidation, anti-inflammatory, antibacterial, antitumor, antiviral, anti-aging, liver protection, and has good application prospects in the fields of food, medicine and the like. Naringenin is converted into dihydroquercetin by flavonoid 3'-hydroxylase and cytochrome P450 reductase 1 and flavonoid 3-hydroxylase; further, the dihydroquercetin is converted into quercetin by flavonol synthase. Diydroquercetin is a dihydroflavonol compound, belongs to vitamin P family, has functions and characteristics such as antitumor, antiviral, antioxidant, free radical scavenging, and is widely applied in the industries of medicine, health care products, food, agriculture, industry and the like. Plant extraction and chemical synthesis are main methods for obtaining naringenin. The main raw material of the plant extraction method is pomelo peel, but the extraction efficiency is low. The chemical synthesis method can well avoid using a large amount of plants as raw materials, but the steps are complicated and there is a risk of environmental pollution, therefore, the microbial synthesis of naringenin has become a potential production method due to the advantages of short process cycle, high efficiency, environmental friendliness, clear synthesis path and the like.

[0003] In the existing microbial synthesis technology, the modification of key enzyme activity and metabolic pathway is mainly focused on, but the modification of enzyme activity and metabolic pathway cannot solve the problem that the key enzyme is distributed dispersedly in the cytoplasm, causing the diffusion of intermediate products, and ultimately leading to the reduction of intracellular enzymatic reaction rate and low synthesis efficiency. Therefore, in order to realize the efficient production of target products in microorganisms, a construction method of a Saccharomyces cerevisiae engineering strain for self-assembly of key enzymes in the synthesis path is of great significance.

[0004] Therefore, there is an urgent need in the art to develop a strain or technical method for effectively improving the intracellular naringenin content.

[0005] Through retrieval, the following 4 patent publications related to the patent application of the application are found: 1. A genetically engineered bacterium for synthesizing naringenin using tyrosine as a substrate and a construction method thereof (CN103484420A), the construction method comprising the following steps: introducing a gene matB encoding malonate transporter, a gene matC of malonate uptake pathway, a gene of tyrosine deaminase (TAL), a 4-coumaric acid: coenzyme A ligase (4CL) gene, a chalcone synthase (CHS) gene, a chalcone isomerase (CHI) gene, a total of six genes constituting a synthesis pathway into Escherichia coli BL21, thereby obtaining a recombinant bacterium capable of synthesizing naringenin using tyrosine as a substrate, and optimizing the synthesis pathway by modularization modification theory to improve the yield of naringenin.

[0006] 2. A Saccharomyces cerevisiae strain for de novo synthesis of naringenin and a construction method and application thereof (CN115851810A), the construction method comprising the following steps: knocking out substrate competition pathway genes and overexpressing anti-feedback inhibition genes to improve the metabolic flux of precursor tyrosine; heterologously expressing tyrosine deaminase, 4-coumaric acid: CoA-ligase, chalcone synthase and chalcone isomerase to realize de novo synthesis of naringenin. Finally, the yield of naringenin is further improved by high-efficiency expression of Sc 4CL and Ha CHS in multiple copies.

[0007] 3. A Saccharomyces cerevisiae strain for producing naringenin (CN113862166A), the construction method comprising the following steps: constructing plasmid A expressing an aromatic amino acid synthesis module, constructing plasmid B expressing a coumaric acid and cinnamic acid generation module, constructing plasmid C expressing a naringenin synthesis module, transforming plasmid A, plasmid B and plasmid C into Saccharomyces cerevisiae BY4742, and screening the transformants to obtain an engineered bacterium capable of producing naringenin by fermentation.

[0008] 4. A method for synthesizing naringenin using tyrosine as a substrate (CN114606279A), the construction method comprising the following steps: constructing a recombinant strain by introducing tyrosine deaminase gene TAL, 4-coumaric acid: coenzyme A ligase gene 4CL, chalcone synthase gene CHS, chalcone isomerase gene CHI, malonate transporter gene MatC and malonyl coenzyme A synthetase gene MatB into E. coli 13032 (DE3), and optimizing the naringenin synthesis pathway of the recombinant strain by modularization modification theory and optimizing the substrate composition by adding sodium malonate to increase the yield of naringenin. C. glutamicum

[0009] By comparison, the patent application of the present application is essentially different from the above-mentioned patent disclosure. SUMMARY

[0010] ​The purpose of this invention is to overcome the shortcomings of the prior art and provide an engineered strain of Saccharomyces cerevisiae that produces naringenin, its construction method, and its application.

[0011] The technical solution adopted by this invention to solve its technical problem is: A *Saccharomyces cerevisiae* strain producing naringin, wherein the strain contains the following genes: tyrosine ammonia-lyase gene TAL (SEQ ID NO. 1), 4-coumaric acid:coenzyme A ligase gene 4CL (SEQ ID NO. 2), chalcone synthase gene CHS (SEQ ID NO. 3), chalcone isomerase gene CHI (SEQ ID NO. 4), short peptide gene RIADn-RGGm (SEQ ID NO. 5), where n=1-3, m=2-5, and short peptide gene RIDD (SEQ ID NO. 6); and the following gene is knocked out: SEQ ID NO. 7. ARO10 Gene, shown in SEQ ID NO. 8 FDC1 Gene, shown in SEQ ID NO. 9 PAD1 Gene, shown in SEQ ID NO. 10 PDC5 Gene.

[0012] Furthermore, the tyrosine ammonia-lyase gene TAL, the 4-coumaric acid:coenzyme A ligase gene 4CL, the chalcone synthase gene CHS, the chalcone isomerase gene CHI, and the short peptide gene RIADn-RGGm are expressed on the chromosome of *Saccharomyces cerevisiae*, and the original host strain used includes *Saccharomyces cerevisiae* (…). Saccharomyces cerevisiae BY4741, BY4742, or BY4743; Alternatively, the tyrosine ammonia-lyase gene TAL has the nucleotide sequence shown in SEQ ID NO. 1, or a nucleotide sequence obtained by substitution, deletion or addition of one or more bases to the nucleotide sequence shown in SEQ ID NO. 1, or a nucleotide sequence that has at least 90% homology with the nucleotide sequence shown in SEQ ID NO. 1; and its function is the same as or similar to that of the nucleotide sequence shown in SEQ ID NO. 1. And / or the 4-coumaric acid:coenzyme A ligase gene 4CL has the nucleotide sequence shown in SEQ ID NO. 2, or a nucleotide sequence obtained by substitution, deletion or addition of one or more bases to the nucleotide sequence shown in SEQ ID NO. 2, or a nucleotide sequence that has at least 90% homology with the nucleotide sequence shown in SEQ ID NO. 2; and has the same or similar function as the nucleotide sequence shown in SEQ ID NO. 2; and / or the chalcone synthase gene CHS has a nucleotide sequence as shown in SEQ ID NO. 3, or a nucleotide sequence obtained by substitution, deletion, or addition of one or more bases of the nucleotide sequence as shown in SEQ ID NO. 3, or a nucleotide sequence having at least 90% homology with the nucleotide sequence as shown in SEQ ID NO. 3; and functions the same as or similar to the nucleotide sequence as shown in SEQ ID NO. 3; and / or the chalcone isomerase gene CHI has a nucleotide sequence as shown in SEQ ID NO. 4, or a nucleotide sequence obtained by substitution, deletion, or addition of one or more bases of the nucleotide sequence as shown in SEQ ID NO. 4, or a nucleotide sequence having at least 90% homology with the nucleotide sequence as shown in SEQ ID NO. 4; and functions the same as or similar to the nucleotide sequence as shown in SEQ ID NO. 4.

[0013] and / or the short peptide gene RIADn-RGGm has a nucleotide sequence as shown in SEQ ID NO. 5, or a nucleotide sequence obtained by substitution, deletion, or addition of one or more bases of the nucleotide sequence as shown in SEQ ID NO. 5, or a nucleotide sequence having at least 90% homology with the nucleotide sequence as shown in SEQ ID NO. 5; and functions the same as or similar to the nucleotide sequence as shown in SEQ ID NO. 5.

[0014] Further, the tyrosine ammonia-lyase gene (TAL) is derived from Flavobacterium johnsoniae (GenBank No. AYF 12673.1), the 4-coumaric acid-CoA ligase gene (4CL) is derived from Populus tomentosa (GenBank No. AYF 12673.1), the chalcone synthase gene (CHS) is derived from Sophora japonica (GenBank No. AYF 12673.1), the chalcone isomerase gene (CHI) is derived from Medicago sativa (GenBank No. AYF 12673.1), the RIDD gene is derived from the N-terminal of cAMP-dependent protein kinase (PKAs), the RIAD gene is derived from the amphipathic helix RIAD on the anchoring domain of A kinase-anchoring proteins AKAP, and the RGG gene is derived from LAF-1. Flavobacterium johnsoniae Populus tomentosa Sophora japonica Medicago sativa

[0015] ​​​​Further, the nucleotide sequences of the tyrosine ammonia-lyase gene TAL from Flavobacterium johnsoniae, the 4-coumarate: coenzyme A ligase gene 4CL from Populus tomentosa, the chalcone synthase gene CHS from Sophora japonica, the chalcone isomerase gene CHI from Medicago sativa, the short peptide gene RIDD from the N-terminal of cAMP-dependent protein kinase (PKAs), the short peptide gene RIAD from the amphipathic helix on the anchor domain of A-kinase anchoring proteins (AKAPs), and the short peptide gene RGG from LAF-1 are partially or fully optimized according to the codon bias of Saccharomyces cerevisiae.

[0016] The method for constructing the Saccharomyces cerevisiae engineering strain as described above, characterized in that it comprises the following steps: (1) The codons of the target genes tyrosine ammonia-lyase gene TAL, 4-coumarate: coenzyme A ligase gene 4CL, chalcone synthase gene CHS, chalcone isomerase gene CHI, short peptide gene RIDD, short peptide gene RIAD, and short peptide gene RGG are partially or fully optimized according to the codon bias of Saccharomyces cerevisiae, and then the target gene fragments are obtained by gene synthesis; Fj TAL, 4-coumarate: coenzyme A ligase gene 4CL, Pt CHS, chalcone isomerase gene CHI, Sj CHS, chalcone isomerase gene CHI, Ms CHI, short peptide gene RIDD, short peptide gene RIAD, and short peptide gene RGG are partially or fully optimized according to the codon bias of Saccharomyces cerevisiae, and then the target gene fragments are obtained by gene synthesis; (2) The components of the gene expression cassette are obtained by overlap extension PCR, and specific primers with homologous arms are designed to amplify the components of the target fragments, including a promoter, a termination sequence, a target gene fragment, a screening tag gene fragment, and 300-700 bp homologous sequences on the upstream and downstream of the integration site, so that the gene to be expressed is provided with a Saccharomyces cerevisiae constitutive or inducible strong promoter and termination sequence, and the DNA fragment of the expression frame is obtained by PCR technology or vector construction method; (3) The homologous arm sequences of 300-700 bp on the upstream and downstream of the target integration site are amplified by specific primers to obtain the gene expression frame, which is transformed into Saccharomyces cerevisiae cells by lithium acetate transformation method, so as to obtain the gene expression frame fragment integrated and expressed at a specific site on the chromosome of Saccharomyces cerevisiae; (4) The Saccharomyces cerevisiae recombinant strain is subjected to positive clone screening by a screening type culture medium; (5) The single colony grown on the screening culture medium plate is inoculated into YEPD liquid culture medium, and cultured for 16-36 h, and the genome is subjected to PCR amplification verification, so as to obtain the naringenin-producing Saccharomyces cerevisiae engineering strain.

[0017] Further, the gene expression cassette is first constructed on plasmids pRS416, pRS426, and pRS425, specifically as follows: (1) The codon-optimized heterologous gene fragments TAL, 4CL, CHS, CHI, RIDD, RIAD, and RGG are respectively inserted into the restriction enzyme digestion sites of the plasmids pRS416, pRS426, and pRS425 to obtain the gene expression cassettes pRS416-TAL, pRS426-4CL, pRS426-CHS, pRS426-CHI, pRS426-RIDD, pRS426-RIAD, and pRS426-RGG; FjTAL, Pt 4CL, Sj CHS, Ms CHI, RIAD, RGG, RIDD are templates, and a gene fragment is obtained by PCR amplification Fj TAL, Pt 4CL, Sj CHS, Ms CHI, RIADn-RGGm, RIDD, and the sequences are SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6 in turn; the plasmid pUG27 is taken as a template, and PCR amplification is carried out to obtain P TEF1 - Sphis5 + - T TEF1 Screening marker gene fragment; the plasmid pUG6 is taken as a template, and PCR amplification is carried out to obtain P TEF1 - KanMX - T TEF1 Screening marker gene fragment; the plasmid P TEF1 - hphMX6 - T TEF1 -pUG27 as a template, PCR amplification is carried out to obtain P TEF1 - hphMX6 - T TEF1 Screening marker gene fragment; the plasmid P TEF1 - Ble - T TEF1 -pUG27 as a template, PCR amplification is carried out to obtain P TEF1 - Ble - T TEF1 Screening marker gene fragment; the plasmid pYX212 is taken as a template, and PCR amplification is carried out to obtain P TPI1 Promoter; the plasmid pYES2.0 is taken as a template, and PCR amplification is carried out to obtain T CYC1 Termination sequence fragment; the plasmid P CUP1 -pRS416 as a template, PCR amplification is carried out to obtain P CUP1Promoter; the plasmid pSH65 is used as a template to perform PCR amplification to obtain P TEF1 Promoter (2) The plasmids pRS416, pRS426 and pRS425 are used as vectors, specific restriction enzyme double enzyme digestion sites are selected, the vectors are digested, the digestion products are separated by agarose gel electrophoresis, and the gel is cut and recovered and purified to obtain linearized vectors; (3) The fragments are connected to the vectors by using seamless cloning enzymes, the connection products are transformed into E. coli competent cells DH5a, positive transformants are obtained on a culture medium with an end concentration of 0.1 g / L ampicillin resistance, plasmids are extracted, and sequencing verification is performed to obtain a recombinant plasmid; Alternatively, the specific steps of the construction method are as follows: (1) The target gene tyrosine ammonia lyase gene Fj TAL, 4-coumaric acid: coenzyme A ligase gene Pt 4CL, chalcone synthase gene Sj CHS, chalcone isomerase gene Ms CHI, short peptide gene RIDD, short peptide gene RIAD and short peptide gene RGG are partially or completely optimized, and then the target gene fragments are obtained by gene synthesis, and Kpn I restriction enzyme DNA sequences are added at the 5' end and Sac II restriction enzyme DNA sequences are added at the 3' end; (2) The synthesized genes are used as templates to perform PCR amplification to obtain heterologous gene fragments Fj TAL, Pt 4CL, Sj CHS, Ms CHI, RIAD, RGG, RIDD; the plasmid pUG27 is used as a template to perform PCR amplification to obtain P TEF1 - Sphis5 + - T TEF1 Screening marker gene fragment; the plasmid pUG6 is used as a template to perform PCR amplification to obtain P TEF1 - KanMX - T TEF1 Screening marker gene fragment; the plasmid P TEF1 - hphMX6 - T TEF1 pUG27 is used as a template to perform PCR amplification to obtain P TEF1 - hphMX6 -T TEF1 Screening marker gene fragment; plasmid pYX212 as template, PCR amplification to obtain P TEF1 - Ble - T TEF1 -pUG27 as template, PCR amplification to obtain P TEF1 - Ble - T TEF1 Screening marker gene fragment; plasmid pYX212 as template, PCR amplification to obtain P TPI1 Promoter; plasmid pYES2.0 as template, PCR amplification to obtain T CYC1 Termination sequence; plasmid P CUP1 -pRS416 as template, PCR amplification to obtain P CUP1 Promoter; plasmid pSH65 as template, PCR amplification to obtain P TEF1 Promoter; Saccharomyces cerevisiae BY4741 genome as template, PCR amplification to obtain 300-700 bp homologous arm sequences upstream and downstream of the gene integration site; (3) Using plasmids pRS416, pRS426 and pRS425 as vectors, selecting specific restriction enzyme double enzyme digestion sites, cutting the vectors, separating the enzyme digestion products by agarose gel electrophoresis, and cutting and recovering the gel to obtain linearized vectors; (4) Using seamless cloning enzyme to link the fragments with the vectors, transforming the ligation products into E. coli competent cells DH5α, obtaining positive transformants on the medium with a final concentration of 0.1 g / L ampicillin resistance, extracting the plasmids, and sequencing to obtain the recombinant plasmid; (5) The constructed gene expression cassette P CUP1 - RIDD - Pt4CL - T CYC1 - P TPI1 - RIDD - FjTAL - T CYC1 - P TEF1 - hphMX6 - T TEF1 PCR amplification, the obtained DNA fragments were transformed into Saccharomyces cerevisiae cells by lithium acetate transformation method, and integrated into theARO10 sites, and the yeast engineering strains expressing TAL, 4CL, CHS, CHI simultaneously were obtained on solid medium with 0.1-0.3 g / L geneticin. Fj TAL and Pt 4CL of Saccharomyces cerevisiae; (6) the constructed gene expression cassette P TEF1 - SjCHS - T CYC1 - P TEF1 - KanMX - T TEF1 PCR amplification was performed, the obtained DNA fragments were transformed into Saccharomyces cerevisiae cells by lithium acetate transformation method, and were integrated into the FDC1 sites, and the yeast engineering strains expressing TAL, 4CL, CHS simultaneously were obtained on solid medium with 0.1-0.3 g / L geneticin. Fj TAL, Pt 4CL, Sj CHS of Saccharomyces cerevisiae; (7) the constructed gene expression cassette P TPI1 - MsCHI - T CYC1 - P TEF1 - Sphis5 + - T TEF1 PCR amplification was performed, the obtained DNA fragments were transformed into Saccharomyces cerevisiae cells by lithium acetate transformation method, and were integrated into the PAD1 sites, and the yeast engineering strains expressing TAL, 4CL, CHS, CHI simultaneously were obtained on histidine auxotrophic solid medium. Fj TAL, Pt 4CL, Sj CHS, Ms CHI of Saccharomyces cerevisiae; (8) the constructed gene expression cassette P CUP1 - RIADn - RGGm - T CYC1 - P TEF1 - Ble - T TEF1 PCR amplification was performed, the obtained DNA fragments were transformed into Saccharomyces cerevisiae cells by lithium acetate transformation method, and were integrated into the PDC5Site, solid medium with 0.05-0.2 g / L bleomycin to obtain Saccharomyces cerevisiae engineering strain expressing all the above genes simultaneously; wherein the plasmid P TEF1 - hphMX6 - T TEF1 The sequence of pUG27 is shown as SEQ ID NO. 11, and the plasmid P TEF1 - Ble - T TEF1 The sequence of pUG27 is shown as SEQ ID NO. 12, and the plasmid P CUP1 The sequence of pRS416 is shown as SEQ ID NO. 13.

[0018] Plasmid for constructing integrated gene expression cassette P TEF1 - hphMX6 - T TEF1 pUG27 (SEQ ID NO. 11), P TEF1 - Ble - T TEF1 pUG27 (SEQ ID NO. 12), P CUP1 The specific construction method of pRS416 (SEQ ID NO. 13) is as follows: (1) According to the codon preference of Saccharomyces cerevisiae, the genes P TEF1 - hphMX6 - T TEF1 , P TEF1 - Ble - T TEF1 , P CUP1 are partially or fully optimized, and then the target gene fragments are obtained by gene synthesis method; (2) Take plasmids pUG27 and pRS416 as vectors respectively, select specific restriction enzyme double digestion sites, cut the vectors, separate the enzyme digestion products by agarose gel electrophoresis method, and cut and recover the purified gel to obtain linearized vectors; (3) using seamless cloning enzyme to connect the fragment with the vector, transforming the connection product into E. coli competent cell DH5a, obtaining positive transformant on ampicillin-resistant medium, extracting plasmid, and sequencing verification to obtain recombinant plasmid; The application of the engineered Saccharomyces cerevisiae strain as described above in the production of naringenin.

[0019] The method for producing naringenin by fermentation using the engineered Saccharomyces cerevisiae strain as described above comprises the following steps: The engineered Saccharomyces cerevisiae strain is streaked on YEPD solid medium plate and cultured at 28-30 °C for 48-72 h. The activated strain is inoculated in a test tube containing 3-6 mL of YNB (Complete medium) liquid medium at 1-2 cycles, and cultured at 28-30 °C, 180-220 rpm for 12-16 h to obtain seed culture solution. The seed culture solution is inoculated into YNB (Complete medium) fermentation medium at a volume ratio of 2-10%, and fermented at 28-30 °C, 180-220 rpm for 24-72 h. The substrate L-tyrosine is added in batches for bioconversion to synthesize naringenin.

[0020] Further, the YNB (complete medium) solid culture medium formula is as follows: amino-free yeast nitrogen base (YNB) 6.6-6.8 g / L, DO Supplement Complete 1.2-1.4 g / L, agar 2-3%, and ddH2O as solvent. After sterilization, 1.7-2.3% of glucose is added. The YNB (Complete medium) liquid medium is as follows: amino-free yeast nitrogen base (YNB) 6.6-6.8 g / L, DO Supplement Complete 1.2-1.4 g / L, and ddH2O as solvent. After sterilization, 1.7-2.3% of glucose is added. The YNB (Complete medium) fermentation medium is as follows: amino-free yeast nitrogen base (YNB) 6.6-6.8 g / L, DO Supplement Complete 1.2-1.4 g / L, and ddH2O as solvent. After sterilization, 1.7-2.3% of glucose is added. The percentages mentioned above are all mass concentration percentages.

[0021] The method for determining the yield of naringenin produced by the engineered Saccharomyces cerevisiae strain as described above comprises the following specific steps: (1) After the fermentation of the engineered Saccharomyces cerevisiae strain is completed, part of the fermentation broth is collected; (2) The collected fermentation liquor is added to an organic solvent for extraction; (3) The supernatant of the extracted liquor is taken for rotary evaporation drying and redissolution with methanol; (4) The content of naringin is measured by using high performance liquid chromatography; (5) The content of naringin is calculated.

[0022] The advantages and positive effects obtained by the present application are as follows: 1. The engineering strain of the present application can synthesize naringin with L-tyrosine as a substrate. The genetic engineering strain contains tyrosine ammonia lyase gene TAL, 4-coumaric acid: coenzyme A ligase gene 4CL, chalcone synthase gene CHS and chalcone isomerase gene CHI. The engineering strain has stable genetic traits, high naringin yield, which can reach 27.45 mg / L, and can be produced by fermentation under relatively simple conditions, which has a very broad application prospect.

[0023] 2. The genetic engineering strain of the present application uses Saccharomyces cerevisiae as a chassis. The information of expression frame, integration site and copy number of the gene in the construction process of the engineering strain is clear. The genetic background of the strain is clear and stable, which is beneficial to improve the yield of naringin.

[0024] 3. The present application uses three short peptides of RIAD, RGG and RIDD to self-assemble part of the key enzymes in the synthesis pathway of naringin in the cell, which increases the contact opportunity of the enzyme and the substrate, forms an efficient, tight and synergistic catalytic network, so as to optimize the complex metabolic product synthesis pathway and improve the reaction efficiency. It is not only beneficial to improve the yield of naringin, but also can be applied to the synthesis pathway of other substances based on this technical platform, which has a very broad application prospect.

[0025] 4. Based on the problem that the key enzymes for synthesizing naringin are distributed dispersedly in the cytoplasm, causing the diffusion of intermediate products, and ultimately leading to the reduction of intracellular enzymatic reaction rate and low efficiency of synthesizing naringin, the present application heterologously expresses tyrosine ammonia lyase gene TAL containing SEQ ID NO. 1, 4-coumaric acid: coenzyme A ligase gene 4CL containing SEQ ID NO. 2, chalcone synthase gene CHS containing SEQ ID NO. 3, chalcone isomerase gene CHI containing SEQ ID NO. 4, short peptide gene RIADn-RGGm (wherein n=1-3; m=2-5) containing SEQ ID NO. 5 and short peptide gene RIDD containing SEQ ID NO. 6 in Saccharomyces cerevisiae. ARO10 The genes containing SEQ ID NO. 7, FDC1 The genes containing SEQ ID NO. 8, PAD1Gene, SEQ ID NO. 10 PDC5 Gene; expressed in Saccharomyces cerevisiae BY4741, BY4742 or BY4743, and the final naringin yield in a shake flask reached 27.45 mg / L, which was increased by 206.65% compared with the control strain, laying a foundation for efficient synthesis and further industrialization of naringin. BRIEF DESCRIPTION OF DRAWINGS

[0026] Figure 1 For the present application P CUP1 - RIDD - Pt4CL - T CYC1 - P TPI1 - RIDD - FjTAL - T CYC1 - P TEF1 - hphMX6 - T TEF1 -pRS426 plasmid restriction enzyme cutting verification diagram; wherein, M: DNA molecular weight marker; Figure 2 For the present application P TEF1 - SjCHS - T CYC1 - P TEF1 - KanMX - T TEF1 -pRS426 plasmid restriction enzyme cutting verification diagram; wherein, M: DNA molecular weight marker; Figure 3 For the present application P TPI1 - MsCHI - T CYC1 - P TEF1 - Sphis5 + - T TEF1 - pRS416 plasmid restriction enzyme cutting verification diagram; wherein, M: DNA molecular weight marker; Figure 4 For the present application P CUP1 - RIAD - RGGRGGRGGRGG - T CYC1 - PTEF1 - Ble - T TEF1 - pRS425 plasmid verification map; wherein, M: DNA molecular weight marker; Figure 5 Figure for comparison of naringenin production in the constructed Saccharomyces cerevisiae engineering strain and the control strain in the application. DETAILED DESCRIPTION

[0027] The application is further described below in conjunction with examples, which are descriptive rather than limiting, and cannot be used to limit the protection scope of the application.

[0028] The various experimental operations involved in the specific embodiments are all conventional techniques in the art, and the parts not specially noted herein can be implemented by referring to various commonly used tool books, scientific and technical literature or related instructions, manuals, etc. before the application date.

[0029] A naringenin-producing Saccharomyces cerevisiae engineering strain, the Saccharomyces cerevisiae engineering strain contains a tyrosine ammonia-lyase gene TAL, a 4-coumaric acid: coenzyme A ligase gene 4CL, a chalcone synthase gene CHS as shown in SEQ ID NO. 3, a chalcone isomerase gene CHI as shown in SEQ ID NO. 4, a short peptide gene RIADn-RGGm (wherein n = 1-3; m = 2-5) as shown in SEQ ID NO. 5, a short peptide gene RIDD as shown in SEQ ID NO. 6, and the genes as shown in SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10 and SEQ ID NO. 11 are knocked out. ARO10 FDC1 PAD1 PDC5 More preferably, the tyrosine ammonia-lyase gene TAL, the 4-coumaric acid: coenzyme A ligase gene 4CL, the chalcone synthase gene CHS, the chalcone isomerase gene CHI, and the short peptide gene RIADn-RGGm (wherein n = 1-3; m = 2-5) are expressed on the chromosome of Saccharomyces cerevisiae, and the host bacteria used include Saccharomyces cerevisiae (S. cerevisiae) BY4741, BY4742 or BY4743. Saccharomyces cerevisiae ​​​​​Alternatively, the tyrosine ammonia-lyase gene TAL has the nucleotide sequence shown in SEQ ID NO. 1, or a nucleotide sequence obtained by substitution, deletion or addition of one or more bases to the nucleotide sequence shown in SEQ ID NO. 1, or a nucleotide sequence that has at least 90% homology with the nucleotide sequence shown in SEQ ID NO. 1; and its function is the same as or similar to that of the nucleotide sequence shown in SEQ ID NO. 1. And / or the 4-coumaric acid:coenzyme A ligase gene 4CL has the nucleotide sequence shown in SEQ ID NO. 2, or a nucleotide sequence obtained by substitution, deletion or addition of one or more bases to the nucleotide sequence shown in SEQ ID NO. 2, or a nucleotide sequence that has at least 90% homology with the nucleotide sequence shown in SEQ ID NO. 2; and has the same or similar function as the nucleotide sequence shown in SEQ ID NO. 2; And / or the chalcone synthase gene CHS has the nucleotide sequence shown in SEQ ID NO. 3, or the nucleotide sequence shown in SEQ ID NO. 3 obtained by substitution, deletion or addition of one or more bases, or the nucleotide sequence having at least 90% homology with the nucleotide sequence shown in SEQ ID NO. 3; and its function is the same as or similar to that of the nucleotide sequence shown in SEQ ID NO. 3; And / or the chalcone isomerase gene CHI has the nucleotide sequence shown in SEQ ID NO. 4, or the nucleotide sequence shown in SEQ ID NO. 4 obtained by substitution, deletion or addition of one or more bases, or the nucleotide sequence having at least 90% homology with the nucleotide sequence shown in SEQ ID NO. 4; and its function is the same as or similar to that of the nucleotide sequence shown in SEQ ID NO. 4; Preferably, the tyrosine ammonia-lyase gene TAL is derived from Flavobacterium johnsonii (Bacillus johnsonii). Flavobacterium johnsoniae Populus tomentosa The 4-coumaric acid:coenzyme A ligase gene 4CL is derived from Populus tomentosa (…). Sophora japonica L The chalcone synthase gene CHS is derived from Sophora japonica ( Medicago sativa The chalcone isomerase gene CHI is derived from alfalfa ( RIDD Furthermore, its nucleotide sequence underwent partial or complete codon optimization based on the codon preference of Saccharomyces cerevisiae.

[0030] The method for constructing the engineered strain of *Saccharomyces cerevisiae* as described above includes the following steps: (1) According to the codon preference of Saccharomyces cerevisiae, the codons of the target genes tyrosine ammonia-lyase gene TAL, 4-coumarate: coenzyme A ligase gene 4CL, chalcone synthase gene CHS, chalcone isomerase gene CHI, short peptide gene RIDD, short peptide gene RIAD and short peptide gene RGG are partially optimized or fully optimized, and then the target gene fragments are obtained by gene synthesis method; (2) The gene expression cassette components are obtained by overlap extension PCR technology. The specific primers with homologous arms are designed to amplify the target fragment components, including the promoter, the termination sequence, the target gene fragment, the screening tag gene fragment, the homologous sequences of 300-700 bp on the upstream and downstream of the integration site, and the gene expression cassette; (3) The plasmid vector is linearized by double enzyme digestion with restriction endonuclease, and the enzyme digestion products are separated by agarose gel electrophoresis, and the gel is recovered and purified to obtain the linearized vector; (4) The fragments are connected with the vector by using seamless cloning enzyme, and the ligation product is transformed into E. coli competent DH5α. The positive transformants are obtained on the culture medium with a final concentration of 0.1 g / L ampicillin resistance, and the plasmid is extracted and sequenced to obtain the recombinant plasmid; (5) The homologous arm sequences of 300-700 bp on the upstream and downstream of the target integration site and the target gene expression frame to be expressed are obtained by specific primer amplification, and the lithium acetate transformation method is used to transform them into Saccharomyces cerevisiae cells to obtain the gene expression frame fragment integrated and expressed at a specific site on the Saccharomyces cerevisiae chromosome; (6) The single colony of the recombinant strain is obtained by screening on the specified nutrition-deficient or antibiotic screening solid yeast medium.

[0031] Specifically, the preparation and detection are as follows: Example 1 P CUP1 - Pt4CL - RIDD - T CYC1 - P TPI1 - FjTAL - hphMX6 - T CYC1 - P TEF1 - Pt - T TEF1 Construction of gene expression cassette 1. Acquisition of each component gene fragment The plasmid P CUP1pRS416 as template, PCR amplification was carried out, and the PCR product was purified and recovered to obtain P CUP1 The promoter gene fragment, the primers are respectively: 416-KpnI-CUP1-F: 5'-tcactatagggcgaattgggtaccTACCGACATTTGGGCGCTAT-3' and RIDD-XhoI-CUPI-R: 5'-AATTCACATTCCCGCAACATctcgagACAGTTTGTTTTTCTTAATATCT-3'.

[0032] Plasmid pYX212 as template, PCR amplification was carried out, and the PCR product was purified and recovered to obtain P TPI1 The promoter gene fragment, the primers are respectively: Not1-TPI-F: 5'-actagttctagagcggccgcgatctacgtatggtcattcttc-3' and RIDD-TPI-R: 5'-CGTACAATTCACATTCCCGCAACATGAATTCtgtatgtgttttttgtagttataga-3'.

[0033] Plasmid pYES2.0 as template, PCR amplification was carried out, and the PCR product was purified and recovered to obtain two T CYC1 The termination sequence gene fragment, the primers are respectively: Pt4CL-SalI-CYCI-F: 5'-AAAAATTGGCTGGTATTTAAgtcgacGCAAATTAAAGCCTTCGAGCG-3' and CYC1-R: 5'-ggccgctctagaactagtggatccTCATGTAATTAGTTATGTCACGCTT-3'; FjTAL-CYCI-F: 5'-TCATTTGATTAATAATTAAGGATCCGCAAATTAAAGCCTTCGAGCG-3' and 426-SacII-CYCI-R: 5'-acaaaagctggagctccaccgcggTCATGTAATTAGTTATGTCACGCTT-3'.

[0034] The 4CL gene fragment was synthesized by GENEWIZ Co., Ltd. Pt4CL The plasmid containing the 4CL gene fragment Pt -pUC57 (the synthesized 4CL fragment was inserted into the default vector pUC57, wherein the sequence of the 4CL fragment is given at the end of the document, and pUC57 is well known in the art) as a template, PCR amplification was performed, and the PCR product was purified and recovered to obtain Pt The 4CL gene fragment, the primers were as follows: Pt RIDD-Pt4CL-F: Fj 5'-GGTTCTGGTGGTGGTGGTTGTGGTTCATACCCATACGATGTTCCTGACTATG 3' and CYC1-SalI-Pt4CL-R: 5'-TCGAAGGCTTTAATTTGCgtcgacTTAAATACCAGCCAATTTTTCTTT-3'. The TAL gene fragment was synthesized by GENEWIZ Co., Ltd. The plasmid containing the TAL gene fragment

[0035] -pUC57 (the synthesized FjTAL fragment was inserted into the default vector pUC57, wherein the sequence of the FjTAL fragment is given at the end of the document, and pUC57 is well known in the art) as a template, PCR amplification was performed, and the PCR product was purified and recovered to obtain FjTAL The TAL gene fragment, the primers were as follows: Fj RIDD-FjTAL-F: RIAD 5'-GGTGGTGGTGGTTGTGGTTCAAATACTATTAATGAATACTTGTCA-3' and CYC1-FjTAL-R: 5'-AGGCTTTAATTTGCGGATCCTTAATTATTAATCAAATGATCTTTAAC-3' The 4CL gene fragment was synthesized by GENEWIZ Co., Ltd. - - RGG - RIDD - RIDDUsing pUC57 (the synthesized RIAD, RGG, and RIDD fragments were inserted into the default vector pUC57; the sequences of RIAD, RIDD, and RGG are given at the end of this document, and pUC57 is well-known in the art) as a template, PCR amplification was performed, and the PCR products were purified and recovered to obtain two... hphMX6 The fragment and primers are as follows: C-CUP1-XhoI-RIDD-F: 5'-AAGAAAAAACAAACTGTctcgagATGTTGCGGGAATGTGAATTGTAC-3' And C-Pt4CL-RIDDlin-R: 5'-CATAGTCAGGAACATCGTATGGGTATGAACCACAACCACCACC-3'; A-TPI-Eco-RIDD-F: 5'-acaaaaaacacatacaGAATTCATGTTGCGGGAATGTGAATTGTAC-3' And A-FjTAL-RIDDlin-R: 5'-ATGACAAGTATTCATTAATAGTATTTGAACCACAACCACCACC-3' plasmids preserved in the laboratory P TEF1 - hphMX6 - T TEF1 Using pUG27 as a template, PCR amplification was performed, and the PCR product was recovered to obtain... P TEF1 - Pt - T TEF1 The primers for screening marker gene fragments are as follows: T3-19bp-F: 5'-TGACATAACTAATTACATGAccgcggtggagctccagcttttgttccctttagtgagggttaattcagctgaagcttcgtacgc-3' And ARO10-DN500-21bp-R: 5'-GTTTTATAATTGCGCCCACAAGTTTgcataggccactagtggatct-3' PCR reaction system: 2 × Phanta Max Master Mix 25 μL, template 1 μL, upstream and downstream primers 2 μL each, ddH2O to a total volume of 50 μL; The PCR reaction conditions are: 95 °C for 3 min, 95 °C for 15 s, 54 °C for 15 s, 72 °C for 7 min, 35 cycles, 72 °C for 5 min, 4 °C for 5 min. After agarose gel electrophoresis analysis of the PCR product, the target fragment was recovered and purified.

[0036] The plasmid vector pRS426 was linearized by double enzyme digestion with restriction enzymes Kpn I and Sac II, and the vector part was recovered by gel electrophoresis. The plasmid vector fragment was obtained.

[0037] Double enzyme digestion reaction system: template plasmid 1000 ng, Kpn I and Sac II enzyme 1 μL each, 10 × Buffer 5 μL, ddH2O to a total volume of 50 μL; Double enzyme digestion reaction conditions: 37 °C for 45-90 min, 4 °C for 5 min. The enzyme digestion product was separated by agarose gel electrophoresis and gel recovery and purification, and the linearized vector was obtained.

[0038] 2. Fragment ligation and E. coli competent transformation The gene fragment expression cassette obtained in 1 was ligated with the linearized vector pRS426 using seamless cloning enzyme. P CUP1 Promoter gene fragment, P TPI1 Promoter gene fragment, two T CYC1 Termination sequence gene fragment, Fj 4CL gene fragment, -hphMX6-T TAL gene fragment, two RIDD gene fragments and P TEF1 Figure 1 TEF1 Screening marker gene fragment) and linearized vector pRS426, the seamless cloning enzyme ligation system and reaction conditions: 2 × ClonExpressMix 5 μL, each fragment was added according to the concentration (calculated according to the 2 × ClonExpressMix instruction), ddH2O to a total volume of 10 μL, 50 °C, 30 min. The ligation product was transformed into E. coli competent cells DH5α, and positive transformants were obtained on ampicillin-containing medium (final concentration 0.1 g / L). The plasmid was extracted and verified by enzyme digestion (pRS426 vector digestion), and sequencing verification obtained a recombinant plasmid containing a gene expression cassette RIDD ​P CUP1 - Pt4CL - RIDD - T CYC1 - P TPI1 - FjTAL - hphMX6 - T CYC1 - P TEF1 - SjCHS - T TEF1 -pRS426.

[0039] Example 2 P TEF1 - KanMX - T CYC1 - P TEF1 - Sj - T TEF1 Construction of gene expression cassettes 1. Obtaining gene fragments from each component Using plasmid pSH65 as a template, PCR amplification was performed, and the PCR product was purified and recovered to obtain... P TEF1 Promoter gene fragment, primers are as follows: 426-KpnI-TEF-F: 5'-ctcactatagggcgaattgggtaccCCACACACCATAGCTTCAAAATGT-3' And CHI-XhoI-TEF-R: 5'-TTTCTTCGACGGTAACCATctcgagCTTAGATTAGATTGCTATGCTTTCTT-3' Using plasmid pYES2.0 as a template, PCR amplification was performed, and the PCR product was purified and recovered to obtain... T CYC1 The terminator sequence gene fragment, and the primers are as follows: SjCHS-CYC1-F: 5'-CCATTGCAAGGTTGAgtcgacGCAAATTAAAGCCTTCGAGCG-3' And 426-CYC1-R: 5'- GCGTACGAAGCTTCAGCTGggatccTCATGTAATTAGTTATGTCACGCTTAC-3' The CHS gene fragment was synthesized SjCHS The plasmid containing the CHS gene fragment SjCHS -pUC57 (synthetic SjCHS The fragment was inserted into the default vector pUC57, wherein Sj The sequence of the fragment is given at the end of the document, and pUC57 is well known in the art) as a template, PCR amplification was performed, and the PCR product was purified and recovered to obtain KanMX The CHS gene fragment, the primers being respectively: TEF1-XhoI-SjCHS1-F: 5'-CATAGCAATCTAATCTAAGctcgagATGGTTACCGTCGAAGAAATAAG-3' and CYC1-SalI-SjCHS1-Rr: 5'-GAAGGCTTTAATTTGCgtcgacTCAACCTTGCAATGGAACGGA-3' The plasmid pUG6 as a template, PCR amplification was performed, and the PCR product was purified and recovered to obtain P TEF1 - Sj - T TEF1 The screening marker gene fragment, the primers being respectively: CYC1-19bp-F: 5'-ATTACATGAggatccCAGCTGAAGCTTCGTACGCTGCAGGTCGACAACCCT-3' and FDC1-DN-MID-KanMX-R2: 5'-TTCTTCCGTAGAAAGTCTATGGCAAGCATAGGCCACTAGTGGATCT3' The PCR reaction system: 2 × Phanta Max Master Mix 25 μL, template 1 μL, upstream and downstream primers 2 μL each, and ddH2O to make up the total volume of 50 μL; The PCR reaction conditions were: 95 °C for 3 min, 95 °C for 15 s, 54 °C for 15 s, 72 °C for 7 min, 35 cycles, 72 °C for 5 min, and 4 °C for incubation. After agarose gel electrophoresis analysis of the PCR product, the target fragment was recovered and purified.

[0040] The plasmid vector pRS426 was linearized by double digestion with restriction endonucleases Kpn I and Sac II, and the vector fragment was recovered by gel electrophoresis to obtain the plasmid vector fragment.

[0041] Double enzyme digestion reaction system: 1000 ng template plasmid, 1 μL each of Kpn I and Sac II enzymes, 5 μL 10× Buffer, and ddH2O to bring the total volume to 50 μL; Double enzyme digestion reaction conditions: 37 °C for 45-90 min, followed by incubation at 4 °C. The digestion products were separated by agarose gel electrophoresis, and purified by gel extraction to obtain the linearized vector.

[0042] 2. Fragment Ligation and Colonic Competency Transformation Amplification The gene fragment expression cassettes obtained in step 1 were expressed using a seamless cloning enzyme. P TEF1 promoter gene fragments, T CYC1 Termination sequence gene fragment, KanMX CHS gene fragment, P TEF1 - Figure 2 - T TEF1 The marker gene fragment was ligated into the linearized vector pRS426. The ligation system and reaction conditions were as follows: 5 μL of 2×ClonExpressMix, with each fragment added according to the calculated concentration (following the 2×ClonExpressMix instructions), and ddH2O added to a total volume of 10 μL. The reaction was carried out at 50 °C for 30 min. The ligation product was transformed into competent E. coli DH5α cells. Positive transformants were obtained on ampicillin-containing medium (final concentration 0.1 g / L). The plasmid was extracted and verified by enzyme digestion. SjCHS Sequencing verification yielded recombinant plasmids containing gene expression cassettes. P TEF1 - KanMX - T CYC1 - P TEF1 - MsCHI - T TEF1 -pRS426.

[0043] Example 3 P TPI1 - Sphis5 - T CYC1 - P TEF1 - Ms+ - T TEF1 Construction of gene expression cassette PCR amplification was performed with plasmid pYX212 as template, and the PCR product was purified and recovered to obtain P TPI1 Promoter gene fragment, primers were as follows: 416-KpnI-TPI1-F: 5'-GACTCACTATAGGGCGAATTGGGTACCgatctacgtatggtcattcttctt 3' and MsCHI-EcoRI-TPI-R: 5'-GCAGTGATGGAGGCAGCCATGAATTCtgtatgtgttttttgtagttatagat-3' PCR amplification was performed with synthesized MsCHI CHI gene fragment-containing plasmid MsCHI -pUC57 (synthesized MsCHI fragment was inserted into the default vector pUC57, wherein Ms fragment sequence is given at the end of the text, and pUC57 is well known in the art) as template, and the PCR product was purified and recovered to obtain Sphis5 CHI gene fragment, primers were as follows: TPI-EcoRI-MsCHI-F: 5'-atctataactacaaaaaacacatacaGAATTCATGGCTGCCTCCATCACTGC-3' and CYC1-BamHI-R: 5'-ACGCTCGAAGGCTTTAATTTGCGGATCCTCAATTACCAATCTTGAAAGCACC-3' PCR amplification was performed with plasmid pYES2.0 as template, and the PCR product was purified and recovered to obtain T CYC1 Termination sequence gene fragment, primers were as follows: MsCHI-CYCI-F: 5'-ACGCTCGAAGGCTTTAATTTGCGGATCCTCAATTACCAATCTTGAAAGCACC-3' and 416-CYCI-R: 5'-agcttcagctgCCGCGGTGGCGGCCGCTCATGTAATTAGTTATGTCACGCTT-3' PCR amplification was performed with plasmid pUG27 as template, and the PCR product was purified and recovered to obtain P TEF1 - Ms + - T TEF1 The screening marker gene fragment was amplified by PCR using the primers as follows: CYCI-19bp-F: 5'-CTAATTACATGAGCGGCCGCCACCGCGGcagctgaagcttcgtacgc-3' and 416-21bp-R: 5'-AACAAAAGCTGGAGCTCCACCGCGGgcataggccactagtggatct-3' The PCR reaction system was as follows: 2 × Phanta Max Master Mix 25 μL, template 1 μL, upper and lower primers 2 μL each, and ddH2O was added to a total volume of 50 μL. The PCR reaction conditions were as follows: 95 °C for 3 min, 95 °C for 15 s, 54 °C for 15 s, 72 °C for 7 min, 35 cycles, 72 °C for 5 min, and 4 °C for incubation. After agarose gel electrophoresis analysis of the PCR product, the target fragment was recovered and purified.

[0044] The plasmid vector pRS416 was linearized by double enzyme digestion with restriction endonucleases Kpn I and Sac II, and the vector part was recovered by gel electrophoresis to obtain the plasmid vector fragment.

[0045] The double enzyme digestion reaction system was as follows: template plasmid 1000 ng, Kpn I and Sac II enzymes 1 μL each, 10 × Buffer 5 μL, and ddH2O was added to a total volume of 50 μL. The double enzyme digestion reaction conditions were as follows: 37 °C for 45-90 min, and 4 °C for incubation. The enzyme digestion product was separated by agarose gel electrophoresis, and the gel was recovered and purified to obtain the linearized vector.

[0046] 2. Fragment ligation and E. coli transformation and amplification The gene fragment expression cassette obtained in item 1 was ligated with the linearized vector pRS416 using seamless cloning enzymes, P TPI1 The promoter gene fragment,T CYC1 Termination sequence gene fragment, Sphis5 CHI gene fragment, P TEF1 - Figure 3 + - T TEF1 Screening marker gene fragment) Seamless cloning enzyme ligation system and reaction conditions: 2 x ClonExpress Mix 5 μL, each fragment is added according to the concentration (calculated according to the 2 x ClonExpress Mix instruction), ddH2O is added to 10 μL, 50 °C, 30 min. The ligation product is transformed into E. coli competent cells DH5α, positive transformants are obtained on ampicillin-containing medium (final concentration 0.1 g / L), plasmids are extracted, and the plasmids are verified by enzyme digestion ( MsCHI ) and sequencing to obtain a recombinant plasmid containing a gene expression cassette P TPI1 - Sphis5 - T CYC1 - P TEF1 - RIAD + - T TEF1 -pRS416.

[0047] Example 4 P CUP1 - RGGRGGRGGRGG-T - Ble CYC1 - P TEF1 - RIAD - T TEF1 Construction of a gene expression cassette The plasmid P CUP1 -pRS416 is used as a template for PCR amplification, and the PCR product is purified and recovered to obtain P CUP1 Promoter gene fragment, primers are as follows: KpnI-CUP1-pRS426-F1: 5'-ctcactatagggcgaattgggtaccTACCGACATTTGGGCGC-3' and RIAD-XhoI-CUP1-R: 5'-CAGACCCACCACCACCCATctcgagACAGTTTGTTTTTCTTAATATCT-3' The plasmid containing the synthesized RIAD-RGG gene fragment RGG - RIDD - RIAD -pUC57 (synthetic) RGG - RIDD - RIAD The fragment was inserted into the default carrier pUC57, in which RGG , RIDD , RIAD The fragment sequence is given at the end of the text, and pUC57 (which is well known in the art) was used as a template for PCR amplification. The PCR product was purified and recovered to obtain the RIAD-RGG gene fragment. The primers were as follows: CUP-XhoI-RIAD-F: 5'-ATTAAGAAAAAAACAAACTGTctcgagATGGGTGGTGGTGGGTCT-3' And RGG-linker-RGG-R: 5'-CGTTGTTAGATTGGTTGGATTCCATAAGCTTCCCGAATTCACCATCACCACCATTGTCTCTTCTG-3' The plasmid containing the synthesized RGG gene fragment RGG - RIDD - Ble Using pUC57 as a template, PCR amplification was performed. The PCR product was purified and recovered, yielding four RGG gene fragments. The primers were as follows: RGG-lin-RGG-F: 5'-CAGAAGAGACAATGGTGGTGATGGTGAATTCGGGAAGCTTATGGAATCCAACCAATCTAACAACG-3' CYCI-SalI-TAA-RGG-R: 5'-TTGGGACGCTCGAAGGCTTTAATTTGCgtcgacTTAACCATCACCACCATTGTCTCTTCTG-3' RGG-lin-RGG-F: 5'-CAGAAGAGACAATGGTGGTGATGGTGAATTCGGGAAGCTTATGGAATCCAACCAATCTAACAACG-3' RGG-lin-RGG-R: 5'-GTTGTTAGATTGGTTGGATTCCATAAGCTTCCCGAATTCACCATCACCACCATTGTCTCTT-3' PCR amplification was carried out with the plasmid pYES2.0 as a template, and the PCR product was purified and recovered to obtain T CYC1 The primer for the termination sequence gene fragment was as follows: RGG-TAA-SalI-CYC1-F: 5'-AAGAGACAATGGTGGTGATGGTTAAgtcgacGCAAATTAAAGCCTTCGAGC-3' and 425-CYC1-R: 5'-ATTCGATATCAAGCTTATCGATACCTCATGTAATTAGTTATGTCACGCTT-3' The plasmid pUG27 was used as a template for PCR amplification, and the PCR product was purified and recovered to obtain P TEF1 - Ble - T TEF1 The primer for the termination sequence gene fragment was as follows: P TEF1 - Ble - T TEF1 The primer for the screening marker gene fragment was as follows: CYC1-19-F: 5'-AGCGTGACATAACTAATTACATGAGGTATCcagctgaagcttcgtacgc-3' and PDC5DN-21bp-ble-R2: 5'-AATCATGAGTTTTATGTTAATTAGCgcataggccactagtggatct-3' The PCR reaction system was as follows: 2 × Phanta Max Master Mix 25 μL, template 1 μL, upstream and downstream primers 2 μL each, and ddH2O was added to a total volume of 50 μL. The PCR reaction conditions were as follows: 95 °C for 3 min, 95 °C for 15 s, 54 °C for 15 s, 72 °C for 7 min, 35 cycles, 72 °C for 5 min, and 4 °C for incubation. After agarose gel electrophoresis analysis of the PCR product, the target fragment was recovered and purified.

[0048] The plasmid vector pRS426 was linearized by double digestion with restriction endonucleases Kpn I and Sac II, and the vector fragment was recovered by gel electrophoresis to obtain the plasmid vector fragment.

[0049] Double enzyme digestion reaction system: 1000 ng template plasmid, 1 μL each of Kpn I and Sac II enzymes, 5 μL 10× Buffer, and ddH2O to bring the total volume to 50 μL; Double enzyme digestion reaction conditions: 37 °C for 45-90 min, followed by incubation at 4 °C. The digestion products were separated by agarose gel electrophoresis, and purified by gel extraction to obtain the linearized vector.

[0050] 2. Fragment Ligation and Colonic Competency Transformation Amplification The gene fragment expression cassettes obtained in step 1 were expressed using a seamless cloning enzyme. P CUP1 Promoter gene fragment, RIAD-RGG gene fragment, 4 RGG gene fragments T CYC1 Termination sequence gene fragment, P TEF1 - Figure 4 - T TEF1 The marker gene fragment was ligated into the linearized vector pRS425. The ligation system and reaction conditions were as follows: 5 μL of 2×ClonExpress Mix, with each fragment added according to the calculated concentration (following the 2×ClonExpress Mix instructions), and ddH2O added to a total volume of 10 μL. The reaction was carried out at 50 °C for 30 min. The ligation product was transformed into competent E. coli DH5α cells. Positive transformants were obtained on ampicillin-containing medium (final concentration 0.1 g / L). The plasmid was extracted and verified by enzyme digestion. RIAD Sequencing verification yielded recombinant plasmids containing gene expression cassettes. P CUP1 - RGGRGGRGGRGG - Ble - T CYC1 - P TEF1 - ARO10 - T TEF1 -pRS425.

[0051] Example 5: Construction of an engineered strain of *Saccharomyces cerevisiae* producing naringin 1. Obtaining upstream and downstream homologous sequences and integration gene expression cassettes at the integration site Using the genome of Saccharomyces cerevisiae BY4741 as a template, PCR amplification was performed separately.FDC1 、 PAD1 、 PDC5 、 RIDD The homologous sequence fragments of about 500 bp upstream and downstream of the gene, and the related primers are shown in Table 1: Table 1

[0052]

[0053] PCR reaction system: 2 × Phanta Max Master Mix 25 μL, template 1 μL, upstream and downstream primers 2 μL each, ddH2O to make up to a total volume of 50 μL; The PCR reaction conditions are: 95 °C for 3 min, 95 °C for 15 s, 54 °C for 15 s, 72 °C for 30 s, 35 cycles, 72 °C for 5 min, 4 °C for incubation. After agarose gel electrophoresis analysis of the PCR product, the target fragment was recovered and purified.

[0054] The constructed key enzyme gene expression cassette P CUP1 - Pt4CL - RIDD - T CYC1 - P TPI1 - FjTAL - hphMX6 - T CYC1 - P TEF1 - SjCHS - T TEF1 , P TEF1 - KanMX - T CYC1 - P TEF1 - MsCHI - T TEF1 , P TPI1 - Sphis5 - T CYC1 - P TEF1 - RIAD + - T TEF1 and P CUP1 - RGGRGGRGGRGG - Ble -T CYC1 - P TEF1 - RIDD - T TEF1 The plasmid as the template, PCR amplification P CUP1 - Pt4CL - RIDD - T CYC1 - P TPI1 - FjTAL - hphMX6 - T CYC1 - P TEF1 - SjCHS - T TEF1 、 P TEF1 - KanMX - T CYC1 - P TEF1 - MsCHI - T TEF1 、 P TPI1 - Sphis5 - T CYC1 - P TEF1 - RIAD + - T TEF1 and P CUP1 - ​ - RGGRGGRGGRGG - T CYC1 - P TEF1 - Ble - T TEF1 Gene fragments. The relevant primers are shown in Table 2.

[0055] Table 2

[0056] PCR reaction system: 2 × Phanta Max Master Mix 25 μL, template 1 μL, upstream and downstream primers 2 μL each, ddH2O to a total volume of 50 μL; PCR reaction conditions: 95 °C 3 min, 95 °C 15 s, 54 °C 15 s, 72 °C 5 min, cycle 35 times, 72 °C 8 min, 4 °C. After agarose gel electrophoresis analysis of PCR products, the target fragment was recovered and purified.

[0057] 2. Integration of the target fragment into the genome of Saccharomyces cerevisiae The P CUP1 - RIDD - Pt4CL - T CYC1 - P TPI1 - RIDD - FjTAL - T CYC1 - P TEF1 - hphMX6 - T TEF1 、 P TEF1 - SjCHS - T CYC1 - P TEF1 - KanMX - T TEF1 、 P TPI - MsCHI - T CYC1 - P TEF1 - Sphis5 + - T TEF1 and P CUP1 - RIAD - RGGRGGRGGRGG - T CYC1 - P TEF1 - Ble - T TEF1 The four gene expression cassettes were transformed into Saccharomyces cerevisiae cells by lithium acetate transformation method at one time, and were integrated into ARO10 、 FDC1 、 PAD1 、 PDC5The positive transformants obtained on 0.2 g / L hygromycin B resistant solid medium, 0.2 g / L geneticin resistant solid medium, histidine auxotrophic solid medium and 0.1 g / L bleomycin resistant solid medium, respectively, were sequenced and correct recombinant yeast strains were obtained.

[0058] Example 6 Fermentation of naringenin by Saccharomyces cerevisiae engineering strain 1. Activation of the strain The Saccharomyces cerevisiae engineering strain obtained in Example 5 was streaked on YEPD plates and cultured at 30 °C for 48 h. 2. Seed culture The activated strain was inoculated into a test tube containing 5 mL YNB liquid medium, and cultured at 30 °C and 220 rpm for 12 h to obtain the seed culture. 3. Fermentation culture The seed culture was inoculated into a flask containing 50 mL YNB fermentation medium at an inoculation amount of 3%, and fermented at 30 °C and 220 rpm for 72 h. The substrate L-tyrosine powder was added at 0 h, 12 h, 24 h and 36 h, and the amount of each addition was 0.0125 g.

[0059] The YNB (complete medium) solid medium formula is: amino acid-free yeast nitrogen source (YNB) 6.6-6.8 g / L, DO Supplement Complete 1.2-1.4 g / L, agar 2-3%, solvent ddH2O, and 1.7-2.3% glucose was added after sterilization. The YNB (complete medium) liquid medium is: amino acid-free yeast nitrogen source (YNB) 6.6-6.8 g / L, DO Supplement Complete 1.2-1.4 g / L, and 1.7-2.3% glucose was added after sterilization, solvent ddH2O; The YNB (complete medium) fermentation medium is: amino acid-free yeast nitrogen source (YNB) 6.6-6.8 g / L, DO Supplement Complete 1.2-1.4 g / L, and 1.7-2.3% glucose was added after sterilization, solvent ddH2O; The above percentages are all mass concentration percentages.

[0060] Example 7 HPLC detection of naringenin in fermentation broth In a 50 mL centrifuge tube, 20 mL of the fermentation broth of Example 6 was added, extracted with 20 mL of ethyl acetate, vortexed for 15 min, centrifuged at 5000 rpm for 5 min, 15 mL of the upper organic phase was sucked into a round-bottom flask, the extraction was repeated twice, rotary evaporation was performed to dryness, 2 mL of pure methanol solution was added to the round-bottom flask, the product was fully redissolved to completely dissolve, the supernatant was filtered through a 0.22 μm organic filter membrane into a liquid phase bottle to obtain a sample to be tested; The naringenin was detected by HPLC, the high performance liquid chromatography column was WondaSil C18 Superb 5 μm 4.6 mm x 250 mm, the mobile phase was 0.1% (v / v) trifluoroacetic acid and acetonitrile added with 0.1% (v / v) trifluoroacetic acid, the column temperature was 40 °C, the detection wavelength was 320 nm, the flow rate was 1 mL / min, the injection amount was 10 μL.

[0061] The results are shown in Figure 5 From the figure, it can be seen that the yield of naringenin of the Saccharomyces cerevisiae engineering strain of the application was 27.45 mg / L after 72 h of fermentation, and the yield of the control strain was Fj The TAL gene and Pt The Saccharomyces cerevisiae strain without adding RIDD tags at the end of the TAL gene and the 4CL gene (this strain is only used as a control strain, and the only difference from the engineering strain is that: Fj The TAL gene and Pt The TAL gene and the 4CL gene in this strain do not carry RIDD short peptide tags.) The tyrosine ammonia lyase gene TAL gene involved in the application is as follows (SEQ ID NO. 1): The 4CL gene according to the present application is as follows (SEQ ID NO. 2): The chalcone synthase gene CHS gene according to the present application is as follows (SEQ ID NO. 3): The chalcone isomerase gene CHI involved in the present application is as follows (SEQ ID NO. 4): ATGGCTGCCTCCATCACTGCTATTACTGTTGAAAACTTGGAATACCCAGCCGTCGTTACCTCTCCAGTCACCGGTAAGTCTTACTTCTTGGGTGGTGCTGGTGAAAGAGGTTTGACCATTGAAGGTAACTTTATCAAGTTCACCGCCATCGGTGTCTACTTGGAAGACATTGCTGTTGCTTCTTTGGCCGCTAAGTGGAAGGGTAAATCCTCTGAAGAACTATTAGAAACTTTGGACTTCTACCGTGATATCATCTCTGGTCCATTCGAAAAATTGATCAGAGGTTCCAAGATCAGAGAATTGTCCGGTCCAGAATATAGTAGAAAGGTTATGGAAAACTGTGTCGCTCACTTAAAATCAGTTGGTACTTACGGTGACGCTGAAGCTGAAGCTATGCAAAAGTTTGCCGAGGCTTTCAAGCCAGTTAACTTCCCACCAGGTGCCTCCGTTTTCTACAGACAATCTCCTGATGGTATCTTGGGCTTATCTTTCTCTCCAGATACTTCCATTCCAGAAAAGGAAGCTGCTTTGATTGAAAACAAGGCTGTTTCTTCTGCTGTCTTGGAAACCATGATTGGTGAACACGCTGTCTCCCCAGACTTGAAGAGATGTCTGGCTGCCAGATTGCCAGCTTTGTTGAACGAAGGTGCTTTCAAGATTGGTAATTGA The RIADn-RGGm (wherein n = 1-3; m = 2-5) gene involved in the present application is as follows (SEQ ID NO. 5): RIAD: ATGGGTGGTGGTGGGTCTGGTGGTGGTGGTAGCGGTGGTGGTGGTTGTGGTTTGGAACAATACGCTAACCAATTAGCTGACCAAATCATTAAAGAAGCTACTGAAGGTTGT RGG: ATGGAATCCAACCAATCTAACAACGGTGGTTCCGGTAACGCTGCTTTGAACAGAGGTGGTAGATACGTTCCACCACACTTACGTGGTGGTGACGGTGGTGCTGCTGCCGCCGCTTCTGCTGGTGGTGACGACAGAAGAGGTGGTGCCGGTGGTGGAGGTTACAGAAGAGGTGGTGGTAACTCTGGTGGTGGTGGTGGTGGTGGTTACGATAGAGGTTACAACGATAACCGTGATGACCGTGACAACCGTGGTGGTTCTGGTGGTTACGGTAGAGACAGAAACTACGAAGACAGAGGTTATAACGGTGGTGGTGGTGGTGGTGGTAATCGTGGTTACAACAACAACAGAGGTGGTGGTGGCGGTGGTTACAACAGACAAGATAGAGGTGATGGTGGTTCTTCTAACTTTTCTAGAGGGGGTTATAATAACAGAGATGAAGGTTCTGACAACAGAGGTTCCGGTAGATCTTACAACAACGACAGAAGAGACAATGGTGGTGATGGT The short peptide gene RIDD involved in the present application is as follows (SEQ ID NO. 6): ATGTTGCGGGAATGTGAATTGTACGTTCAAAAGCACAACATCCAAGCTCTATTGAAGGATTCCATTGTCCAATTGTGTACCGCTAGACCAGAAAGACCAATGGCTTTCTTGAGAGAATACTTCGAAAGATTGGAAAAGGAAGAAGCCAAGGGTGGTGGTGGTTCCGGTGGGGGCGGTTCTGGTGGTGGTGGTTGTGGTTCA The short peptide gene RIDD involved in the present application is as follows (SEQ ID NO. 6): ARO10 The gene is as follows (SEQ ID NO. 7): The present invention relates to FDC1 The gene is as follows (SEQ ID NO. 8): The present invention relates to PAD1 The gene is as follows (SEQ ID NO. 9): ATGCTCCTATTTCCAAGAAGAACTAATATAGCCTTTTTCAAAACAACAGGCATTTTTGCTAATTTTCCTTTGCTAGGTAGAACCATTACAACTTCACCATCTTTCCTTACACATAAACTGTCAAAGGAAGTAACCAGGGCATCAACTTCGCCTCCAAGACCAAAGAGAATTGTTGTCGCAATTACTGGTGCGACTGGTGTTGCACTGGGAATCAGACTTCTACAAGTGCTAAAAGAGTTGAGCGTAGAAACCCATTTGGTGATTTCAAAATGGGGTGCAGCAACAATGAAATATGAAACAGATTGGGAACCGCATGACGTGGCGGCCTTGGCAACCAAGACATACTCTGTTCGTGATGTTTCTGCATGCATTTCGTCCGGATCTTTCCAGCATGATGGTATGATTGTTGTGCCCTGTTCCATGAAATCACTAGCTGCTATTAGAATCGGTTTTACAGAGGATTTAATTACAAGAGCTGCCGATGTTTCGATTAAAGAGAATCGTAAGTTACTACTGGTTACTCGGGAAACCCCTTTATCTTCCATCCATCTTGAAAACATGTTGTCTTTATGCAGGGCAGGTGTTATAATTTTTCCTCCGGTACCTGCGTTTTATACAAGACCCAAGAGCCTTCATGACCTATTAGAACAAAGTGTTGGCAGGATCCTAGACTGCTTTGGCATCCACGCTGACACTTTTCCTCGTTGGGAAGGAATAAAAAGCAAGTAA The present invention relates to PDC5 The gene is as follows (SEQ ID NO. 10): The present invention relates to P TEF1 - hphMX6 - T TEF1 The pUG27 plasmid gene is as follows (SEQ ID NO. 11): The present invention relates to P TEF1 - Ble - T TEF1 The pUG27 plasmid gene is as follows (SEQ ID NO. 12): The present invention relates to P CUP1 The pRS416 plasmid genes are as follows (SEQ ID NO. 13): While embodiments of the present application have been disclosed for illustrative purposes, those skilled in the art will appreciate that various alterations, changes, and modifications are possible in the spirit and scope of the application and appended claims, therefore, the scope of the present application is not limited to what has been disclosed in the embodiments.

Claims

1. A naringenin-producing engineered Saccharomyces cerevisiae strain, characterized in that: The engineered strain of *Saccharomyces cerevisiae* contains the following genes: TAL (tyrosine ammonia-lyase) as shown in SEQ ID NO. 1; 4CL (4-coumaric acid:coenzyme A ligase) as shown in SEQ ID NO. 2; CHS (chalcone synthase) as shown in SEQ ID NO. 3; CHI (chalcone isomerase) as shown in SEQ ID NO. 4; RIADn-RGGm (short peptide gene) as shown in SEQ ID NO. 5, where n=1-3, m=2-5; and RIDD (short peptide gene) as shown in SEQ ID NO.

6. The strain also contains the gene knocked out as shown in SEQ ID NO.

7. ARO10 Gene, shown in SEQ ID NO. 8 FDC1 Gene, shown in SEQ ID NO. 9 PAD1 Gene, shown in SEQ ID NO. 10 PDC5 Gene.

2. The engineered Saccharomyces cerevisiae strain of claim 1, wherein: The tyrosine ammonia-lyase gene TAL, 4-coumarate: coenzyme A ligase gene 4CL, chalcone synthase gene CHS, chalcone isomerase gene CHI, and short peptide genes RIADn-RGGm are expressed on the chromosomes of Saccharomyces cerevisiae. The original host strains used include Saccharomyces cerevisiae (a) Saccharomyces cerevisiae ) BY4741, BY4742, or BY4743. Alternatively, the tyrosine ammonia-lyase gene TAL has a nucleotide sequence as shown in SEQ ID NO. 1, or a nucleotide sequence obtained by substitution, deletion, or addition of one or more bases to the nucleotide sequence as shown in SEQ ID NO. 1, or a nucleotide sequence having at least 90% homology with the nucleotide sequence as shown in SEQ ID NO. 1; and functions the same as or similar to the nucleotide sequence as shown in SEQ ID NO. 1; and / or the 4-coumaric acid: coenzyme A ligase gene 4CL has a nucleotide sequence as shown in SEQ ID NO. 2, or a nucleotide sequence obtained by substitution, deletion, or addition of one or more bases to the nucleotide sequence as shown in SEQ ID NO. 2, or a nucleotide sequence having at least 90% homology with the nucleotide sequence as shown in SEQ ID NO. 2; and functions the same as or similar to the nucleotide sequence as shown in SEQ ID NO. 2; and / or the chalcone synthase gene CHS has a nucleotide sequence as shown in SEQ ID NO. 3, or a nucleotide sequence obtained by substitution, deletion, or addition of one or more bases to the nucleotide sequence as shown in SEQ ID NO. 3, or a nucleotide sequence having at least 90% homology with the nucleotide sequence as shown in SEQ ID NO. 3; and functions the same as or similar to the nucleotide sequence as shown in SEQ ID NO. 3; and / or the chalcone isomerase gene CHI has a nucleotide sequence as shown in SEQ ID NO. 4, or a nucleotide sequence obtained by substitution, deletion, or addition of one or more bases to the nucleotide sequence as shown in SEQ ID NO. 4, or a nucleotide sequence having at least 90% homology with the nucleotide sequence as shown in SEQ ID NO. 4; and functions the same as or similar to the nucleotide sequence as shown in SEQ ID NO. 4; and / or the short peptide gene RIADn-RGGm has a nucleotide sequence as shown in SEQ ID NO. 5, or a nucleotide sequence obtained by substitution, deletion, or addition of one or more bases to the nucleotide sequence as shown in SEQ ID NO. 5, or a nucleotide sequence having at least 90% homology with the nucleotide sequence as shown in SEQ ID NO. 5; and functions the same as or similar to the nucleotide sequence as shown in SEQ ID NO.

5.

3. The engineered Saccharomyces cerevisiae strain of claim 2, wherein: The tyrosine ammonia-lyase (TAL) gene is derived from Flavobacterium johnsonii (T. TAL). Flavobacterium johnsoniae The 4-coumaric acid-CoA ligase gene (4CL) is derived from Populus tomentosa (…). Populus tomentosa The chalcone synthase (CHS) gene is derived from Sophora japonica (Sophora japonica). Sophora japonica The chalcone isomerase (CHI) gene is derived from alfalfa (…). Medicago sativa The RIDD gene is derived from the N-terminus of cAMP-dependent protein kinases (PKAs); the RIAD gene is an amphipathic helix RIAD derived from the anchoring domain of the A kinase anchoring protein AKAP; and the RGG gene is derived from LAF-1.

4. The engineered Saccharomyces cerevisiae strain of any one of claims 1 to 3, wherein: The nucleotide sequences of the tyrosine ammonia-lyase gene TAL from Flavobacterium johnsoniae, the 4-coumarate: coenzyme A ligase gene 4CL from Populus tomentosa, the chalcone synthase gene CHS from Sophora japonica, the chalcone isomerase gene CHI from Medicago sativa, the short peptide gene RIDD from the N-terminal of cAMP-dependent protein kinase (PKAs), the short peptide gene RIAD from the amphipathic helix on the anchor domain of A kinase anchor proteins (AKAPs), and the short peptide gene RGG from LAF-1 are partially or fully optimized according to the codon bias of Saccharomyces cerevisiae.

5. The method for constructing an engineered Saccharomyces cerevisiae strain according to any one of claims 1 to 4, wherein: The method comprises the following steps: (1) Partial or full optimization of the codons of the target genes tyrosine ammonia-lyase gene TAL, 4-coumarate: coenzyme A ligase gene 4CL, chalcone synthase gene CHS, chalcone isomerase gene CHI, short peptide gene RIDD, short peptide gene RIAD, and short peptide gene RGG according to the codon bias of Saccharomyces cerevisiae, followed by obtaining the target gene fragments by gene synthesis; (2) Obtaining each component of the gene expression cassette by overlap extension PCR, amplifying each component of the target fragment by designing specific primers with homologous arms, including a promoter, a termination sequence, a target gene fragment, a screening tag gene fragment, and 300-700 bp homologous sequences upstream and downstream of the integration site, so that the gene to be expressed is provided with a strong constitutive or inducible promoter and a termination sequence of Saccharomyces cerevisiae, and the DNA fragment of the expression frame is obtained by PCR technology or vector construction method; (3) Amplifying the 300-700 bp homologous arm sequences upstream and downstream of the target integration site and the gene expression frame to be expressed by specific primers, and transforming them into Saccharomyces cerevisiae cells by lithium acetate transformation method to obtain the gene expression frame fragment integrated and expressed at a specific site on the chromosome of Saccharomyces cerevisiae; (4) Screening the positive clones of the Saccharomyces cerevisiae recombinant strain by a screening-type culture medium; (5) Inoculating the single colonies grown on the screening medium plate into YEPD liquid medium, culturing for 16-36 h, and verifying the genome by PCR amplification to obtain the naringenin-producing Saccharomyces cerevisiae engineering strain.

6. The method of construction of claim 5, wherein: The gene expression cassette is first constructed on plasmids pRS416, pRS426, and pRS425, specifically as follows: (1) a heterologous gene fragment codon-optimized Fj TAL, Pt 4CL, Sj CHS, Ms CHI, RIAD, RGG, and RIDD as templates to obtain gene fragments Fj TAL, Pt 4CL, Sj CHS, Ms CHI, RIADn-RGGm, and RIDD, whose sequences are SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, and SEQ ID NO. 6, respectively; and P TEF1 - Sphis5 + - T TEF1 a selection marker gene fragment; and P TEF1 - KanMX - T TEF1 a selection marker gene fragment; and P TEF1 - hphMX6 - T TEF1 a selection marker gene fragment; and P TEF1 - hphMX6 - T TEF1 a selection marker gene fragment; and P TEF1 - Ble - T TEF1 a selection marker gene fragment; and P TEF1 - Ble - T TEF1 a selection marker gene fragment; and P TPI1 a promoter; and T CYC1 a terminator; and P CUP1 a selection marker gene fragment; and P CUP1 Promoter; PCR amplification was performed using plasmid pSH65 as a template to obtain P TEF1 Promoter; (2) Using plasmids pRS416, pRS426, and pRS425 as vectors, selecting specific restriction enzyme double digestion sites, and cutting the vectors by enzymes, separating the enzyme digestion products by agarose gel electrophoresis, and recovering and purifying the gel to obtain linearized vectors; (3) Linking the fragments and the vectors by using seamless cloning enzymes, transforming the ligation products into E. coli competent cells DH5α, obtaining positive transformants on a culture medium with an ampicillin resistance of 0.1 g / L, extracting plasmids, and verifying the recombinant plasmids by sequencing; Alternatively, the specific steps of the construction method are as follows: (1) According to the codon preference of Saccharomyces cerevisiae, the codons of the target genes tyrosine ammonia-lyase gene TAL, 4-coumaric acid: coenzyme A ligase gene 4CL, chalcone synthase gene CHS, chalcone isomerase gene CHI, short peptide gene RIDD, short peptide gene RIAD and short peptide gene RGG are partially optimized or fully optimized, and then the target gene fragments are obtained by gene synthesis method, and Kpn I restriction endonuclease DNA sequence is added at the 5' end and Sac II restriction endonuclease DNA sequence is added at the 3' end; (2) using the synthesized gene as a template, performing PCR amplification to obtain a heterologous gene fragment Fj TAL, Pt 4CL, Sj CHS, Ms CHI, RIAD, RGG, RIDD; using plasmid pUG27 as a template, performing PCR amplification to obtain P TEF1 - Sphis5 + - T TEF1 a selection marker gene fragment; using plasmid pUG6 as a template, performing PCR amplification to obtain P TEF1 - KanMX - T TEF1 a selection marker gene fragment; using plasmid P TEF1 - hphMX6 - T TEF1 pUG27 as a template, performing PCR amplification to obtain P TEF1 - hphMX6 - T TEF1 a selection marker gene fragment; using plasmid P TEF1 - Ble - T TEF1 pUG27 as a template, performing PCR amplification to obtain P TEF1 - Ble - T TEF1 a selection marker gene fragment; using plasmid pYX212 as a template, performing PCR amplification to obtain P TPI1 a promoter; using plasmid pYES2.0 as a template, performing PCR amplification to obtain T CYC1 a terminator; using plasmid P CUP1 pRS416 as a template, performing PCR amplification to obtain P CUP1 a promoter; using plasmid pSH65 as a template, performing PCR amplification to obtain P TEF1 a promoter; using the genome of Saccharomyces cerevisiae BY4741 as a template, performing PCR amplification to obtain a 300-700 bp homologous arm sequence upstream and downstream of a gene integration site; (3) The plasmids pRS416, pRS426 and pRS425 are used as vectors, specific restriction endonuclease double enzyme digestion sites are selected, the vectors are digested, the digestion products are separated by agarose gel electrophoresis, and the gel is recovered and purified to obtain linearized vectors; (4) The fragments are connected with the vectors by using seamless cloning enzyme, the connection product is transformed into E. coli competent cells DH5α, positive transformants are obtained on a culture medium with an end concentration of 0.1 g / L ampicillin resistance, plasmids are extracted, and sequencing verification is performed to obtain a recombinant plasmid; (5) The constructed gene expression cassette P CUP1 - RIDD - Pt4CL - T CYC1 - P TPI1 - RIDD - FjTAL - T CYC1 - P TEF1 - hphMX6 - T TEF1 PCR amplification was performed, the obtained DNA fragment was transformed into Saccharomyces cerevisiae cells by lithium acetate transformation method, and integrated into the ARO10 site of Saccharomyces cerevisiae genome, and the Saccharomyces cerevisiae engineering strain expressing Fj TAL and Pt 4CL was screened on solid culture medium with 0.1-0.3 g / L of hygromycin B. (6) Construct the gene expression cassette P TEF1 - SjCHS - T CYC1 - P TEF1 - KanMX - T TEF1 PCR amplification was performed, and the resulting DNA fragments were transformed into *Saccharomyces cerevisiae* cells using lithium acetate conversion, and integrated into the *Saccharomyces cerevisiae* genome. FDC1 The site was simultaneously expressed on solid culture medium containing 0.1–0.3 g / L genimycin. Fj TAL、 Pt 4CL Sj CHS engineered strains of Saccharomyces cerevisiae; (7) Construct the gene expression cassette P TPI1 - MsCHI - T CYC1 - P TEF1 - Sphis5 + - T TEF1 PCR amplification was performed, and the resulting DNA fragments were transformed into *Saccharomyces cerevisiae* cells using lithium acetate conversion, and integrated into the *Saccharomyces cerevisiae* genome. PAD1 The site was simultaneously expressed on histidine auxotrophic solid medium. Fj TAL、 Pt 4CL Sj CHS, Ms CHI's engineered brewer's yeast strain; (8) The constructed gene expression cassette P CUP1 - RIADn - RGGm - T CYC1 - P TEF1 - Ble - T TEF1 PCR amplification was performed, the obtained DNA fragment was transformed into Saccharomyces cerevisiae cells by lithium acetate transformation method, and integrated into the PDC5 site of the Saccharomyces cerevisiae genome, and the Saccharomyces cerevisiae engineering strain expressing all the above genes was obtained on the solid culture medium with 0.05-0.2 g / L bleomycin; wherein the plasmid P TEF1 - hphMX6 - T TEF1 The sequence of pUG27 is shown in SEQ ID NO.

11. P TEF1 - Ble - T TEF1 The sequence of pUG27 is shown in SEQ ID NO.

12. P CUP1 The sequence of pRS416 is shown in SEQ ID NO.

13.

7. The application of the Saccharomyces cerevisiae engineering strain in the production of naringenin according to any one of claims 1 to 4.

8. The method for producing naringenin by fermentation using the engineered Saccharomyces cerevisiae strain according to any one of claims 1 to 4, characterized in that: The steps are as follows: The Saccharomyces cerevisiae engineering strain is streaked on a YEPD solid culture medium plate and cultured at 28-30 °C for 48-72 h, the activated strain is inoculated in a test tube containing 3-6 mL of YNB (Complete medium) liquid culture medium at 1-2 cycles, and the seed culture liquid is obtained by culturing at 28-30 °C and 180-220 rpm for 12-16 h, which is inoculated into YNB (Complete medium) fermentation medium at a volume ratio of 2-10%, and the fermentation is carried out at 28-30 °C and 180-220 rpm for 24-72 h, and the substrate L-tyrosine is added in batches for bioconversion to synthesize naringenin.

9. The method of claim 8, wherein: The YNB (complete medium) solid culture medium formula is: amino-free yeast nitrogen source 6.6-6.8 g / L, DO Supplement Complete 1.2-1.4 g / L, agar 2-3%, and ddH2O as the solvent; after sterilization, 1.7-2.3% of glucose is added; The YNB liquid culture medium is: amino-free yeast nitrogen source (YNB) 6.6-6.8 g / L, DO Supplement Complete 1.2-1.4 g / L, and ddH2O as the solvent; after sterilization, 1.7-2.3% of glucose is added; The YNB fermentation medium is: amino acid-free yeast nitrogen base (YNB) 6.6-6.8 g / L, DO Supplement Complete 1.2-1.4 g / L, 1.7-2.3% glucose is added after sterilization, and the solvent is ddH2O; The percentages are all mass concentration percentages.

10. A method for determining the yield of naringenin production using the engineered Saccharomyces cerevisiae strain according to any one of claims 1 to 4, characterized in that: The specific steps are as follows: (1) After the fermentation of the Saccharomyces cerevisiae engineering strain is completed, part of the fermentation broth is collected; (2) The collected fermentation broth is added to an organic solvent for extraction; (3) The supernatant of the extraction liquid is taken for rotary evaporation drying and redissolution with methanol; (4) The content of naringin is measured by high performance liquid chromatography; (5) The content of naringin is calculated.

Images