Deoxyribozyme targeting enolase 1 and application of deoxyribozyme in preparation of gene medicine for treating rheumatoid arthritis

Abstract

The invention discloses deoxyribozyme targeting enolase 1 and application of deoxyribozyme in preparation of a gene medicine for treating rheumatoid arthritis, and belongs to the technical field of biology. On the basis of a mouse ENO1 mRNA secondary structure, 15 deoxyribozyme is designed and screened, Dz8 has the strongest ENO1 mRNA cutting capacity, and the expression level of the gene can be effectively reduced; meanwhile, the Dz8 has Mg-dependent efficient ENO1 mRNA cleavage activity and time-dependent multi-turnover kinetic characteristics, ENO1 expression can be remarkably inhibited at the gene and protein levels, then inflammatory factor secretion is reduced, the glycolysis level is regulated and controlled, and the Dz8 has important application prospects in the field of rheumatoid arthritis gene therapy. The invention provides a new target and a treatment strategy for rheumatoid arthritis gene therapy, and Dz8 is expected to become a potential tool for rheumatoid arthritis gene therapy.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to a deoxyribozyme targeting enolase 1 and application thereof in preparing a gene drug for treating rheumatoid arthritis. BACKGROUND

[0002] Rheumatoid arthritis (RA) is a common chronic, systemic autoimmune disease, mainly characterized by chronic inflammation of synovial tissue, synovial hyperplasia (formation of pannus), and progressive joint cartilage and bone destruction, ultimately leading to joint deformity and loss of function, which seriously affects the quality of life of patients. Although existing treatment options, such as non-steroidal anti-inflammatory drugs, disease-modifying antirheumatic drugs, and biological agents (such as anti-TNF-α antibodies, anti-IL-6 receptor antibodies, etc.), have improved the prognosis of some patients, there are still significant limitations, including poor response in some patients, serious adverse reactions from long-term use, high treatment costs, and difficulty in achieving sustained remission or cure. Therefore, developing efficient, specific, and safe rheumatoid arthritis treatment strategies, especially those that can precisely target the core pathological mechanisms of the disease, is a hot topic in current basic research and clinical application fields.

[0003] Recent studies have shown that metabolic abnormalities in macrophages are a key mechanism of RA joint destruction, and the immune activation state of macrophages is closely linked to their metabolic patterns. Under inflammatory stimulation, macrophages undergo significant metabolic reprogramming, one of the characteristics of which is the shift from oxidative phosphorylation to aerobic glycolysis. This metabolic reprogramming provides the material basis for macrophages to rapidly produce adenosine triphosphate (ATP) and biological macromolecules, to meet the energy and synthetic raw materials required for their activation, proliferation, and secretion of large amounts of inflammatory factors. Therefore, inhibiting this abnormal glycolytic activity is expected to weaken the pro-inflammatory function of macrophages, and has important application prospects in the design of rheumatoid arthritis treatment strategies.

[0004] Enolase 1 (ENO1), also known as α-enolase, is one of the key enzymes in the glycolytic pathway, responsible for catalyzing 2-phosphoglycerate to phosphoenolpyruvate, which is crucial in energy production and metabolic flux regulation. ENO1 can also perform non-enzymatic functions on the membrane surface, acting as a ligand for related functional proteins (plasminogen, apolipoprotein B, etc.), stimulating monocyte / macrophage release of inflammatory factors (such as TNF-α, IL-1β, etc.), further amplifying the inflammatory cascade. Inhibition of ENO1 can directly disrupt the glycolytic flow, limiting energy supply and biosynthesis, thereby inhibiting the overactivation of macrophages and the production of pro-inflammatory factors.

[0005] Although targeting glycolytic pathway is a research hotspot, there are few reports on small molecule inhibitors with high specificity and high activity against ENO1. The fundamental reason is that such inhibitors usually face the challenges of poor selectivity, high off-target efficiency, poor pharmacokinetic properties, etc. Although siRNA or shRNA can silence the expression of ENO1 by targeting ENO1 mRNA, they usually have the bottlenecks of low cell uptake efficiency (dependent on vectors), poor in vivo stability (easy to be degraded by nucleases), the need for a suitable delivery system (increasing complexity, cost and potential toxicity), potential off-target effects, and the potential to trigger non-specific immune responses. Monoclonal antibodies targeting extracellular ENO1 can theoretically block its pro-inflammatory activity, but the long development cycle, high cost, and potential risks of neutralizing antibody formation and immunogenicity limit its application prospects.

[0006] Deoxyribozyme is a kind of single-stranded DNA molecule with catalytic activity. Through in vitro screening technology, a deoxyribozyme that can specifically recognize and bind to a specific target RNA sequence and then efficiently cut it can be designed. Its main advantages include: high catalytic activity; strong targeting; high stability; small molecular weight; clear mechanism of action, etc. Currently, studies (Fahmy, R, Waldman, A, Zhang, G. et al. Suppression of vascular permeability andinflammation by targeting of the transcription factorc-Jun. Nat Biotechnol 24, 856-863 (2006)) have achieved the reduction of the expression levels of c-Jun, E-selectin, ICAM-1 and other genes by deoxyribozyme molecule Dz13, thereby relieving the symptoms of joint swelling, inflammatory cytokine infiltration and bone erosion in RA mouse models.

[0007] The present application first designs a deoxyribozyme molecule targeting ENO1, which inhibits glycolysis energy supply by precisely cutting ENO1 mRNA, realizes the inhibition of inflammation storm and the intelligent activation of physiological environment, and provides a new strategy for the gene therapy of rheumatoid arthritis. SUMMARY

[0008] The purpose of the present application is a deoxyribozyme targeting enolase 1 and its application in the preparation of a gene drug for treating rheumatoid arthritis.

[0009] The application confirms that ENO1 gene is highly expressed in synovial macrophages of rheumatoid arthritis (RA) patients, and participates in lipopolysaccharide-induced inflammatory response and glycolysis process, and is a key target point for the occurrence and development of RA through analyzing the GSE97779 database and combining immunofluorescence, real-time fluorescence quantitative PCR and other experiments. Based on the secondary structure of mouse ENO1 mRNA sequence (NM_001379127.2), 15 deoxyribzymes are designed and screened, wherein Dz8 has the strongest ENO1 mRNA cutting capacity, has Mg2+-dependent high cutting activity and time-dependent multi-turnover kinetic characteristics, can significantly inhibit ENO1 expression at the gene and protein levels, and then reduce the secretion of inflammatory factors and regulate the glycolysis level. The deoxyribzyme can realize precise gene therapy for RA by inhibiting the intracellular glycolysis level, provide a new target and strategy for RA gene therapy, and is expected to become a potential tool for RA gene therapy.

[0010] The deoxyribozyme Dz8 targeting ENO1 mRNA in the application belongs to the 10-23 type deoxyribozyme, which has both the chemical stability of antisense oligonucleotides and the function of catalytic cleavage of RNA. The deoxyribozyme Dz8 is composed of two parts: a highly conserved catalytic function sequence in the center and a target gene binding arm on both sides. The sequence of the deoxyribozyme Dz8 targeting ENO1 mRNA in the application is shown in the nucleotide sequence of SEQ ID NO. 24, and the specific sequence is: Dz8: TCCAGGTCAGGCTAGCTACAACGAACTTGCCAG The catalytic function sequence is composed of 15 deoxyribonucleotides, and the specific sequence is 5'-GGCTAGCTACAACGA-3', which is the functional center of RNA cleavage reaction and can activate its catalytic activity through its own conformation change. The deoxyribozyme forms a stable double-stranded complex with the target RNA (such as mRNA) through the base complementary pairing of the binding arms (5'-TCCAGGTCA and ACTTGCCAG-3') on both sides, and the 5' end binding arm (5'-TCCAGGTCA) is complementary to the sequence at the 3' end of the target RNA cleavage site, and the 3' end binding arm (ACTTGCCAG-3') is complementary to the sequence at the 5' end of the target RNA cleavage site. This pairing makes the deoxyribozyme and the target RNA form a stable double-stranded complex, and precisely locates the cleavage site near the catalytic core. The cleavage of the 10-23 type deoxyribozyme has strict sequence specificity, only acts on the "R↓Y" structure (R is A or G, Y is U or C, and ↓ is the cleavage point) in the target RNA, and the cleavage occurs at the phosphodiester bond between R and Y.

[0011] In the present application, the stability of the deoxyribozyme can be further enhanced by chemical modification. Specifically, the phosphodiester bond between the nucleotides connected to the deoxyribozyme is modified to improve the deoxyribozyme's resistance to acidic environments and enzymatic degradation. In the deoxyribozyme Dz8 described in the present application, two deoxyribonucleotides at each end of the deoxyribozyme are thio-modified, i.e., one non-bridging oxygen atom in the phosphodiester bond is replaced by a sulfur atom (thio-modification was performed by Shengong Bioengineering (Shanghai) Co., Ltd.), and then purified using HPLC grade, thereby obtaining a thio-modified deoxyribozyme Dz8 powder with better stability, the sequence of which is as follows: Thio-modified Dz8: T*C*CAGGTCAGGCTAGCTACAACGAACTTGCC*A*G wherein "*" represents thio-modification; In the present application, the treatment of rheumatoid arthritis by the deoxyribozyme Dz8 is mainly carried out by the following steps: the deoxyribozyme Dz8 powder targeting ENO1 (synthesized by Shengong Bioengineering (Shanghai) Co., Ltd.) is dissolved in nuclease-free water (ThermoFisher Scientific, USA) to obtain a deoxyribozyme Dz8 solution; using mouse monocyte macrophage leukemia cells (RAW 264.7) as an inflammation model, the deoxyribozyme Dz8 solution is transfected into RAW264.7 using the universal transfection reagent Lipofectamine 3000, and the deoxyribozyme Dz8 can exert a cleavage effect to reduce the gene and protein levels of intracellular ENO1 mRNA. In the present application, when preparing a rheumatoid arthritis gene drug, the deoxyribozyme Dz8 can be combined with cationic liposomes, biodegradable polymers, targeted modification carriers, and viral vectors. Among them, the cationic liposome is represented by Lipofectamine 3000, which has been used to mediate the transfection of Dz8 into RAW264.7 cells in Example 5, confirming that it can efficiently deliver Dz8 and achieve ENO1 expression inhibition.

[0012] In summary, the present application designs and screens a deoxyribozyme Dz8 targeting ENO1 with high target gene recognition and cleavage activity by simulating the mRNA secondary structure of the ENO1 gene, and enhances its intracellular stability through chemical modification. Dz8 can significantly inhibit the expression of ENO1 in RAW264.7, thereby effectively reducing the glycolysis level and inhibiting inflammation, and thus the deoxyribozyme Dz8 targeting ENO1 described in the present application can be used to prepare a gene drug for treating rheumatoid arthritis. BRIEF DESCRIPTION OF DRAWINGS

[0013] Figure 1 The result graph of GSE database analysis of ENO1 expression in RA patients in Example 1; Figure 2Scanning electron microscope image of RAW264.7 cells after LPS stimulation for immunofluorescence analysis of ENOl protein expression level in Example 2; Figure 3 Bar chart of the expression levels of ENOl, IL-6, TNF-a, IL-1 b, Glutl, LDHA and Hk2 in RAW264.7 cells after treatment with siRNA targeting ENOl in Example 3; * indicates P<0.05, ** indicates P<0.01, *** indicates P<0.001, **** indicates P<0.0001, all of which are significant differences; Figure 4 Secondary structure diagram of the target gene ENOl mRNA obtained by simulation according to the method of Example 4; Figure 5 Relative quantification chart of the expression level of ENOl after treatment of RAW264.7 cells with different deoxyribozymes obtained by the method of Example 5; Figure 6 Urea-polyacrylamide gel electrophoresis chart of Mg 2+ Dependence obtained by the method of Example 6; Figure 7 Chart of the cleavage efficiency of Dz8 on the substrate at different time points obtained by the method of Example 7; wherein, Figure 7 (a) is a chart of the urea-polyacrylamide gel results for detecting the cleavage process of ENOl mRNA, the horizontal coordinate represents time (unit: min), respectively 0, 15, 30, 60, 120, 180, 240 min, and the changes of the bands of full-length ENOl mRNA and cleaved product at different time points are shown; Figure 7 (b) is a kinetic curve of the cleavage rate of ENOl mRNA with time, the horizontal coordinate is time (unit: min), and the vertical coordinate is Cleavage, the curve shows the change trend of the cleavage rate with time, and the apparent rate constant K obs = 0.0121 min -1 ; Figure 8 Chart of the protein expression of ENOl after treatment with siRNA targeting ENOl mRNA and deoxyribozyme Dz8 obtained by the method of Example 8; wherein, Figure 8 (a) is a chart of the Western blot gel results for detecting the expression of ENOl protein in different treatment groups, with b-actin as an internal reference (molecular weight 42 kDa), and the horizontal coordinate groups are Marker, control, LPS, Lipofectamine3000, siENOl, Dz8 in turn, and the molecular weight of ENOl protein is 47 kDa;Figure 8 (b) The column chart for quantifying the relative protein levels of ENO1 in different treatment groups. It can be seen that the expression levels of ENO1 in the Dz8 transfection group and the siENO1 group both showed a downward trend. The vertical coordinate is the relative protein level (fold change), and the horizontal coordinate is the grouping Figure 8 (a) Consistent, respectively, control, LPS, Lipofectamine 3000, siENO1, Dz8. DETAILED DESCRIPTION

[0014] The examples given below are further illustrations of the present application, in order to enable a more comprehensive understanding of the present application by those skilled in the art. However, the examples given cannot be understood as limiting the scope of protection of the present application, and thus non-essential improvements and adjustments made by those skilled in the art based on the above description of the application should also belong to the scope of protection of the present application.

[0015] Example 1 In order to explore the role of the gene ENO1 in RA, the gene expression profile data of RA patients and healthy control samples in the GSE97779 database was analyzed using the statistical tool GEO2R. In the data set search box of the GEO2R interface, input "GSE97779", click the "Analyze" button to import all sample data, and in the "Groups" function module of the tool, clearly divide the two groups of samples, set the healthy control samples as the "Control" reference group, and the RA patient samples as the "RA" experimental group. Then locate the target gene, input the gene symbol "ENO1" of the target gene ENO1 in the "Gene" search box of GEO2R, and finally perform the difference analysis process, taking the "Control" group as the reference, to analyze the expression data of the ENO1 gene in the RA group. The GEO2R tool will automatically complete the preprocessing steps such as background correction and Quantile standardization based on the original fluorescence intensity value, then fit the expression difference between groups through the built-in linear model, correct the variance between groups through Bayesian statistical test, and finally directly output the relative fold change of the gene expression of ENO1 gene in the RA group relative to the healthy control group (log2 transformed value, i.e. log2FC), and the P value reflecting the significance of the difference between groups. The results are shown in Figure 1 The expression of ENO1 gene in RA patients showed a high expression state, combined with the glycolytic enzyme activity of ENO1 itself and the role of membrane surface protein, showing the potential as a gene therapy target for rheumatoid arthritis.

[0016] Example 2 Immunofluorescence was used to explore the expression of ENOl in the cell model of rheumatoid arthritis. Macrophage RAW264.7 was seeded in 6-well plates containing cover glass at a density of 2.0 x 10 5 Figure 2 ​shown. For observing the cellular localization and morphological changes of ENOl protein under unstimulated (Control group) and 100 ng / mL LPS stimulated for 12 hours (LPS group), the images contain four channels of ENOl (green fluorescence, labeling ENOl protein), DAPI (blue fluorescence, labeling nucleus), Merge (fluorescence overlay of ENOl and DAPI), Bright field (bright field, showing the overall morphology of cells), and the scale bar "10 μm" in the lower right corner represents the actual size of the image; in the Control group, the green fluorescence of ENOl channel was diffusely distributed in the cytoplasm and the signal was weak, with no obvious tendency to aggregate to the cell membrane surface, the blue fluorescence of DAPI channel clearly labeled the round or oval and uniformly stained nuclei, and there was no obvious colocalization of green ENOl fluorescence and blue nuclear fluorescence in the Merge channel, and the cells in the Bright field channel were round or nearly round and closely arranged, consistent with the morphology of resting and inactivated macrophages; while in the LPS group, the green fluorescence of ENOl channel changed from diffuse distribution in the cytoplasm to aggregation to the cell membrane surface, forming a ring or patch-like fluorescence around the cell edge, and the fluorescence intensity of the membrane region of some cells was significantly enhanced, the number of blue fluorescence labeled nuclei in the DAPI channel was reduced compared with the Control group, and the morphology of some nuclei became irregular, the green ENOl fluorescence in the Merge channel was obviously surrounded by the blue cell nuclei, i.e. the cell membrane region, directly verifying the translocation of ENOl protein to the cell membrane surface, and the cells in the Bright field channel changed from round or nearly round to irregular morphology with pseudopodia and loose arrangement between cells, which was a typical feature of macrophage activation and morphological polarization after LPS stimulation; this localization and translocation of ENOl protein from the cytoplasm to the cell membrane surface after LPS stimulation was completely consistent with the biological function of ENOl as a membrane surface molecule, which started the inflammatory signaling pathway such as NF-κΒ by binding to signal proteins such as plasminogen and apolipoprotein B, and promoted the release of inflammatory mediators, and also provided direct cytological mechanism evidence for the gene therapy strategy of targeting ENOl gene to inhibit the release of inflammatory factors and reduce the inflammatory response of rheumatoid arthritis, i.e. to block the ENOl mediated inflammatory signal initiation from the source.

[0017] Example 3 To clarify the biological function of ENOl at the cellular level and provide preliminary experimental basis for the study of deoxyribozyme therapy, real-time fluorescent quantitative PCR strategy was used to detect the expression of inflammatory factors and key glycolytic enzymes in RAW264.7 cells treated with siENOl. 2 x 10 5RAW264.7 cells were seeded in 6-well plates at a density of 1 cell / well and stimulated with 100 ng / mL LPS for 12 hours. When the cell confluence reached 70%, commercial transfection reagent Lipofectamine 3000 (Thermo Fisher, USA) was mixed with siRNA targeting ENOl (synthesized by Suzhou Jimake Gene Co., Ltd.) at a ratio of 3 μL:2 μg (v:w) and incubated for 15 minutes, then added to the cultured cell system for continuous culture for 12 hours. The cells in each group were lysed using TRNzol Universal Total RNA Extraction Reagent (Tiangen Bioscience Co., Ltd., China), and total RNA was extracted according to the kit instructions; 1 μg of total RNA was reverse transcribed using the PrimeScript RT reagent kit (TAKARA, Japan) to obtain cDNA. The TB Green Premix EX Taq Kit (TAKARA, Japan) and the corresponding primers were used to detect the gene expression level in the above samples in the real-time fluorescent quantitative PCR reaction. β-actin was used as an internal reference, and the mRNA expression levels of IL-6, TNF-α, IL-1β, Glutl, Ldha, and Hk2 were calculated using the 2 -ΔΔCt method, and finally presented in the form of "fold change relative to the Control group", i.e. the "Relative fold change" data shown in the ordinate. The corresponding primer sequences are as follows (synthesized by Shenguo Bioengineering (Shanghai) Co., Ltd.): β-actin forward primer: AGTGTGACGTTGACATCCGT β-actin reverse primer: GCAGCTCAGTAACAGTCCGC ENO1 forward primer: GAGTCTCTTCAGGCGTGCAAG ENO1 reverse primer: CAGTCTTGATCTGCCCAGTGC IL-6 forward primer: TCCGGAGAGGAGACTTCACA IL-6 reverse primer: GTGACTCCAGCTTATCTCTTGGT TNF-α forward primer: ACCCTCACACTCACAAACCA TNF-α reverse primer: ACAAGGTACAACCCATCGGC IL-1β forward primer: TGCCACCTTTTGACAGTGATG IL-1β reverse primer: AAGGTCCACGGGAAAGACAC Glut1 forward primer: TACACCCCAGAACCAATGGC Glut1 reverse primer: CCCGTAGCTCAGATCGTCAC Ldha forward primer: AACTTGGCGCTCTACTTGCT Ldha reverse primer: TAGCCGCCTGAGGACTTACT Hk2 forward primer: TGATCGCCTGCTTATTCACGG Hk2 reverse primer: AACCGCCTAGAAATCTCCAGA The nucleotide sequences thereof are shown in SEQ ID NO. 1~ SEQ ID NO. 16, respectively.

[0018] The results are shown in Figure 3 Compared with Control, the expression level of ENOl gene was significantly reduced after transfection of siRNA, and the levels of inflammatory factors IL-6, TNF-a, IL-1β also appeared different degrees of reduction, indicating that reducing the expression level of ENOl target has good anti-inflammatory effect. At the same time, the expression levels of glycolysis metabolites Ldha and key enzymes Glutl and Hk2 of glycolysis also showed a decreasing trend, that is, ENOl target has good ability to regulate cell glycolysis.

[0019] Example 4 Based on the mouse ENOl mRNA sequence (NM_001379127.2), the secondary structure under physiological conditions was simulated by RNA draw V1.1b2 software, and the results are shown in Figure 4 The mRNA folds to form a stable secondary conformation containing multiple high accessibility loop regions (Loop region). In order to improve the gene silencing efficiency and break through the secondary structure barrier, deoxyribozyme design was carried out for the Loop region, and a total of 15 deoxyribozymes, namely Dzl-Dzl5, were obtained. The specific sequences are as follows: Dzl: ACAGTGGGAGGCTAGCTACAACGATCCCACGGG Dz2: GTCTTATCAGGCTAGCTACAACGATGTCTCGGA Dz3: CGGGTCTTAGGCTAGCTACAACGACATTGTCTC Dz4: TCTCGATCAGGCTAGCTACAACGACAGCTTGTC Dz5: GCCATTGGAGGCTAGCTACAACGATGGGCCAGC Dz6: CAATGCGCAGGCTAGCTACAACGAGGCTTCCCG Dz7: CCTTTGCGAGGCTAGCTACAACGATGCAGTCTT Dz8: TCCAGGTCAGGCTAGCTACAACGAACTTGCCAG Dz9: TCAAAGGGAGGCTAGCTACAACGACTTCGATGG Dz10: CTGCAGGGAGGCTAGCTACAACGATCGGTCACA Dz11: GTCTGGAGAGGCTAGCTACAACGAGCCCTTCCC Dz12: CCAGGGACAGGCTAGCTACAACGATCCCAGGAT Dz13: AAAGGGGCAGGCTAGCTACAACGACCCCTTTTC Dz14: CAGGTCATAGGCTAGCTACAACGATTGCCAGAC Dz15: AGTTCTGGAGGCTAGCTACAACGAGAAGGACTT The nucleotide sequences thereof are shown in SEQ ID NO. 17~ SEQ ID NO. 31, respectively.

[0020] Further, the two ends of the deoxyribzymes Dzl~Dzl5 are each subjected to 2 deoxyribonucleotides of thio modification, i.e. one non-bridging oxygen atom in the phosphodiester bond is replaced by a sulfur atom (phosphorothioate bond modification is performed by Zhejiang Hisson Bioengineering Co., Ltd.), and then HPLC grade purification is adopted, so as to obtain thio-modified deoxyribzyme Dzl~Dzl5 powder with better stability, and the sequences thereof are shown as follows: Thio-modified Dzl: A*C*AGTGGGAGGCTAGCTACAACGATCCCACG*G*G Thio-modified Dz2: G*T*CTTATCAGGCTAGCTACAACGATGTCTCG*G*A Thio-modified Dz3: C*G*GGTCTTAGGCTAGCTACAACGACATTGTC*T*C Thio-modified Dz4: T*C*TCGATCAGGCTAGCTACAACGACAGCTTG*T*C Thio-modified Dz5: G*C*CATTGGAGGCTAGCTACAACGATGGGCCA*G*C Thio-modified Dz6: C*A*ATGCGCAGGCTAGCTACAACGAGGCTTCC*C*G Thio-modified Dz7: C*C*TTTGCGAGGCTAGCTACAACGATGCAGTC*T*T Thio-modified Dz8: T*C*CAGGTCAGGCTAGCTACAACGAACTTGCC*A*G Thio-modified Dz9: T*C*AAAGGGAGGCTAGCTACAACGACTTCGAT*G*G Thio-modified Dz10: C*T*GCAGGGAGGCTAGCTACAACGATCGGTCA*C*A Thio-modified Dz11: G*T*CTGGAGAGGCTAGCTACAACGAGCCCTTC*C*C Thio-modified Dz12: C*C*AGGGACAGGCTAGCTACAACGATCCCAGG*A*T Thio-modified Dz13: A*A*AGGGGCAGGCTAGCTACAACGACCCCTTT*T*C Thio-modified Dz14: C*A*GGTCATAGGCTAGCTACAACGATTGCCAG*A*C Thio-modified Dz15: A*G*TTCTGGAGGCTAGCTACAACGAGAAGGAC*T*T Wherein, "*" represents thio-modification.

[0021] Example 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at a density of 2 x 10 5 RAW264.7 cells were seeded in 6-well plates at

[0022] Results are shown in Figure 5 Figure 6. Control represents blank control group without any treatment, providing a baseline reference for ENOl gene expression; LPS is lipopolysaccharide, as an inflammatory stimulant group, used to simulate the inflammatory environment in rheumatoid arthritis to observe the expression changes of ENOl gene under inflammatory conditions; siNC is a negative control small interfering RNA group, used to rule out the influence of non-specific interference on experimental results and verify the specificity of the experiment; siENOl is a positive control small interfering RNA group targeting ENOl, used to confirm the feasibility of the gene silencing strategy targeting ENOl and provide a positive reference for the results of the deoxyribozyme group. By comparing with 15 deoxyribozyme (D1-D15) transfection groups, the knockdown effect of each deoxyribozyme on ENOl gene expression was comprehensively and rigorously evaluated. It can be seen that after transfection of 15 deoxyribozymes respectively, there are obvious differences in the expression level of ENOl gene, among which the knockdown effect of Dz8 on the expression level of target gene ENOl after transfection is the most significant, that is, Dz8 has good ENOl mRNA cleavage activity and can significantly reduce the expression level of intracellular ENOl.

[0023] Example 6 The in vitro activity experiment process of deoxyribozyme Dz8 cleaving ENOl mRNA based on Mg2+ concentration gradient is as follows: first, construct the reaction system, each group contains ENOl mRNA as substrate, deoxyribozyme Dz8 (“+” indicates addition), and different concentrations of Mg2+ solution (gradient is 0, 1, 2, 3, 4 mM) as variables. The reaction system is prepared as shown in Table 1 to maintain a suitable reaction environment. Then, heat at 95 ℃ for 5 minutes, then cool to room temperature, and incubate each group at 37 ℃ for 2 hours to ensure that the reaction is fully carried out. After the reaction is completed, separate the RNA products by urea-polyacrylamide gel electrophoresis (Urea-PAGE), and use the Universal Hood II system (Bio-Rad, USA) to observe and analyze the RNA bands to explore the cleavage effect of Dz8 on ENOl mRNA under different Mg2+ concentrations.

[0024] Table 1: Urea-polyacrylamide gel electrophoresis buffer system Tris-HCl buffer (pH 7.5) 50 mM NaCl 150 mM MgCl2 0, 1, 2, 3, 4 mM Dz8 2 μΜ ENO1 mRNA 4 μΜ As shown in Figure 6 , 0 mM Mg 2+ group can only observe full-length ENOl mRNA band (full-length ENOl mRNA) and Dz8 band, almost no cleavage product, indicating that in the absence of Mg 2+ , Dz8 cannot effectively cleave ENOl mRNA, that is, the catalytic ability of Dz8 depends on Mg2+ As Mg 2+ concentration increased, the substrate band gradually disappeared and the cleaved product band gradually appeared, indicating that the cleavage activity of Dz8 on ENOl mRNA substrate was enhanced with the increase of Mg 2+ concentration, but the change trend had a saturation effect, i.e. 3 mM Mg 2+ was the optimal condition for Dz8 to exert catalytic activity, which was consistent with the action mechanism of 10-23 type deoxyribozyme dependent on divalent cation activation.

[0025] Example 7 The process of deoxyribozyme Dz8 multi-turnover kinetic cleavage reaction was as follows: the construction of reaction system was shown in Example 6, the difference was that the Mg 2+ concentration was fixed at 3 mM, and the reaction time at 37 °C was 15 min, 30 min, 60 min, 120 min, 180 min and 240 min, respectively. NaCl and MgCl2 were added to start the reaction, 10 mM EDTA was added to terminate the reaction after the incubation time, and then Urea-PAGE analysis was performed. The gel image was observed using Universal Hood II system, and then the gray scale quantitative analysis of the bands was performed using ImageJ software, and the gray scale value of the full-length ENOl mRNA band (denoted as A) and the gray scale value of the cleaved product band (denoted as B) at each time point were determined, respectively. The calculation logic of the cleavage percentage was as follows: taking the gray scale sum of all bands (A+B) as the total amount of substrate and product at this time point, the cleavage percentage (Cleavage) =

B / (A+B)

[0026] Example 8 The expression of ENOl protein in RAW264.7 cells treated by deoxyribozyme was detected by Western blot. Referring to the method of Example 5, siRNA targeting ENOl and Dz8 were transfected into RAW264.7 cells, respectively, and cultured for 48 hours. After treatment, the cells were collected and lysed on ice with radio-immunoprecipitation assay lysis buffer (RIPA) containing protease inhibitor phenylmethylsulfonyl fluoride, and the mixture was gently shaken every 15 minutes for 1 hour. After extracting the total protein from the cells, the protein concentration was quantitatively analyzed by Bicinchoninic acid (BCA) protein assay kit. 5x sodium dodecyl sulfate (SDS) loading buffer was added to the sample, and the sample was denatured at 100°C for 10 min. The denatured sample was separated by 10% SDS-polyacrylamide gel electrophoresis, and then transferred to a poly (1,1-difluoroethylene) (PVDF) membrane at a constant current of 250 mA for 1 hour in an ice bath. The PVDF membrane with protein was blocked with blocking buffer at room temperature for 15 minutes to block non-specific protein binding sites. The antibody was diluted to an appropriate proportion (ENO1: 1:1000; β-actin: 1:5000, purchased from Abeam, USA) with antibody diluent, and incubated overnight at 4°C on a shaker. The PVDF membrane was washed 3 times with Tris buffered saline Tween-20 (TBST) containing Tween-20, and then incubated with a corresponding species of horseradish peroxidase (HRP)-labeled secondary antibody at room temperature for 1 hour. The PVDF membrane was washed 3 times with TBST again, and then developed and photographed by an enhanced chemiluminescence kit. The gray scale of the band was quantitatively analyzed by ImageJ analysis software, and the gray scale value of the ENOl protein of the Control group was taken as the reference (set as 1 times). The gray scale values of other groups were calculated by ratio with the gray scale value of the Control group, so as to obtain the fold change of the relative protein level of each group, which was taken as the data of the vertical coordinate. As shown in FIG. 8, LPS stimulation or transfection with Lipofectamine3000 alone did not affect the protein expression level of ENOl. The expression levels of ENOl in the Dz8 transfection group and the siENOl group showed a downward trend, and the reduction effect was close, indicating that the deoxyribozyme Dz8 could bind to the target gene ENOl mRNA depending on the specific target binding sequence, and realize the inhibition of the expression level of the target gene. Figure 8

[0027] ​The above merely describes the preferred embodiments of the present application, and is not limited to the present application, and the present application can have various modifications and changes for those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. A deoxyribozyme targeting enolase 1, characterized in that: The nucleotide sequence of which is shown as SEQ ID NO.

24.

2. A thio-modified deoxyribozyme targeting enolase 1, characterized in that: The nucleotide sequence is as follows, T*C*CAGGTCAGGCTAGCTACAACGAACTTGCC*A*G Wherein, "*" represents a thio modification.

3. The use of the deoxyribozyme targeting enolase 1 according to claim 1 in the preparation of a gene drug for treating rheumatoid arthritis.

4. The use of the thio-modified deoxyribozyme targeting enolase 1 according to claim 2 in the preparation of a gene drug for treating rheumatoid arthritis.

Images