Phvul.002G015100 gene for improving saline-alkaline resistance of kidney beans and application of Phvul.002G015100 gene
By mining and introducing the Phvul.002G015100 gene, the problem of inhibited seed germination and root development of common beans in saline-alkali environments was solved, achieving high germination rate and high yield of common beans in saline-alkali land, and providing key gene resources for molecular breeding.
Patent Information
- Application Number
- CN202511999679.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-26
- Publication Date
- 2026-02-03
AI Technical Summary
In existing technologies, common beans are sensitive to salt and alkali stress, which leads to stunted germination rate and root development during seed germination, limiting their planting and yield improvement in saline-alkali areas. There is a lack of effective molecular breeding methods and key functional genes.
The Phvul.002G015100 gene was identified and a recombinant expression vector was constructed. This vector was then introduced into common bean or yeast for overexpression to enhance their salt and alkali tolerance.
It significantly improved the germination rate and root development of green beans in saline-alkali environments, promoted the planting and yield increase of green beans in saline-alkali land, and provided technical support for the utilization of saline-alkali land.
Smart Images

Figure CN121450671A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to a method for improving the salt and alkali tolerance of green beans. Phvul.002G015100 Genes and their applications. Background Technology
[0002] Soil salinization is a serious environmental problem facing agricultural production. Saline-alkali lands, with their high salt concentrations and high pH values, severely damage the plant growth environment, restricting agricultural production efficiency and the scope of crop cultivation. Common beans, an important legume crop used for both food and vegetables, are rich in protein, dietary fiber, and various minerals, and are widely cultivated in many regions, playing a vital role in ensuring agricultural product supply and improving dietary structure. However, common beans are highly sensitive to salt and alkali stress. A saline-alkali environment disrupts their cell osmotic pressure balance, inhibiting root development, seed germination, and photosynthesis, leading to slow growth, significantly reduced yields, and even crop failure. This has become the core bottleneck restricting the widespread cultivation of common beans in saline-alkali areas.
[0003] The seed germination period is one of the most sensitive stages of the common bean growth cycle to salt and alkali stress, and the tolerance at this stage directly determines the seedling survival rate and subsequent growth status. Under salt and alkali stress, common bean seeds experience hindered water absorption, reduced efficiency in the decomposition and translocation of endosperm nutrients, and a significant decrease in germination rate, germination index, and vigor index. Simultaneously, root cells are damaged, resulting in a reduction in total root length, root surface area, root volume, and the number of lateral roots, leading to a decrease in the seedling's ability to absorb water and nutrients, further exacerbating growth inhibition. Significant differences in salt and alkali tolerance exist among different common bean varieties, providing an important material basis for identifying salt and alkali tolerance-related functional genes. However, research on the molecular mechanisms of salt and alkali tolerance in common beans remains relatively weak.
[0004] Existing research on salt-alkali tolerance genes in plants mainly focuses on major food crops such as rice, wheat, and corn, with relatively few reports on the identification and functional verification of key genes for salt-alkali tolerance in common bean. Traditional breeding methods for salt-alkali tolerance in common bean rely heavily on phenotypic screening, which suffers from long cycles, low efficiency, and unclear genetic backgrounds, making it difficult to meet the demand for rapid breeding of new salt-alkali tolerant varieties. With the development of molecular biology techniques, transcriptome sequencing technologies such as RNA-seq have become effective means of discovering stress-responsive genes, enabling rapid identification of differentially expressed genes under different stress conditions and providing support for elucidating the molecular mechanisms of stress tolerance. However, the functions of differentially expressed genes related to salt-alkali tolerance in common bean are currently unclear, and there is a lack of validated key functional genes, limiting the application of molecular breeding techniques in improving salt-alkali tolerance in common bean. Therefore, discovering key genes regulating salt-alkali tolerance in common bean and clarifying their functions and mechanisms of action is of significant theoretical and practical importance for breeding new salt-alkali tolerant common bean varieties, expanding the planting area of common bean, and improving the utilization rate of saline-alkali land. Summary of the Invention
[0005] The purpose of this invention is to provide a method for improving the salt and alkali tolerance of green beans. Phvul.002G015100 This gene and its applications aim to address the problems existing in the aforementioned technologies. It can effectively enhance an organism's tolerance to salt and alkali stress.
[0006] To achieve the above objectives, the present invention provides the following solution: This invention provides a method for improving the salt and alkali tolerance of green beans. Phvul.002G015100 The gene, whose nucleotide sequence is shown in SEQ ID NO.1.
[0007] The present invention also provides a gene expression cassette, comprising the above-described components. Phvul.002G015100 Gene.
[0008] The present invention also provides a recombinant expression vector comprising the gene expression cassette described above.
[0009] The present invention also provides a recombinant host cell comprising the above-described recombinant expression vector.
[0010] The present invention also provides the above-mentioned Phvul.002G015100 Applications of genes, gene expression cassettes, recombinant expression vectors, or recombinant host cells in improving the salt and alkali tolerance of organisms.
[0011] Furthermore, the organism is a plant or yeast.
[0012] Furthermore, the plant in question is a common bean.
[0013] The present invention also provides a method for improving the salt and alkali tolerance of organisms, comprising taking the above-mentioned... Phvul.002G015100 Genes are genetically transformed into organisms, enabling the aforementioned Phvul.002G015100 The steps involved in gene overexpression in an organism; The organism is a plant or yeast.
[0014] Furthermore, the plant in question is a common bean.
[0015] Furthermore, the gene expression cassette, recombinant expression vector, or recombinant host cell described above can be used to express the gene... Phvul.002G015100 Genes undergo genetic transformation.
[0016] The present invention discloses the following technical effects: This invention successfully identified key genes for salt tolerance in common beans using transcriptome sequencing technology. Phvul.002G015100 Validation experiments using transgenic yeast confirmed that this gene can significantly improve the salt and alkali tolerance of recipient organisms. In a mixed salt-alkali stress culture medium, the gene was introduced... Phvul.002G015100The recombinant yeast strain with the gene showed significantly better growth than the control yeast strain with the empty vector, indicating that this gene can effectively enhance the organism's tolerance to salt and alkali stress. The discovery of this gene not only enriches the plant salt and alkali tolerance gene resource library and provides a key target for elucidating the molecular mechanism of salt and alkali tolerance in common bean, but also provides a core functional gene for the genetic improvement of salt and alkali tolerance in common bean. Using this gene to develop transgenic technology, new salt-tolerant common bean varieties can be bred, effectively improving the germination rate, growth vigor, and yield of common bean in saline-alkali environments. This provides important technical support for the development and utilization of saline-alkali land and has significant agricultural application value. Attached Figure Description
[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0018] Figure 1 A schematic diagram showing the germination of different bean varieties under salt stress treatment; Figure 2 Statistical graphs showing the germination rate (A), germination index (B), and vigor index (C) of different bean varieties under salt stress treatment; where S represents salt stress treatment and W represents water control treatment; Figure 3 Statistical graphs showing the total root length (A), total root surface area (B), total root volume (C), and number of lateral roots (D) during the germination period of different common bean varieties under salt stress treatment; where S represents the salt stress treatment and W represents the water control treatment; Figure 4 for Phvul.002G015100 Results of the transgenic yeast gene validation experiment; where CK is the normal culture medium and SA is the salt-alkali stress culture medium. Detailed Implementation
[0019] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0020] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0021] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0022] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0023] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0024] Example 1: Discovery of Salt Tolerance Genes Salt-alkali stress treatment was applied to two varieties of kidney beans (R: small black kidney bean; N: milk flower kidney bean). Figure 1 It was found that the germination indices of varieties R and N were lower than those of the control. The germination index of variety N decreased more significantly, while that of variety R decreased less, indicating that salt-alkali stress had a greater impact on variety N. Under salt-alkali stress, the vigor indices of both varieties were lower than the control, with the vigor index of variety N decreasing by 18.4% and that of variety R decreasing by 25.5%. Figure 2 Compared to the control, the number of lateral roots decreased in both N and R varieties during salt treatment. Figure 3 ).
[0025] Raw RNA-seq data were generated for common bean varieties R and N with different salt-related phenotypes. After filtering, the clean reads of all libraries ranged from 530,300 to 40.2 million, and the Q20 and Q30 values of all raw data exceeded 94% and 87%, respectively. More than 70% of the reads in each sample were aligned with the reference genome sequence, reflecting the quality of the sequencing reads. The clean RNA-seq data were stored in the National Center for Biotechnology Information database (accession number PRJNA558376).
[0026] Genes associated with salt-alkali stress response during soybean sprouting were identified, and gene expression differences among different samples were analyzed. The criteria for differentially expressed genes in the four libraries (WN, WR, SR, and SN) were: |log2(fold-change)|>1 and false discovery rate<0.05. 236 and 141 differentially expressed genes (DEGs) were found in SR and WR, and SN and WN, respectively. Among the differentially expressed genes between SR and WR samples, those also detected as DEGs in the SN and WN comparison were deleted. The remaining genes likely respond to salt-alkali stress. However, changes in the expression levels of the latter five DEGs (different expression in SR and WR, and also different expression in SN and WN) appeared to have no effect on the salinity response. Therefore, 231 genes that showed differential expression in SR and WR samples but not in SN and WN samples were selected as candidate genes. Furthermore, 1705 genes showed differential expression in the SR and SN comparisons, and 5825 genes showed differential expression in the WR and WN comparisons, with 18990 genes showing no differential expression. Genes identified as deg in the SR and SN comparisons were not found in the WR and WN comparisons, meaning their expression may affect salt tolerance in common soybeans. Therefore, they were selected as candidate genes. This example identified 441 genes associated with salt-alkali stress response, including... Phvul.002G015100 Gene (nucleotide sequence as shown in SEQ ID NO.1).
[0027] SEQ ID NO.1: ATGAACACAGGCGTTGTTCTTTCCAGAAAGGACATGGACCGTATCAAAGGCCCATGGAGCCCGGAGGAGGACGAGGCTCTGCAGAGGCTCGTCGAGAAGCACGGTCCCAGGAACTGGTCCCTCATCAGCAAGTCCATCCCTGGCCGCTCCGGCAAATCCTGCAGGCTCCGCTGGTGCAATCAGCTCTCCCCCCAGGTCGAGCACCGGGCCTTCACGCCCGAAGAGGACGACACCATAGTCAGGGCCCATGCTCGCTTCGGCAACAAATGGGCCACCATAGCCCGCTTGCTCCAGGGCAGAACCGACAACGCAATCAAGAACCACTGGAACTCCACGCTGAAGCGCAAGTGCGCCTCTACCATGATGGACGACCACCCTCCGCCGCTCAAGAGGTCCGTCAGTGCCGGCGCGGCCATCCCCGTCTCCACCGGCCTCTACATCAACCCTCCCACACCCGGTAGTCCCTCCGGATCCGATGTGAGTGAATCCAGCGCGCCAGTTGCCTCCCCCTCACACGTCTTCCGTCCCGTGCCCAGGACCGCCGCGGTTCTTCCTCCCGTAGAAACTACCTCCTCCTCCTCCAATGACCCTCCAACTTCCCTTTCACTGTCCCTCCCCGGCGTCGACTCTTCCGAGGTCTCCAATCGGGTAACCGAGCCAGCCCATCCCGTACCCCCGCCACAGCCCTCGAACACTATCCCGTTGCTGCCAATGATGGCTGCTCCGGTGGCGATGGTGCCGCAGTTGAAGCCACCGGGGTTGGGGGCTTTCAATCTGAGTGCGGAGTTTTTGGTGGTGATGCAGGAAATGATAAGGAAGGAGGTGAGGAGTTACATGGAGCGCCAGAATCCGAATGGGATGTGTTTTCAGGCAGCAGAGGATGGCTTTAGGAATACTTCCGTCAAGCGAATTGGGATTAGCAGGGTGGATTCGTAA。
[0028] Example 2 Phvul.002G015100 Functional verification of the gene To clarify the results obtained in Example 1 Phvul.002G015100 To determine whether a gene possesses the function of enhancing the salt and alkali tolerance of green beans, this embodiment employs a transgenic yeast verification system for functional validation experiments. Yeast, as a commonly used model microorganism for verifying the function of eukaryotic genes, is easily affected by external salt and alkali stress during its growth. Furthermore, the experimental cycle is short, and the results are intuitive, quickly reflecting the stress resistance function of the target gene. By... Phvul.002G015100 The gene was introduced into Saccharomyces cerevisiae INVSCⅠ to construct a recombinant yeast strain. The growth phenotype of the strain was compared with that of the control yeast strain transformed with an empty vector under salt and alkali stress conditions. This was done to clarify the role of the gene in enhancing the salt and alkali tolerance of organisms and to provide a theoretical basis and functional gene resources for the subsequent genetic improvement of salt and alkali tolerance in common bean.
[0029] 1. Experimental Materials 1.1 Strains and Vectors The Escherichia coli strain DH5α was purchased from Beijing Qingke Biotechnology Co., Ltd.; the Saccharomyces cerevisiae INVSC Ⅰ and the yeast expression plasmid vector pYES2 were both purchased from Beijing Coolplay Technology Co., Ltd.
[0030] 1.2 Main Reagents Hind III and EcoR I restriction endonucleases were purchased from NEB (Beijing) Co., Ltd.; homologous recombinases were purchased from Beijing Qingke Biotechnology Co., Ltd.; RNA extraction kits were purchased from Aisjin Biotechnology (Hangzhou) Co., Ltd.; reverse transcription kits were purchased from Beijing TransGen Biotechnology Co., Ltd.; product purification kits and plasmid extraction kits were purchased from Nanjing Novizan Biotechnology Co., Ltd.; KOD-Fx high-fidelity enzyme, anhydrous ethanol, agarose, etc.
[0031] 1.3 Main Equipment and Instruments High-speed low-temperature centrifuges, vortex mixers, water baths, autoclaves, nucleic acid and protein detectors, PCR amplifiers, electrophoresis apparatus, gel imaging systems, pipettes, pipette tips, and EP tubes, etc.
[0032] 2. Experimental Methods 2.1 Extraction and Detection of Total RNA from Plants Common bean seeds were germinated, and the radicles were collected after 4 days as samples. Samples should be immediately frozen in liquid nitrogen after collection. Store in a -80°C ultra-low temperature freezer. Follow the RNA extraction method outlined in the RNA extraction kit instructions. Finally, dissolve in RNase-free water and assess the quality of the prepared sample.
[0033] First, the concentration of extracted RNA and OD were measured. 260 / 280 OD 260 / 230 The values were then analyzed, and RNA integrity was detected by electrophoresis.
[0034] 2.2 Phvul.002G015100 Molecular cloning of genes (1) Synthesis of the first strand of cDNA Calculate the volume based on the RNA sample concentration, take 1 µg of total RNA as a template, and perform RT-PCR reverse transcription into cDNA according to the reverse transcription kit instructions.
[0035] (2) Phvul.002G015100 Gene cloning and PCR product recovery and purification Using cDNA as a template, PCR amplification was performed using the primers shown in Table 1.
[0036] Table 1 Primer Sequences
[0037] The PCR amplification system is shown in Table 2: Table 2 PCR system
[0038] The PCR reaction program was as follows: 94℃ pre-deformation for 2 min; 98℃ deformation for 10 s, 55℃ annealing for 45 s; 68℃ extension for 2 min, 35 cycles; 68℃ extension for 5 min. The PCR product length was verified by 1.0% agarose gel electrophoresis. Under UV light, the single target DNA band was removed as much as possible using a newly opened blade. The excised gel containing the DNA fragment was placed into a pre-weighed 1.5 mL centrifuge tube, weighed, and the product was recovered using a recovery kit. The experimental procedures were performed according to the manufacturer's instructions. The collected DNA solution was stored at -20℃.
[0039] 2.3 Obtaining the pYES2 plasmid The yeast expression vector used in this experiment was pYES2. A small amount of the purchased pYES2 plasmid was inoculated onto LB solid medium (100 mg / mL ampicillin) and cultured overnight. Then, single colonies were picked and cultured overnight in liquid medium. The pYES2 plasmid was extracted according to the instructions of the plasmid extraction kit.
[0040] The amplified target fragment was ligated into a vector, and the pYES2 plasmid was digested with EcoRI and HindIII. After agarose gel electrophoresis, the corresponding fragment was purified and recovered.
[0041] The enzyme digestion system is shown in Table 3: Table 3 Enzyme digestion system
[0042] Add the system components to a 200 μL centrifuge tube, gently mix, centrifuge briefly for 5 s, and then inactivate by heat at 37℃ for 30 min and 65℃ for 20 min.
[0043] 2.4 Ligation and transformation of the target fragment with the yeast expression vector The concentration of the purified fragment was measured, and the target fragment was ligated to the vector fragment using a homologous recombinase to construct the recombinant plasmid vector. The ligation system is shown in Table 4. Table 4 Connection System
[0044] Add the system components to a 200 μL centrifuge tube, gently mix, centrifuge briefly for 5 seconds, and then place at 50℃ for 30 minutes.
[0045] The recombinant plasmid vector was transformed into DH5α competent cells, and the culture medium contained 100 mg / mL ampicillin. After overnight incubation, colonies growing on the plates were found to be ampicillin-resistant. Single colonies were picked and inoculated into liquid medium containing ampicillin, and incubated overnight at 37°C and 200 rpm. Using the overnight culture as a template, PCR was performed. Recombinant plasmid vectors were extracted from PCR-positive colonies using a plasmid extraction kit.
[0046] 2.5 Yeast Conversion Freshly prepared competent yeast cells were used for transformation at room temperature, following the instructions in the transformation section. Finally, 50 μL of the transformation mixture was evenly spread onto SD-Ura (glucose) solid medium and incubated at 30°C for 3 days until white colonies appeared.
[0047] Single white colonies were picked and cultured overnight at 30°C and 200 rpm in SD-Ura liquid medium. The bacterial culture was then subjected to cell lysis at 100°C for 5 min. 5 μL of the lysed bacterial culture was used as a template for PCR detection to determine whether the target gene was accurately integrated into the yeast expression vector. The introduced... Phvul.002G015100 The recombinant yeast gene was named INVSCⅠ(pYES2- Phvul.002G015100 The recombinant yeast with the empty vector was named INVSCⅠ(pYES2).
[0048] 2.6 Phenotypic Identification of Recombinant Yeast To verify the effects of salt-alkali stress on transgenic yeast, a mixed salt-alkali stress method was used with NaCl, Na2CO3, NaHCO3 and Na2SO4 (molar ratio of 1:1:9:9) to observe its growth status, and the method was repeated three times.
[0049] (1) In a clean bench, select the successfully verified recombinant yeast and yeast with empty vector and place them in YPDA liquid medium (glucose) and culture overnight at 30°C and 200 rpm with shaking. (2) Determination of OD of overnight bacterial culture 600 Calculate the required bacterial culture volume so that the OD value of 5 mL of induction medium supplemented with galactose (SD-Ura) is 0.4; (3) Take the required volume of bacterial culture and centrifuge at 8000 rpm for 1 min; (4) First, resuspend the bacterial cells in 1 mL of SD-Ura, then add to a final volume of 5 mL; (5) Incubate overnight at 30℃ with shaking at 200 rpm; (6) Determine the OD of overnight bacterial culture 600 After calculation, OD is adjusted uniformly. 600 It is 2.0; (7) Dilute the bacterial solution by 10 μL each time. -1 times, 10 -2 times, 10 -3 times, 10 -4 times, 10 -5 times; (8) Using INVScⅠ(pYES2) transformed with empty vector yeast as a control, 5 μL of undiluted bacterial solution and diluted bacterial solution were inoculated onto normal YPDA solid medium and YPDA solid medium under mixed salt and alkali stress, respectively. (9) Incubate at 30℃ for 5 days; (10) Observe and record the growth of the plate, and analyze and compare the differences in yeast growth.
[0050] 3. Experimental Results This embodiment conducts a transgenic verification experiment in yeast. Phvul.002G015100 The functionality was verified, and the results show that... Phvul.002G015100 Genetically modified yeast has developed salt and alkali tolerance in salt- and alkali-tolerant culture media. Figure 4 ).
[0051] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A method for improving the salt and alkali tolerance of green beans Phvul.002G015100 Genes, characterized by, Its nucleotide sequence is shown in SEQ ID NO.
1.
2. A gene expression cassette, characterized in that, Including the claims 1 Phvul.002G015100 Gene.
3. A recombinant expression vector, characterized in that, Includes the gene expression cassette as described in claim 2.
4. A recombinant host cell, characterized in that, Includes the recombinant expression vector as described in claim 3.
5. A device as described in claim 1 Phvul.002G015100 The application of genes, gene expression cassettes of claim 2, recombinant expression vectors of claim 3, or recombinant host cells of claim 4 in improving the salt and alkali tolerance of organisms.
6. The application according to claim 5, characterized in that, The organism is a plant or yeast.
7. The application according to claim 6, characterized in that, The plant in question is a common bean.
8. A method for improving the salt and alkali tolerance of an organism, characterized in that, Including the one described in claim 1 Phvul.002G015100 Genes are genetically transformed into organisms, enabling the aforementioned Phvul.002G015100 The steps involved in gene overexpression in an organism; The organism is a plant or yeast.
9. The method according to claim 8, characterized in that, The plant in question is a common bean.
10. The method according to claim 8, characterized in that, Using the gene expression cassette of claim 2, the recombinant expression vector of claim 3, or the recombinant host cell of claim 4, the gene expression cassette of claim 2 is used to express the gene expression vector of claim 3. Phvul.002G015100 Genes undergo genetic transformation.