Multiplex PCR (Polymerase Chain Reaction) Panel for detecting favorable allelic variation of wheat scab-resistant site and application of multiplex PCR Panel
By using multiplex PCR panels to target and detect major genes and important resistance loci in wheat scab resistance, the complex genetic basis of resistance and the difficulty of detection in breeding have been solved, enabling efficient aggregation of multiple resistance loci and rapid breeding of stable resistant varieties.
Patent Information
- Application Number
- CN202511993269.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-26
- Publication Date
- 2026-02-03
AI Technical Summary
In existing wheat breeding, the improvement of resistance to Fusarium head blight faces multiple bottlenecks, including the complex genetic basis of resistance, the lack of stable and reliable sources of resistance, and the difficulty of molecular detection to support the actual breeding needs of multi-generation, large-scale, and multi-site aggregation, resulting in low breeding efficiency and a shortage of resistant varieties.
A multiplex PCR panel was developed to target and detect the major wheat resistance gene Fhb1 and important resistance sites QFhb_5A and QFhb_2D. Simultaneous and targeted detection was achieved through a multiplex PCR panel primer set. Combined with high-throughput sequencing and bioinformatics analysis, a molecular breeding method was constructed to achieve efficient aggregation of multiple resistance sites.
It improved the effectiveness of genetic improvement for resistance to Fusarium head blight, simplified the operation process, increased detection throughput and efficiency, promoted the generational accumulation and fixation of multi-resistance locus combinations, shortened the breeding process, and obtained new germplasm with stable resistance and excellent traits.
Smart Images

Figure CN121450835A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to wheat molecular breeding, in particular, to a multiplex PCR panel for polyploid favorable allelic variation of wheat resistance to scab and its application in molecular breeding. BACKGROUND
[0002] In the process of wheat production, disease infection is one of the main biological stress factors that restricts yield and quality formation. Among them, wheat scab is considered one of the most destructive diseases in wheat production due to its wide spread, high damage, and significant quality and food safety risks. After the occurrence of scab, not only will it cause grain shriveling, thousand-grain weight reduction, and significant deterioration of processing quality, but also the enrichment of trichothecene mycotoxins represented by deoxynivalenol (DON) in infected kernels, which poses a serious threat to human and animal health. In recent years, affected by multiple factors such as climate warming, adjustment of tillage system, and change of variety layout, scab has been continuously and more severely occurring in the middle and lower reaches of the Yangtze River, Jianghuai, and the southern part of the Huanghuai wheat region, and has become a major disease threatening regional and even national food security (Ma H X, Wang Y G, Gao Y J, et al. (2022) Review and Prospect of Wheat Resistance to Scab. Chinese Journal of Agricultural Sciences, 55(05): 837-855).
[0003] Breeding and applying scab-resistant varieties is the most economical, effective, and green and sustainable measure to control scab and its toxin damage. Since the establishment of the "National Wheat Scab Research Coordination Group" in the 1970s, scientific researchers have first systematically carried out resistance source identification, successfully screening out excellent resistance sources such as Sumai 3 and Wangshuibai, laying an important foundation for wheat scab resistance breeding in China and even the world. Since then, a variety of QTLs of different types of resistance have been analyzed, and the functions of some of the genes have been gradually elucidated. However, only Fhb1 the main resistance genes have been cloned in wheat so far, and the fine mapping and cloning of the remaining resistance QTLs have been slow, and the high-efficiency molecular markers closely linked to them that can be used for biological breeding are also very limited. In terms of breeding of disease-resistant varieties, according to statistics, most of the wheat varieties that have been bred and passed the national or provincial approval are moderately resistant, and very few of them are truly resistant, and new varieties that have both stable resistance and excellent agronomic traits are still relatively scarce.
[0004] In recent years, the rapid development of genomics and biotechnology has significantly promoted the transformation of wheat breeding from the traditional mode of "experience-driven and long cycle" to the molecular breeding stage of "high efficiency and precision and directional improvement". However, in the improvement of scab resistance, the existing breeding system still faces multiple bottlenecks, mainly in the following three aspects: First, the genetic basis of resistance is complex, and phenotype selection is difficult, which significantly restricts the efficiency of improvement of scab resistance: scab resistance is usually co-regulated by multiple genes, and shows obvious diversity of resistance types and strong environmental sensitivity, making phenotype identification itself difficult. Artificial inoculation of scab and resistance evaluation often rely on strict temperature and humidity conditions, which are highly sensitive to natural climate. Extreme weather conditions can easily lead to phenotype deviation or even failure of identification, making it difficult to obtain stable and reliable phenotype data, and greatly limiting the feasibility of effective screening in multiple generations and large-scale breeding populations. Although genome selection (GS) can be used for overall prediction of complex traits, its prediction ability depends on the quality of the model and the training population, and it is difficult to completely replace real phenotype data, so its application effect in improving scab resistance is still very limited. Under this background, the actual breeding work still mainly relies on the centralized identification of stable strains in the later stage, which not only prolongs the breeding cycle, but also reduces the overall efficiency of resistance improvement to some extent.
[0005] Secondly, the stable and reliable resistance sources are still insufficient, and the use of excellent allelic variation is limited: Although several scab resistance QTLs / genes have been identified through map-based cloning or mutant analysis, the effects of most of these sites are different in different genetic backgrounds, and their stability is insufficient. At the same time, the excellent allelic variation derived from the core backbone varieties and capable of continuously exerting resistance improvement effect in the genetic background of mainstream cultivars is still very limited. In addition, the complementary relationship between existing resistance sources has not been systematically sorted out, and the combined effect of different resistance types still needs to be further clarified. This not only restricts the accumulation and synergistic improvement of scab resistance, but also to some extent limits the in-depth application of gene editing and other precision breeding techniques in disease resistance improvement.
[0006] Thirdly, the existing molecular detection and selection methods cannot support the actual breeding needs of multiple generations, large-scale and multi-site aggregation: scab resistance is usually contributed by multiple sites, the number of major genes is limited, and the overall resistance depends on the accumulation of multiple micro-effect sites. Traditional molecular marker-assisted selection (MAS) is usually based on a single or a small number of markers, which is difficult to cover the complex genetic basis and is not conducive to the simultaneous identification and parallel selection of multiple resistance sites in early generations of breeding, thereby restricting the efficiency of resistance accumulation and multi-gene aggregation. Although high-density SNP chips have the ability to detect multiple sites, they have high detection costs, large marker redundancy and insufficient targeting, which are not suitable for large-scale detection of multiple generations and tens of thousands of materials in conventional breeding, and are difficult to truly apply. SUMMARY
[0007] In view of the above problems, the present application provides a multiplex PCR panel for detecting favorable allelic variations of wheat scab resistance sites and its application. The PCR panel can simultaneously and targetedly detect the major genes of wheat scab resistance Fhb1, important resistance loci derived from the Yangmai 158, a backbone parent in the middle and lower reaches of the Yangtze River QFhb_5A , and important resistance loci derived from the Ningmai 9, a backbone parent QFhb_2D . Based on the detection results of the Panel, the parents carrying different excellent allelic variations can be reasonably complemented (such as hybridization, backcrossing, etc.), and targeted detection and screening can be carried out in the offspring population, so as to efficiently identify and retain materials with multiple excellent genotype combinations, and the materials are selected in combination with the comprehensive performance of resistance and agronomic traits, so as to accelerate the breeding of new wheat germplasm with outstanding resistance to scab and excellent comprehensive traits.
[0008] In order to achieve the above-mentioned purpose, one aspect of the present application provides a multiplex PCR Panel primer set for detecting favorable allelic variations of wheat scab resistance loci, wherein the multiplex PCR Panel takes the wheat scab resistance major gene Fhb1 , the scab resistance loci QFhb_5A , and QFhb_2D as the target for targeted detection of the corresponding favorable allelic variations, the PCR Panel is FhbR3-panel, and the Panel comprises three groups of core primer pairs corresponding to RLoci 1-RLoci 3, respectively; each group of core primer pairs is composed of one upstream primer and one downstream primer. The nucleotide sequences of the upstream primers of the RLoci 1-RLoci 3 primer pairs are shown in SEQ ID No. 1, SEQ ID No. 3, and SEQ ID No. 5, respectively; and the nucleotide sequences of the downstream primers of the RLoci 1-RLoci 3 primer pairs are shown in SEQ ID No. 2, SEQ ID No. 4, and SEQ ID No. 6, respectively.
[0009] Each primer of the multiplex PCR Panel primer set based on the core primer is composed of a linker sequence and a core primer, wherein the 5' ends of the forward primer and the reverse primer are respectively connected to different linker sequences. Specifically: the 5' end of the forward primer is connected to a Ty_F linker sequence (SEQ ID No. 7: CACTCTTTCCCTACACGACG); the 5' end of the reverse primer is connected to a Ty_R linker sequence (SEQ ID No. 8: GACTGGAGTTCAGACGTGTG).
[0010] The nucleotide sequences of the multiplex PCR Panel primer set are shown in SEQ ID No. 9-SEQ ID No. 14.
[0011] The second aspect of the present application provides the above-mentioned multiplex PCR Panel primer set in the detection of the wheat scab resistance major geneFhb1 , scab resistance loci QFhb_5A and QFhb_2D application in corresponding favorable allelic variations.
[0012] The third aspect of the present application provides the use of the multiplex PCR Panel primer set described above in the preparation of a detection reagent or kit for detecting the wheat scab resistance major gene Fhb1 , scab resistance loci QFhb_5A and QFhb_2D application in corresponding favorable allelic variations.
[0013] The fourth aspect of the present application provides a method for detecting the excellent allelic variation of the wheat scab resistance locus, which comprises the following steps: (1) amplification and library construction of wheat scab resistance genes / related loci The genomic DNA of the wheat to be tested is used as a template, and a plurality of target scab resistance genes / related loci are simultaneously amplified by using the multiplex specific primers of the FhbR3-panel described above. After purification of the amplification products, library construction is completed by secondary PCR amplification with the introduction of double-index adapters, and a sequencing library suitable for a second-generation high-throughput sequencing platform is obtained; (2) high-throughput sequencing and variation analysis After the above library is quantified and quality controlled, it is sequenced. The sequencing data are subjected to data splitting, sequence alignment and variation identification by standard bioinformatics processes, so as to obtain nucleotide sequence information and corresponding allelic variation types of each target gene / related locus, and to accurately determine whether the target gene exists or the resistance locus carries an excellent allelic variation; The reference nucleotide sequence and allelic variation of the wheat resistance gene / related locus and the target fragment thereof are shown in SEQ ID NO. 15~ SEQ ID NO. 18.
[0014] The fifth aspect of the present application provides a molecular design breeding method for wheat with aggregated scab resistance genes / favorable allelic variations, which comprises the following steps: Step S1: parent selection and complementary matching The candidate parents are subjected to targeted detection by using the FhbR3-panel, and the core parents carrying the wheat scab resistance major gene Fhb1 , scab resistance loci QFhb_5A and QFhb_2D favorable allelic variations are screened. According to the combination of allelic variations, complementary parents are selected and hybridized or backcrossed, and hybridized or backcrossed seeds F1 are harvested; Step S2: planting of hybrid seeds and initial selection of low generations Plant F1 hybrid, harvest self-cross F2; plant F2 population in greenhouse or field, combine plant morphology and growth characteristics to carry out preliminary agronomic trait screening, focus on eliminating extreme plant type (too high or too short, scattered plant type), obvious lodging, weak tillering, late maturity, and powdery mildew, rust or yellow leaf disease susceptible plants, select single plants and cut single ears to harvest to obtain F3 seeds; Step S3: Target site molecular detection and comprehensive selection Plant F3 generation in ear rows, collect tender leaves of each single plant at the seedling stage and extract genomic DNA, use FhbR3-panel to carry out targeted molecular detection on the target resistance site, screen and mark single plants that simultaneously carry all favorable allelic variations (including heterozygous); at the same time, systemically select the comprehensive traits such as tillering property, lodging resistance, and resistance to powdery mildew, rust and yellow leaf disease during the whole growth period of wheat, and harvest F4 seeds of the selected single plants; Step S4: Row selection Plant F4 into plant rows, continue to use FhbR3-panel to screen plant rows that simultaneously carry favorable allelic variations (including heterozygous) and mark them, and combine breeding targets to investigate the comprehensive agronomic traits of the plant rows, select 5-6 single plants with consistent performance from the excellent plant rows, and separately harvest F5 by threshing; Fhb1 、 QFhb_5A and QFhb_2 Step S5: Pure line identification Plant F5 into plant lines, continue to use FhbR3-panel to screen and reserve homozygous plant lines that carry all target genes / favorable allelic variations at the seedling stage, and mark them; use the “single flower drop injection method” to artificially inoculate and identify the resistance of the selected plant lines to scab at the wheat flowering stage, and simultaneously combine agronomic traits, growth period and other disease resistance to mix and harvest the selected plant lines to obtain F6 seeds; Step S6: Plot identification and system evaluation Plant F6 in field plots, use FhbR3-panel for targeted detection to further determine the combination of favorable allelic variations carried; at the same time, re-identify the resistance to scab through artificial inoculation, and carry out system investigation and comprehensive evaluation on the main agronomic traits, yield and quality of the materials during the whole growth period around the breeding target, and screen and obtain new germplasm of scab-resistant wheat that aggregates all favorable allelic variations of the target sites and has excellent comprehensive traits.
[0015] Through the above technical solutions, the present application achieves the following beneficial effects: 1. Targeted aggregation based on stable resistance sources in backbone parents, improving the effectiveness of genetic improvement of scab resistance: the scab-resistant genes / related sites anchored and aggregated by the present application Fhb1 、 QFhb_5A and QFhb_2D All of them are widely used in the middle and lower reaches of the Yangtze River wheat region, and have clear resistance contribution effect in the genetic background of the main cultivar. With the clear source, the excellent allelic variation of the gene / locus with high breeding adaptability is detected and aggregated as the target, which is beneficial to the effective use of resistance resources in the breeding process, reduces the breeding risk caused by the linkage of undesirable traits, and provides a stable and available genetic basis for genetic improvement of resistance to fusarium head blight.
[0016] 2. Constructing a multiplex PCR Panel to realize simultaneous detection of multiple loci of fusarium head blight resistance, and improving the efficiency of molecular detection: the FhbR3-panel constructed in the application can simultaneously and targetedly detect the favorable allelic variations of the main effect gene FhbR3 and related loci in a single tube reaction, avoiding the inefficient process of amplification and analysis of single markers in traditional molecular detection. The Panel realizes rapid identification and screening of resistance loci through parallel amplification and unified detection of multiple loci, has the characteristics of simplified operation process, high detection throughput, controllable cost and clear targeting, and is suitable for molecular detection and assisted selection of fusarium head blight resistance loci in early generations and large-scale populations. Fhb1 QFhb_5A and QFhb_2D
[0017] 3. Constructing a collaborative selection system combining molecular detection and phenotype evaluation of fusarium head blight resistance to promote the accumulation and fixation of multiple resistance loci combination from generation to generation: the FhbR3-panel is organically embedded in the conventional wheat breeding process to construct a collaborative selection strategy of “precise parent combination—multiple loci targeted detection—comprehensive trait evaluation”, realizing the effective connection of molecular information and field phenotype selection. The system helps to improve the identification and retention efficiency of fusarium head blight resistance genotypes, reduces the influence of random separation on the selection results, promotes the accumulation and fixation of multiple resistance loci combination from generation to generation, improves the breeding efficiency of fusarium head blight resistance and shortens the breeding process under the premise of ensuring the coordination of comprehensive traits. BRIEF DESCRIPTION OF DRAWINGS
[0018] Figure 1 Figure 1 is an example of verifying the accuracy of the multiplex PCR Panel provided by the application in detecting the favorable allelic variations of wheat fusarium head blight resistance genes / related loci; and figure 2 is a schematic diagram of the molecular breeding method of fusarium head blight resistance favorable allelic variations based on the wheat multiplex PCR Panel constructed by the application. QFhb_2D Figure 2 DETAILED DESCRIPTION
[0019] The specific embodiments of the present application are described in detail below with reference to the examples. It should be understood that the specific embodiments described herein are merely intended to illustrate and explain the present application, and are not intended to limit the present application.
[0020] The wheat materials used in the present application are all germplasm resource materials preserved by Jiangsu Provincial Crop Germplasm Resource Library (Crops, Yangzhou University Library), which can be obtained and used by those skilled in the art and researchers.
[0021] Example 1. Integration of favorable allelic variation information of wheat Fusarium head blight resistance genes / related sites and design of multiplex PCR PanelFhbR3-panel core primers (1) Integration and analysis of favorable allelic variation information of wheat Fusarium head blight resistance genes / related sites Wheat varieties Yangmai 158 and Ningmai 9 are important backbone parents in the middle and lower reaches of the Yangtze River wheat region (for the definition of this wheat region, see Cheng Shunhe et al. (2012) Chinese South Wheat, Jiangsu Science and Technology Press). Both of them have excellent agronomic foundation and stable Fusarium head blight resistance, and are widely used as core parent sources in Chinese wheat Fusarium head blight resistance breeding. Nearly 100 derived varieties have been bred and applied with Yangmai 158 and Ningmai 9 as parents, which have shown stable resistance and excellent comprehensive traits in production practice. Based on the above background, the present application systematically integrates and analyzes the Fusarium head blight related genetic sites derived from the above two backbone parents and having stable resistance effect in the genetic background of the main cultivars, including: the main effect gene of wheat Fusarium head blight resistance Fhb1 , the important resistance site derived from the backbone parent Yangmai 158 QFhb_5A , and the important resistance site derived from the backbone parent Ningmai 9 QFhb_2D (Jiang P, Zhang X, Wu L, et al. (2020) A novel QTL on chromosome 5AL of Yangmai 158 increases resistance to Fusarium head blight in wheat. Plant Pathology, 69(2): 249-258; Zhang G, Hu R, Chen X, et al. (2023) Molecular and phenotypic characterization of Chinese wheat ( Triticum aestivum(Cultivars for resistance to Fusarium head blight. Plant Breeding, 142(1): 30-40.). The chromosomes containing the genes / locus and their dominant allelic variants are shown in Table 1.
[0022] (2) Multiplex PCR Panel Primer Design 1) Target site sequence acquisition and differential region identification. Retrieval of Fusarium head blight-related loci was performed using the WheatOmics database (http: / / wheatomics.sdau.edu.cn). QFhb_5A and QFhb_2D The genomic sequences of 150 bp upstream and downstream of the corresponding SNP linkage marker were used as reference sequences for subsequent core primer design; the cloned major gene for wheat resistance to Fusarium head blight was extracted. Fhb1 The gene sequence (Su Z, Bernardo A, Tian B, et al. (2019) Adeletion mutation in T aHRC confers Fhb1 Resistance to Fusarium head blight inwheat. Nature genetics, 51(7): 1099-1105.), and used DNAMAN software to analyze its disease resistance alleles ( Fhb1-R ) and disease-susceptibility alleles ( Fhb1-S The sequences were compared and analyzed to screen conserved segments or specific SNP sites with significant differences as anchoring regions for primer design.
[0023] 2) Preliminary design of core primers. Import the above reference sequences into Primer3 software for primer design, with the following parameters set: primer length 18-26 bp (preferably 20 bp); amplification product length 180-220 bp (preferably approximately 200 bp); GC content 40%-60% (preferably approximately 50%); maximum tolerance for oligonucleotide repeats in a single primer 3; maximum allowable score for local self-complementarity of a single primer 8; maximum allowable score for complementarity between forward and reverse primers 3. For each target sequence, design and retain 3-5 pairs of candidate primers. 3) Initial screening of primer specificity. The initially obtained primer sequences were imported into MFEprimer 3.1 software (https: / / mfeprimer3.igenetech.com / spec). Using the wheat whole genome sequence as a specificity analysis database, primers with poor specificity and primers that may produce non-specific amplification were removed, and candidate primer pairs with good specificity were retained. 4) Primer specificity manual review. After the initial screening of primers by MFEprimer, the sequences of primers were further manually reviewed by NCBIPrimer-BLAST tool (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ) to confirm their specific amplification in the wheat genome, ensuring the reliability of primer design; 5) Quality control and determination of core primer panel: MFEprimer 3.1 was used to analyze the primer pairs that passed the screening for primer dimer formation and non-specific structure, and the primer pairs that might form primer dimers or have obvious structural interference risks were excluded. Finally, 3 pairs of core primers that met the requirements of multiplex PCR were obtained, forming the core primer group of FhbR3-panel, and the nucleotide sequences are shown in Table 1. Each pair of core primers consists of an upstream primer and a downstream primer, corresponding to resistance loci RLoci1-RLoci3, respectively.
[0024] Table 1 Information of Fusarium resistance loci and combination of multiplex PCR panel core primers
[0025] 6) Construction of multiplex PCR panel primer group. Each primer in the multiplex PCR panel is composed of a linker sequence and a corresponding core specific primer. Specifically, a universal linker sequence is introduced at the 5' end of the core primer: the 5' end of the forward primer is connected with Ty_F linker sequence (SEQ ID NO. 7), and the 5' end of the reverse primer is connected with Ty_R linker sequence (SEQ ID NO. 8) to form the complete multiplex PCR panel primer group. By introducing a uniform linker sequence without changing the targeting specificity of the core primer, the amplification product can be compatible with the subsequent library construction and high-throughput sequencing process.
[0026] The linker sequences are as follows: SEQ ID NO. 7: CACTCTTTCCCTACACGACG SEQ ID NO. 8: GACTGGAGTTCAGACGTGTG.
[0027] The multiplex PCR panel is named FhbR3-panel, and the complete nucleotide sequences of each primer are shown in SEQ ID NO. 9-SEQ ID NO. 14.
[0028] SEQ ID NO. 9: CACTCTTTCCCTACACGACGCGTTGGTCCTTGTCACTGTT SEQ ID NO. 10: GACTGGAGTTCAGACGTGTGGGCTGGCAATAGTTCGAGAA SEQ ID NO. 11: CACTCTTTCCCTACACGACGCCCTGCCCCTTTCATTTCTT SEQ ID NO. 12: GACTGGAGTTCAGACGTGTGTCACACTTCAGAACCCACAC SEQ ID NO. 13: CACTCTTTCCCTACACGACGTGCAAATGGTCGAGGACAAG SEQ ID NO. 14: GACTGGAGTTCAGACGTGTGGATCACTGTCGAGCTCGGAT
[0029] Example 2. Amplification, library construction of FhbR3-panel, and detection and verification of excellent allelic variations of scab resistance To further verify the applicability and accuracy of FhbR3-panel in detecting excellent allelic variations of wheat genes / scab resistance-related loci, the detection process of the Panel was specifically described, and the multiplex PCR detection results were compared and verified by independent detection methods, as follows: (1) Amplification, library construction and sequencing of FhbR3-panel, including the following steps in turn: 1) Extraction of genomic DNA. Select Yangmai 158, Ningmai 9 and 10 recombinant inbred lines (RILs) derived from the two as test samples. Take the young leaves of each material, refer to Stein et al. (2001) (Stein N, Herren G, and Keller B. (2001) A new DNA extraction method for high-throughput marker analysis in a large-genome species such as wheat (Triticum aestivum L.). Plant Breed, 120:354-356), and extract genomic DNA from it by CTAB method. After determining its quality and integrity by NanoDrop and agarose gel electrophoresis, dilute the DNA to about 100 ng / μL with sterilized ultrapure water for standby. Triticum aestivum
[0030] 2) Multiplex-specific amplification of FhbR3-panel. The genomic DNA above was used as template for specific amplification with FhbR3-panel multiplex primer set.
[0031] The amplification reaction system (20 μL) included: 100 ng / μL sample DNA 2 μL, 500 nM Ty_F 1 μL, 500 nM Ty_R 1 μL, 4× Multiplex PCR Master Mix 5 μL, 30 nM of FhbR3-panel Mix 3 μL, ddH2O to 20 μL.
[0032] The FhbR3-panel Mix was prepared by mixing 6 FhbR3-panel primers in equal molar amounts.
[0033] The PCR amplification program was: 99 ℃ heat activation for 2 min; 99 ℃ denaturation for 15 s, 60 ℃ annealing for 4 min, 22 cycles; 72 ℃ extension for 10 min; 4 ℃ preservation.
[0034] After amplification, 1×VAHTS ® DNA Clean Beads (Vazyme) was used to purify the PCR product by magnetic beads to remove residual primers and non-specific small fragments, and obtain high-purity amplification products.
[0035] 3) Double-index library construction and library enrichment. The purified product obtained in step 2) was used as a template for a secondary PCR enrichment reaction containing double-index adapters to obtain sequencing libraries suitable for next-generation sequencing platforms.
[0036] Specific index primer adapters were designed for different samples, and the specific structure was P5 / P7-i5 / i7-Ty_F / Ty_R, wherein: P5 / P7 was the fixed adapter sequence of the Illumina process, i5 / i7 (nnnnnn) was the sample-specific index sequence, and Ty_F / Ty_R was the PCR Panel adapter sequence.
[0037] The index primer adapter sequences were as follows: P5-n-Ty_F: AATGATACGGCGACCACCGAGATCTACACnnnnnnACACTCTTTCCCTACACGACG; P7-n-Ty_R: CAAGCAGAAGACGGCATACGAGATnnnnnnGTGACTGGAGTTCAGACGTGTG.
[0038] The enrichment PCR reaction system (30 μL) comprises: 13 μL of the purified product (50 ng / μL) obtained in step 2), 15 μL of 2×HiFi Master Mix, 1 μL of index adapter primer P5-n-Ty_F with a concentration of 10 nM, and 1 μL of index adapter primer P7-n-Ty_R with a concentration of 10 nM; The PCR reaction program is: 98°C pre-denaturation for 3 min; 98°C denaturation for 10 s, 60°C annealing for 15 s, 72 °C extension for 30 s, 20 cycles; finally, 72 °C extension for 5 min, and 4 °C incubation.
[0039] After amplification, 0.8×VAHTS DNA Clean Beads (Vazyme) is used for magnetic bead purification to remove primers and small molecule impurities, and a high-purity sequencing library of the target fragment is obtained.
[0040] 4) High-throughput sequencing and variation detection. After Qubit quantification (concentration ≥ 1 ng / μL) and Bioanalyzer quality control of the constructed library, the fragment length and peak type are confirmed to meet the requirements, and then the libraries are mixed in equal molar concentration and loaded onto the machine.
[0041] After double-end high-throughput sequencing on the Illumina NovaSeq platform, the standard bioinformatics process is used to complete data splitting, quality control and sequence alignment, and visual analysis is performed combined with Integrative Genomics Viewer (IGV) to capture and identify the allelic variation types of the target anti-Gibberella gene / site.
[0042] The target site reference genome nucleotide sequence (SEQ ID NO. 15~ SEQ ID NO. 18) and allelic variation information are as follows: SEQ ID NO. 15: HRC_R : TGCAAATGGTCGAGGACAAGAAGAAGAGACTCCTTGAGAAGAAGGAAGCTCCACTGAAATGGCAGCAGAAACTGGAAGGGGCAATTAAGGCCACTGAAGAAAAGGAGAAGAAGCTCAAGTCGAAAAAGCACAGGAGGCGAAGCTATTCTTCCTCAGAATCCGACAGTGAATCCGAGAGCGACAGTGATC SEQ ID NO. 16: HRC_S: TGCAGATGGTCGAAGACAAGAAGAAGAGACTCCTCGAGAAGAAGGAAGCCCCTCTGAAATGGCAGCAGAAACTGGAAGCAGCAATCAAGGCCACTGAAGAAAAGGAGAAGAAGCTCAAGTCGAAAAAGCACAGGAGACGAAGCTATTCTTCCTCAGAATCTGACAGTGAATCCGAGAGCGACAGTGATC SEQ ID NO. 17: QFhb_2D : CCGCTTTCGTCAGATTCACGATAGTCTGTTTTTGCTTGCCGGGTTCCTCTTCTAGCACTTGTTCTTCGAACTGGTCTAGGAGCAGCTCGAGGTGGTCGTTGGTCCTTGTCACTGTTATCTTCTTCCATCCTGGAGATGTGATCTGTGTT[C / t]GACTTTTCATCATCTTGACCTGTTTCACCAGGACCGTTTTCTTCAGGTTCACCATCATCTATTTTTGCCTGCTTATTTCCTCTTCTAGCCCTTGTTGTTCGGACTGGCCTAGGAGCAGCCCGTACAGTTCTCGAACTATTGCCAGCCGCCC SEQ ID NO. 18: QFhb_5A : TAAGAGATGATCGCCTGGAGCACCCTGCCCCTTTCATTTCTTCACCGCATTGTCATCCAAGTCGGCTATCATGGTTCTAGGGGCTTTCACCCTATTTTAAGCATGTCTGCAGTTTGACTGACGACGACTAATTTAAACTTGGAGCTGTGA[G / t]ATTGTCAGTACGGGTGTAGGTATGAACATCTCAGATGTATGCGAACGTGTGGGTTCTGAAGTGTGATTCATGCTTGCATTGCTCTGTGCCTATCATCACATCGTTTCTATTACTGGATCATGGCTGTTGGCGTGTTGAGAATTGGTTGAA.
[0043] (2) Accuracy verification of FhbR3-panel for detecting multiple-site superior allelic variations To verify the detection accuracy of the FhbR3-panel constructed in the application in a multiplex amplification system, to exclude the possible inter-site or inter-primer interference (such as amplification competition, false negative or site omission caused by primer mismatch) in multiplex PCR, the core primers in the panel are used to perform unit point specific amplification and sequencing verification on all target sites, and the multiplex detection results are independently compared and verified. Specifically, the following steps are sequentially performed: 1) Unit point specific amplification. The same sample DNA as detected in the above panel is selected as the verification material. For each target site, the corresponding core primer is extracted from the FhbR3-panel, and PCR amplification is performed in a "single primer pair, unit point" manner.
[0044] The amplification reaction system (20 μL) comprises: 2×Taq Master Mix 10 μL, 0.4 μL of upstream primer with a concentration of 10 μM, 0.4 μL of downstream primer with a concentration of 10 μM, 2 μL of sample DNA with a concentration of 100 ng / μL, and ddH2O to make up to 20 μL; The PCR amplification program is as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 40 s, 34 cycles; 72℃ extension for 5 min; and 12℃ storage of the amplification product.
[0045] 2) Sequencing and sequence analysis of the amplification product. The PCR amplification product is detected by 1.0% agarose gel electrophoresis and then sent for sequencing. The sequencing results are compared and analyzed with the target sequence by Sequencher 4.1.4 sequence comparison software to identify the allelic variation types of each site.
[0046] 3) Consistency verification of the detection results. The genotype results obtained by unit point amplification and sequencing are compared with the multiplex detection results of the FhbR3-panel sample by sample and site by site. For example, Figure 1 As shown in the example, the genotype determination results of the two detection methods on all target genes / sites are completely consistent, and no site loss, false typing or sequencing bias caused by multiplex amplification is found, indicating that the FhbR3-panel has good accuracy and reliability in the detection of multiple site resistance to scab disease.
[0047] Example 3. Application of FhbR3-panel in molecular design breeding of wheat with polymeric scab resistance genes / favorable allelic variations Based on the aforementioned examples of detecting and confirming the superior allelic variations in resistance to Fusarium head blight of the backbone parents Yangmai 158 and Ningmai 9 in the wheat-growing areas of the middle and lower reaches of the Yangtze River, to further illustrate the practical application effect of FhbR3-panel in the aggregation breeding of multi-site favorable allelic variations in resistance to Fusarium head blight, the F1 hybrid offspring of Yangmai 158 / Ningmai 9 / / Yangmai 158 were used as the experimental population for aggregation germplasm selection and verification. Figure 2 The process is as follows: (1) Based on the hybrid F1 of Yangmai 158 / Ningmai 9 / / Yangmai 158, it was planted in a greenhouse in May 2021 and the self-crossed F2 was harvested in September.
[0048] (2) In October 2021, F2 plants were planted in the field. Based on plant morphology and growth characteristics, low-generation basic screening was carried out, focusing on eliminating plants with extreme plant types (too tall or too short, scattered plant type), obvious lodging, weak tillering, late maturity, and high susceptibility to powdery mildew, yellow leaf spot and rust under natural conditions. Among them, Zhenmai 9 and Sumai 3 were used as powdery mildew resistant and susceptible controls, respectively, Ningmai 13 was used as yellow leaf spot resistant control, and Yangmai 20 was used as the control for tillering, lodging and leaf rust resistance. F3 seeds were harvested from selected single plants by cutting single ears.
[0049] (3) In October 2022, F3 seedlings were planted in rows (row length 1.5 m, row spacing 0.25 m, 30 seeds per row). Young leaves from each seedling were collected, referring to Stein et al. (2001) (Stein N, Herren G, and Keller B. (2001) A new DNA extraction method for high-throughput marker analysis in a large-genome species such as Triticum aestivum According to Plant Breed, 120:354-356, genomic DNA was extracted using the CTAB method. Following Example 2, target resistance loci were detected using the FhbR3-panel. Individual plants carrying all favorable allelic variations (including heterozygous genotypes) were screened and tagged. Simultaneously, throughout the entire growth period, tillering ability, lodging resistance, and resistance to powdery mildew, rust, and yellow mosaic virus were comprehensively evaluated. Plants prone to lodging, with a height greater than or a maturity later than Yangmai 20, were discarded. Seeds from the selected individual plants (F4 generation) were harvested.
[0050] (4) In June 2023, under greenhouse conditions, F4 seedlings were planted in rows (row length 1.5 m, row spacing 0.25 m, 30 seeds per row). During the seedling stage, 10 leaves from each row were randomly selected and mixed for DNA extraction. The DNA was detected using an FhbR3-panel, and those carrying the same DNA were screened and retained. Fhb1 ,QFhb_5A and QFhb_2D Advantageous alleles (including heterozygous) were selected and marked. Based on the comprehensive agronomic traits and other disease resistance performance, 5-6 single plants with consistent phenotype were selected from the excellent plants, and F5 seeds were harvested separately.
[0051] (4) In November 2023, F5 seeds were planted, and FhbR3-panel was used for genotype identification at the seedling stage to screen and retain plants with homozygous advantageous alleles at the target site. At the wheat flowering stage, the method of (Chang L, Zhang Y, Qu RZ, et al. (2018) Identification and evaluation of scab resistance of new wheat lines in Jiangsu Province. Jiangsu Journal of Agricultural Sciences, 46(16): 87-91) was used to perform artificial inoculation identification of scab using the "single flower drop method", with Sumai 3 and Annong 8455 as the resistant and susceptible controls, respectively. 20 ears were selected from each line, and 10 μL of conidial suspension was inoculated at the middle of each ear. The concentration of the conidial suspension was 5×10 5 spores / mL. After inoculation, the plants were sprayed and covered with plastic bags for 3 days. At 21 days after inoculation, the disease incidence was investigated, the number of diseased spikelets and total spikelets were counted, and the disease incidence rate (DIS) was calculated. The lines with a DIS higher than the control were eliminated, and the resistance to powdery mildew, rust, and yellow leaf disease was also considered to comprehensively screen the lines. The line BCL341, which showed excellent performance, was mixed and harvested.
[0052] (5) In November 2024, BCL341 (F6) was planted in a 6 m² plot. FhbR3-panel was used again at the seedling stage for targeted detection to confirm that it stably carries the advantageous alleles of Fhb1 , QFhb_5A and QFhb_2D . The "single flower drop method" was used to identify the resistance to scab, and Yangmai 20 was used as the control. The agronomic traits were systematically investigated throughout the growth period. Yield and quality identification was carried out after harvest in May 2025.
[0053] As shown in Table 2, BCL341, as a representative material that simultaneously aggregates the advantageous alleles of Fhb1 , QFhb_5A and QFhb_2D , had an average diseased spikelet rate of 20.9%, which was significantly lower than the moderately resistant control Yangmai 20 (25.0%), indicating good resistance to scab. In terms of agronomic traits, the thousand-grain weight (47.54 g), grain length (6.593 mm), and grain width (3.513 mm) of BCL341 were all at a high level, and the plot yield (6.07 kg / 6 m²) was also better than the control, indicating that while maintaining the improvement effect of resistance to scab, the main agronomic traits such as grain traits and yield were also optimized.
[0054] Table 2 Phenotypic investigation of excellent resistance to scab polymorphic materials
[0055] In summary, the use of multiplex PCR Panel FhbR3-panel can achieve precise targeted detection and efficient aggregation of multiple loci of excellent resistance to scab. By reasonably combining resistance sites of different sources and different mechanisms, especially by making full use of excellent resistance of the backbone parent, the directional accumulation and acceleration of key resistance sites can be realized, which provides a feasible technical solution for molecular design breeding of wheat resistance to scab.
[0056] The preferred embodiments of the present application are described in detail above, but the present application is not limited to the specific details in the above embodiments, and various simple modifications can be made to the technical solutions of the present application within the technical concept of the present application, and these simple modifications all belong to the protection scope of the present application.
[0057] In addition, it should be noted that each specific technical feature described in the above specific embodiments can be combined in any appropriate manner without contradiction, and in order to avoid unnecessary repetition, the present application will not further describe various possible combinations.
[0058] In addition, various different embodiments of the present application can also be combined in any manner, as long as they do not deviate from the idea of the present application, and they should also be considered as disclosed by the present application.
Claims
1. A multiplex PCR panel primer set for detecting favorable allelic variations at wheat Fusarium head blight resistance sites, characterized in that, The multiplex PCR panel uses the major gene for wheat resistance to Fusarium head blight. Fhb1 Anti-Fusarium wilt site QFhb_5A and QFhb_2D The target is used to target and detect the corresponding favorable allelic variants. The PCR panel is FhbR3-panel, and the nucleotide sequence of its primer set is shown in SEQ ID No. 9~SEQ ID No.
14.
2. The multiplex PCR panel primer set according to claim 1, characterized in that, Each primer in this primer set consists of a linker sequence and a core primer. The nucleotide sequences of the core primers are shown in SEQ ID No. 1 to SEQ ID No.
6. The forward primer of the core primer is connected to the linker sequence shown in SEQ ID No. 7 at its 5' end. The reverse primer of the core primer is connected to the linker sequence shown in SEQ ID No. 8 at its 5' end.
3. The multiplex PCR panel primer set as described in claim 1 or 2 for detecting the major gene for wheat resistance to Fusarium head blight. Fhb1 Anti-Fusarium wilt site QFhb_5A and QFhb_2D Applications of corresponding favorable allelic variations.
4. The multiplex PCR panel primer set as described in claim 1 or 2 is used in the preparation of primers for detecting major genes for wheat resistance to Fusarium head blight. Fhb1 Anti-Fusarium wilt site QFhb_5A and QFhb_2D Applications of corresponding favorable allelic variant detection reagents or kits.
5. A method for detecting superior allelic variations at sites of resistance to Fusarium head blight in wheat, characterized in that, Includes the following steps: (1) Amplification and library construction of wheat resistance genes / related loci Using the genomic DNA of the wheat to be tested as a template, multiple target genes / related sites of resistance to Fusarium head blight were simultaneously amplified using the multiple specific primers of FhbR3-panel as described in claim 1 or 2. After purification, the amplification products were used to complete the library construction by secondary PCR amplification with the introduction of dual-index adapters, and a sequencing library that can be adapted to the second-generation high-throughput sequencing platform was obtained. (2) High-throughput sequencing and variant analysis After quantification and quality control of the above library, it was sequenced. The sequencing data was split, sequence aligned and variant identified by standard bioinformatics process to obtain the nucleotide sequence information of each target gene / related site and its corresponding allelic variant type, so as to accurately determine the presence of the target gene or whether the resistance site carries superior allelic variants. The reference nucleotide sequences and allelic variations of the wheat resistance gene / related sites and their target fragments are shown in SEQ ID No. 15 to SEQ ID No.
18.
6. A molecular design breeding method for wheat that aggregates Fusarium head blight resistance genes / favorable allelic variations, characterized in that, Includes the following steps: Step S1: Parental selection and complementary pairing Targeted detection of candidate parents was performed using the FhbR3-panel to screen for those carrying major genes for wheat resistance to Fusarium head blight. Fhb1 Anti-Fusarium wilt site QFhb_5A and QFhb_2D The core parent with favorable allelic variation is selected, and complementary parents are selected based on the combination of allelic variations and hybridization or recrossing is carried out to harvest hybrid or recross seeds F1. Step S2: Hybrid Planting and Early Generation Selection Plant F1 hybrids and harvest self-crossed F2s; plant F2 populations in greenhouses or fields, and conduct preliminary agronomic trait screening based on plant morphology and growth characteristics. Focus on eliminating plants with extreme plant types, obvious lodging, weak tillering, late maturity, and those susceptible to powdery mildew, rust, or yellow mosaic virus. Select single plants and cut single ears to harvest F3 seeds. Step S3: Target site molecular detection and comprehensive selection F3 generation plants were planted in rows, and tender leaves of each individual plant were collected during the seedling stage to extract genomic DNA. Targeted molecular detection of the target resistance sites was performed using FhbR3-panel, and individual plants carrying all favorable allelic variations were screened and marked. At the same time, tillering, lodging resistance, and resistance to powdery mildew, rust, and yellow mosaic were systematically evaluated throughout the wheat's growth period, and F4 seeds of the selected individual plants were harvested. Step S4: Plant Selection F4 cells were planted in rows, and FhbR3-panel screening was continued to select for cells carrying the same type of FhbR3. Fhb1 , QFhb_5A and QFhb_2 For rows with favorable allelic variation, conduct a comprehensive agronomical trait assessment of the selected rows in conjunction with the breeding objectives, and select 5-6 individual plants with relatively consistent performance from the superior rows, and thresh and harvest F5 seeds separately. Step S5: Purebred identification F5 plants were planted into lines. During the seedling stage, FhbR3-panel was used to screen and retain homozygous lines carrying all target genes / favorable allelic variations. During the wheat flowering stage, the selected lines were artificially inoculated with Fusarium head blight and their resistance was identified. At the same time, considering agronomic traits, growth period and other disease resistance, the selected lines were mixed and harvested to obtain F6 seeds. Step S6: Community Identification and System Evaluation F6 wheat was planted in field plots, and targeted detection was performed using FhbR3-panel to further identify the favorable allelic variant combinations it carried. At the same time, its resistance to Fusarium head blight was re-identified through artificial inoculation. In addition, a systematic investigation and comprehensive evaluation of the main agronomic traits, yield and quality of the materials throughout the entire growth period were carried out in accordance with the breeding objectives. New wheat germplasm resistant to Fusarium head blight with all favorable allelic variants at the target loci and excellent comprehensive traits was screened out.