Application of rice LBL2 gene in regulation and control of grain length and thousand grain weight
By overexpressing the LBL2 gene in rice and using a recombinant expression vector and an enhanced promoter, the lack of genes regulating rice grain size was solved, resulting in increased grain length and thousand-grain weight, and thus improved rice yield.
Patent Information
- Application Number
- CN202511451701.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-11
- Publication Date
- 2026-02-06
AI Technical Summary
In existing technologies, there are relatively few genes that regulate rice grain size, making it difficult to effectively increase rice yield through genetic modification.
The LBL2 gene and its encoded protein are provided. By constructing recombinant expression vectors such as pLBL2::LBL2-GUS, the LBL2 gene is overexpressed in rice. Enhanced promoters such as CaMV35S or Ubiquitin promoters are used to increase grain length and thousand-grain weight.
Overexpression of the LBL2 gene significantly increases rice grain length and thousand-grain weight, providing new genetic resources for rice breeding and improving rice yield.
Smart Images
Figure HDA0005632015000000011
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of plant genetic engineering and genetic breeding, and relates to a gene related to regulation of rice grain length and 1000-grain weight and an encoding and application thereof. BACKGROUND
[0002] Rice is one of the important food crops in China. With the increase of population and the continuous reduction of available arable land, improving the yield of rice per unit area to meet the daily demand is an important challenge in current rice breeding research.
[0003] The yield of a single rice plant is determined by the number of effective panicles, the number of grains per panicle and the 1000-grain weight. The factors affecting grain weight mainly include grain length, grain width and grain thickness, etc. Rice grain size is closely related to 1000-grain weight and is one of the important factors affecting yield. In recent years, some key genes regulating rice grain size have been cloned, but there are not many genes that can be really applied in production. Therefore, mining new grain type regulation key genes and analyzing their molecular mechanisms have important production and application value for improving rice yield and breeding high-yield and high-quality rice varieties.
[0004] LBL2 encodes a member of the SMALL AUXIN-UP RNA family 26 (SAUR26) of rice, and its expression is induced by auxin. The rice SAUR gene family has 58 members, and there is a certain redundancy in function. SUMMARY
[0005] The purpose of the present application is to provide a protein related to regulation of rice grain size and an encoding gene and application thereof.
[0006] The protein provided by the present application is named LBL2, derived from rice (Oryza sativa L.) of the genus Oryza, and is as follows (a) or (b):
[0007] (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 1 in the sequence listing;
[0008] (b) a protein derived from SEQ ID NO: 1 by substitution, deletion and / or addition of one or more amino acid residues, and related to regulation of rice grain size.
[0009] In order to facilitate the purification of the protein shown in (a) above, a tag shown in the following table can be connected to the amino-terminal or carboxyl-terminal of the protein consisting of the amino acid residue sequence of SEQ ID NO: 1 in the sequence listing.
[0010] Table: Sequence of tag
[0011] Tag Residue Sequence Poly-Arg 5-6 (usually 5) RRRRR Poly-His 2-10 (usually 6) HHHHHH FLAG 8 DYKDDDDK Strep-tag II 8 WSHPQFEK c-myc 10 EQKLISEEDL
[0012] The protein in (b) above can be artificially synthesized, or a gene encoding the protein can be synthesized and then expressed biologically. The gene encoding the protein in (b) above can be obtained by deleting one or more codons of the DNA sequence shown in SEQ ID NO: 2 in the sequence listing, and / or by performing one or more missense mutations of base pairs.
[0013] A nucleic acid molecule encoding the protein also falls within the scope of the present application.
[0014] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA or recombinant DNA; or the nucleic acid molecule can be RNA, such as mRNA, hnRNA or tRNA, etc.
[0015] In one embodiment of the present application, the nucleic acid molecule is specifically a gene (named as SAUR26) encoding the protein, and the gene can be specifically a DNA molecule as any one of the following 1)-3):
[0016] The gene is a DNA molecule as any one of the following 1)-3):
[0017] 1) the DNA molecule shown in SEQ ID NO: 2 in the sequence listing;
[0018] 2) the DNA molecule shown in SEQ ID NO: 3 in the sequence listing;
[0019] 3) a DNA molecule hybridizing to the DNA molecule defined in any one of 1)-2) under stringent conditions and encoding a protein derived from SEQ ID NO: 1 and related to the regulation of rice grain size;
[0020] 4) a DNA molecule having more than 90% identity to the DNA sequence defined in any one of 1)-3) and encoding a protein derived from SEQ ID NO: 1 and related to the regulation of rice grain size.
[0021] SEQ ID NO: 2 is the cDNA sequence of LBL2 gene, and SEQ ID NO: 3 is the sequence of LBL2 gene in the rice genome.
[0022] A recombinant vector, expression cassette, transgenic cell line or recombinant microorganism containing the nucleic acid molecule above also falls within the scope of the present application. The recombinant vector can be a recombinant expression vector, or a recombinant cloning vector.
[0023] The recombinant expression vector can be constructed using existing plant expression vectors. The plant expression vectors include binary Agrobacterium vectors and vectors that can be used for plant microprojectile bombardment, such as pGreen0029, pCAMBIA3301, pCAMBIA1300, pBI121, pBinl9, pCAMBIA2301, pCAMBIA1301-UbiN, or other derivative plant expression vectors. The plant expression vector can also contain a 3' untranslated region of the foreign gene, i.e., a polyadenylation signal and any other DNA segment involved in mRNA processing or gene expression. The polyadenylation signal can direct polyadenylation to the 3' end of the mRNA precursor. When the gene is used to construct the recombinant expression vector, any one of the enhanced, constitutive, tissue-specific, or inducible promoters can be added before the transcription initiation nucleotide, such as the cauliflower mosaic virus CaMV 35S promoter, the ubiquitin gene Ubiquitin promoter (pUbi), the stress inducible promoter rd29A, etc., which can be used alone or in combination with other plant promoters; in addition, when the gene of the present application is used to construct the recombinant expression vector, enhancers, including translation enhancers or transcription enhancers, can also be used, and these enhancer regions can be the ATG initiation codon or the adjacent region of the initiation codon, but must be in the same reading frame as the coding sequence to ensure correct translation of the entire sequence. The source of the translation control signal and the initiation codon is wide and can be natural or synthetic. The translation initiation region can be from the transcription initiation region or the structural gene. In order to facilitate the identification and screening of transgenic plant cells or plants, the recombinant expression vector used can be processed, such as adding a gene that can express an enzyme or a luminescent compound that can produce a color change in plants, an antibiotic marker with resistance, or an anti-chemical reagent marker gene, etc. Any selective marker gene can also not be added, and the transformed plants can be directly screened under stress.
[0024] In the present application, the recombinant expression vector is a recombinant plasmid obtained by inserting the LBL2 gene into the multiple cloning site of p1300-GN vector. More specifically, it is a recombinant plasmid obtained by replacing the small fragment between the enzyme digestion sites BamHI and SmalI of the p1300-GN vector with the DNA fragment shown in SEQ ID NO: 2 in the sequence listing (named pLBL2::LBL2-GUS).
[0025] The expression cassette consists of a promoter capable of initiating expression of the gene, the gene, and a transcription termination sequence.
[0026] The transgenic cell line is a non-reproductive material into which the gene is introduced.
[0027] The application of the protein or the nucleic acid molecule or the recombinant vector, expression cassette, transgenic cell line or recombinant microorganism in any of the following also falls within the protection scope of the present application:
[0028] (a) plant breeding and / or seed production;
[0029] (b) plant grain size regulation.
[0030] The present application provides LBL2 gene for improving rice grain size, and the size traits include grain length and 1000-grain weight.
[0031] In a preferred embodiment, the LBL2 gene is used for increasing rice grain size, and overexpression of LIP1 gene can increase grain length and 1000-grain weight. Therefore, the present application discloses a new gene for regulating rice grain size.
[0032] The LBL2 gene of the present application can regulate grain size in rice, i.e. the function enhancement of the gene can increase the size of rice grain.
[0033] In the present application, the plant can be monocotyledon or dicotyledon. The monocotyledon is, for example, Gramineae, and specifically rice.
[0034] In the embodiment of the present application, the recipient plant used for breeding transgenic plants with increased grain size is specifically wild-type rice Nipponbare.
[0035] The present application provides a new gene resource for research and application of rice seed size traits. BRIEF DESCRIPTION OF DRAWINGS
[0036] Figure 1 、 LBL2 overexpression material and wild-type Nipponbare grain size phenotype A, grain phenotype; B, grain length and 1000-grain weight. DETAILED DESCRIPTION
[0037] The following examples facilitate better understanding of the present application, but do not limit the present application. In the following examples, the experimental methods are conventional methods unless otherwise specified. In the following examples, the materials, reagents, etc. are commercially available unless otherwise specified. In the quantitative test of the following examples, more than three repeated experiments are set, and the average value is taken as the result.
[0038] The wild-type rice variety Nipponbare and pLBL2::LBL2-GUS are created and preserved by the laboratory. The genotype of Nipponbare is LBL2 / LBL2, and the overexpression material is constructed as pLBL2::LBL2-GUS.
[0039] The rice genome sequencing information is referenced to the database of National Rice Research Center, which is linked as follows: http: / / www.ricedata.cn / .
[0040] Example 1, Creation of LBL2 overexpression material and observation of grain size
[0041] In this study, LBL2 is overexpressed in the background of japonica rice variety Nipponbare. The primer LBL2-F-BamHI: CGCGGATCCACAGCCAAAGTTGGACAC; LBL2-R-Smal: CCCCCGGGTAGCTCTTGGCGG is designed to amplify the target fragment, which is ligated to the pCambia1300-GUS-Nos vector digested by BamHI and Smal to construct pLBL2::LBL2-GUS, and then the overexpression material of LBL2 is obtained by genetic transformation into the Nipponbare material. The overexpression material of LBL2 is screened and the seed phenotype is measured, and the results show that the grain length and the thousand-grain weight of the pLBL2::LBL2-GUS overexpression material are both significantly increased compared with Nipponbare.
[0042] According to the above research results, it can be seen that the LBL2 gene provided by the present application is a gene related to the regulation of rice grain size, that is, the overexpression of the gene leads to the elongation and weight increase of the rice grain. The present application provides a new gene resource for the study of plant, especially rice, grain size traits, and the selection of rice material with excellent LBL2 allelic genotype for genetic improvement of rice grain size will play an important role in the application in the field of rice breeding.
Claims
1. Protein is either (a) or (b) as follows: (a) A protein consisting of the amino acid sequence shown in Sequence 1 of the sequence listing; (b) A protein derived from sequence 1 whose amino acid sequence of sequence 1 has been modified by substitution and / or deletion and / or addition of one or more amino acid residues and is associated with plant seed quality.
2. A nucleic acid molecule encoding the protein of claim 1.
3. The nucleic acid molecule according to claim 2, characterized in that: The nucleic acid molecule is a gene encoding the protein of claim 1, and the gene is any one of the following DNA molecules 1)-4): 1) The DNA molecule shown in sequence 2 of the sequence listing; 2) The DNA molecule shown in sequence 3 of the sequence listing; 3) A DNA molecule that hybridizes under strict conditions to any of the DNA molecules specified in 1)-2) and encodes a protein derived from sequence 1 that is associated with the regulation of plant grain length and thousand-grain weight; 4) A DNA molecule that has more than 90% identity with any of the defined DNA sequences in 1)-3) and encodes a protein derived from sequence 1 that is associated with the regulation of plant grain length and thousand-grain weight.
4. A recombinant vector, expression cassette, transgenic cell line, or recombinant microorganism containing the nucleic acid molecule described in claim 2 or 3.
5. The recombinant vector according to claim 4, characterized in that: The recombinant vector is a recombinant expression vector or a recombinant cloning vector.
6. The use of the protein of claim 1, the nucleic acid molecule of claim 2 or 3, or the recombinant vector, expression cassette, transgenic cell line, or recombinant microorganism of claim 4 or 5 in any of the following: (a) Plant breeding and / or seed production; (b) Regulate plant grain length and thousand-grain weight.
7. The methods for cultivating transgenic plants are as follows: The method for cultivating transgenic plants provided by this invention can be as follows: A: A. A method for cultivating transgenic plants with increased grain length and thousand-grain weight, comprising the following steps: (a1) Increase the expression of LBL2 protein in LBL2 / LBL2 recipient plants to obtain transgenic plants; (a2) Obtain transgenic plants with longer seeds and increased thousand-seed weight from the transgenic plants obtained in step (a1). The longer seeds and increased thousand-seed weight of the transgenic plants are due to the overexpression of the LBL2 protein in the recipient plant.
8. The method according to claim 7, characterized in that: In step (a), the encoding gene is introduced into the recipient plant via the recombinant expression vector of claim 5.
9. The application or method according to claim 7 or 8, characterized in that: The plant is a monocotyledonous plant or a dicotyledonous plant.
10. The application or method according to any one of claims 7-9, characterized in that: The monocotyledonous plants are grasses (Poaceae). The grass species mentioned are specifically rice.