Fungus-derived transcription enhancing elements and uses thereof

Abstract

The invention relates to the technical field of biotechnology and genetic engineering, in particular to a fungus-derived element with a transcription enhancement function and application thereof. The invention provides a polynucleotide sequence capable of enhancing the transcription function of the promoter, and when the polynucleotide sequence is added to the upstream of different promoters, the expression intensity of downstream genes mediated by the promoter can be remarkably improved. The polynucleotide sequence provided by the invention can be applied to the genetic engineering technology of fungi, the expression of a target gene is enhanced, the yield of organic acids and enzyme preparations is further improved, and the polynucleotide sequence has a relatively wide application prospect.

Description

Technical Field

[0001] This invention relates to the fields of biotechnology, bioengineering and genetic engineering, and to a fungal-derived transcriptional enhancement element, as well as a method for designing and constructing an artificial promoter using the transcriptional enhancement element, and a method for the production of organic acids and enzyme preparations by the submitted strain. Background Technology

[0002] Fungi are extremely important industrial strains in the bio-industry, widely used in the industrial production of organic acids, enzymes, and other products. Taking *Aspergillus niger* as an example, it is a crucial industrial strain for the production of organic acids and enzymes. *Aspergillus niger* produces citric acid and other organic acids, as well as bulk enzymes such as glucosylamylase, glucose oxidase, and phytase, which hold a significant market share. Efficient expression of key target genes is crucial for achieving high yields of organic acids and enzymes from fungi, and promoter activity is a significant factor influencing efficient gene expression. Optimizing promoter activity can not only regulate the expression of target genes, control metabolic flow to target products, and improve the yield and production efficiency of target products, but also directly increase the yield of target proteins such as enzymes through strong promoters.

[0003] The promoters of fungi such as Saccharomyces cerevisiae mainly consist of a core promoter element and upstream activating sequences (UAS). By mining, discovering and optimizing the UAS, the activity of the promoter can be significantly improved (Redden H, Alper HS. The development and characterization of synthetic minimal yeast promoters. Nat Commun. 2015.6:7810).

[0004] However, few UAS elements have been discovered in fungi so far, and it is unknown whether UAS elements with even higher enhancement effects exist. Therefore, identifying and developing UAS elements with better effects will be beneficial for the modification and optimization of highly active promoters, improving the expression of key genes related to organic acid metabolism engineering and enzyme expression optimization, thus having broad prospects for industrial applications. Summary of the Invention

[0005] This invention provides a multinucleotide sequence that can enhance promoter transcription function. When added upstream of different promoters, it can significantly increase the expression intensity of downstream genes mediated by the promoter.

[0006] Specifically, the present invention provides a transcription-enhancing UAS element, the nucleotide sequence of which is shown in SEQ ID NO: 1 or 2, or an element that still has transcription-enhancing function obtained by shortening one to 30 nucleotides at both ends or one end based on the nucleotide sequence shown in SEQ ID NO: 1 or 2. The sequences shown in SEQ ID NO: 1 or 2 or those shortened based thereon are respectively referred to as UASa and UASb elements.

[0007] Furthermore, the elements of the nucleotide sequence shown in SEQ ID NO: 1 are truncated and at least retain the elements of the nucleotide sequence shown in SEQ ID NO: 1.

[0008] Preferably, its nucleotide sequence is as shown in any one of SEQ ID NO: 4 to 9.

[0009] The present invention further provides a recombinant expression element that enhances the expression of a target gene, wherein the transcription-enhancing UAS element is positioned upstream of the promoter of the target gene.

[0010] The present invention provides a recombinant expression vector for enhancing the expression of a target gene, comprising the recombinant expression element for enhancing the expression of the target gene, or the UAS element for enhancing transcriptional function as described in any one of claims 1 to 3.

[0011] The present invention also provides a recombinant fungal host cell, characterized in that the recombinant host cell contains the UAS element as described in any one of claims 1-3 or the recombinant expression element as described in claim 4, or the recombinant expression vector as described in claim 5;

[0012] Preferably, the fungus is *Aspergillus niger*, *Aspergillus nidulans*, *Aspergillus oryzae*, *Penicillium chrysogenum*, *Trichoderma reesei*, *Ustilago maydis*, or *Myceliophthorathermophila*.

[0013] The present invention further provides the application of the aforementioned transcription-enhancing UAS element in enhancing the transcriptional activity of target genes.

[0014] Specifically, this is achieved by placing the UAS element, which enhances the transcriptional function, upstream of the promoter of the target gene.

[0015] The present invention also provides a method for enhancing the expression of a target gene, which involves placing the aforementioned transcription-enhancing UAS element upstream of the promoter of the target gene to increase the transcriptional expression of the target gene.

[0016] Preferably, the transcription-enhancing UAS element is located upstream of the promoter of the target gene in multiple copies, specifically 2, 3, 4, 5, or 6 copies; preferably, different combinations of the transcription-enhancing UAS elements or combinations with different copy numbers are used, such as a combination of two copies of UASa and two copies of UASb elements.

[0017] The promoter is selected from PcitA, PpkiA, and PgpdA promoters;

[0018] Specifically, the target gene is an enzyme, protein, or transcription factor; specifically, the enzyme is a gene required for citric acid synthesis, such as a gene for citric acid efflux protein or a glucose oxidase gene.

[0019] The present invention also provides a method for producing an organic acid or enzyme preparation, characterized in that the method includes the steps of culturing a recombinant host cell as described in claim 6 to produce an organic acid or enzyme, and collecting the produced organic acid or enzyme, wherein the target gene encodes a gene for a protein related to the synthesis of the organic acid or enzyme.

[0020] Optionally, the organic acid is any one of gluconic acid and citric acid; the enzyme preparation is any one of glucosylamylase, glucose oxidase, catalase and phytase.

[0021] Preferably, it further includes the step of separating organic acids or enzyme preparations from the fermentation broth after culture.

[0022] The UAS element provided by this invention has excellent compatibility and versatility, and can be combined with different promoters to construct a series of high-strength artificial promoters. For example, it can be applied in fungal genetic engineering to enhance the expression of target genes, thereby increasing the yield of organic acids and enzyme preparations, and has broad application prospects. Attached Figure Description

[0023] Figure 1 The fluorescence detection of the PgpdA promoter fluorescent protein reporter strain after the addition of the UAS element is displayed.

[0024] Figure 2 Fluorescence detection of PgpdA promoter fluorescent protein reporter strains after the addition of the UAS element core sequence. Detailed Implementation

[0025] When used in conjunction with the term "comprising" in the claims and / or specification, the word "a" may also refer to "one or more," "at least one," and "one or more." As used in the claims and specification, the words "comprising," "having," "including," or "containing" are inclusive or open-ended and do not exclude additional, uncited elements or method steps.

[0026] The term "about" in this invention means: a value includes the standard deviation of the error of the apparatus or method used to determine the value.

[0027] As used in this invention, the term "promoter" refers to a nucleic acid molecule, typically located upstream of the coding sequence of a target gene, providing a recognition site for RNA polymerase and situated upstream of the mRNA transcription start site in the 5' direction. It is an untranslated nucleic acid sequence to which RNA polymerase binds, initiating transcription of the target gene. In ribonucleic acid (RNA) synthesis, promoters can interact with transcription factors that regulate gene transcription, controlling the initiation time and extent of gene expression (transcription). Containing a core promoter region and a regulatory region, promoters act like a "switch," determining gene activity and thus controlling which protein the cell begins to produce. The polynucleotide sequences of the promoters of this invention are shown in SEQ ID: 1-2. This invention also includes variants of the aforementioned nucleic acid molecules with the same function, possessing at least 90%, preferably at least 95%, preferably at least 96%, preferably at least 97%, preferably at least 98%, or preferably at least 99% identity with the polynucleotide sequences shown in any one of SEQ ID NO: 1-2, and having promoter activity.

[0028] Preferably, the mutation of the variant occurs in the regulatory region of the promoter, which can be obtained, for example, by inserting or deleting the regulatory region, or by random or site-directed mutation of the regulatory region. In other words, the present invention also includes variants of SEQ ID NO: 1-2 that retain the function of the promoter in guiding the expression of the target gene, obtained by deleting or mutating one, several, or dozens (e.g., less than 100, or less than 80, or less than 60, or less than 50, or less than 40, or less than 30, or less than 20, or less than 15, or less than 10, or less than 5) bases based on the polynucleotide sequence shown in SEQ ID NO: 1-2. The present invention also includes adding, for example, fragments of 15 to 50 bases, more preferably 15 to 30 bases in length, to both ends of the polynucleotide shown in SEQ ID NO: 1-2 and having promoter activity.

[0029] The term "polynucleotide" in this invention refers to a polymer composed of nucleotides. A polynucleotide can be in the form of a single fragment or as a component of a larger nucleotide sequence structure derived from a nucleotide sequence isolated at least once in number or concentration, capable of being recognized, manipulated, and recovered using standard molecular biology methods (e.g., using cloning vectors). This also includes an RNA sequence (i.e., A, U, G, C) when a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), where "U" replaces "T". In other words, "polynucleotide" refers to a polymer of nucleotides removed from other nucleotides (single fragments or entire fragments), or it can be a component or part of a larger nucleotide structure, such as an expression vector or a polycistronic sequence. Polynucleotides include DNA, RNA, and cDNA sequences.

[0030] The term "expression" in this invention includes any step involving RNA and protein production, including but not limited to: transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0031] The term "transcriptional expression cassette" in this invention refers to a class of expression elements that include a transcriptional regulatory element and a target gene, and that regulate the expression of the target gene using the transcriptional regulatory element. In this disclosure, the transcriptional regulatory element includes a promoter, and may also include enhancers, silencers, insulators, etc. In this disclosure, the target gene is specifically a protein-coding gene. "Operationally linked" between the target gene and a polynucleotide refers to the functional linking of a promoter-active polynucleotide to the target gene to initiate and mediate the transcription of the target gene; the operably linked manner can be any method described by those skilled in the art.

[0032] The term "target gene" in this invention refers to any gene linked to a promoter-active polynucleotide in this invention to regulate its transcriptional level. In some embodiments, a target gene refers to a gene encoding a target protein in a microorganism. Exemplary examples include genes encoding enzymes related to the biosynthesis of a target compound, enzymes related to reducing power, enzymes related to glycolysis or the TCA cycle, or enzymes related to the release of a target compound, etc.

[0033] The term "target compound" in this invention can be selected from organic acids, enzyme preparations, or other types of compounds that can be obtained through biosynthesis in the art. In some embodiments, the target compound is an organic acid. Organic acids can be acidic organic compounds, for example, those containing carboxyl and sulfonic acid groups. Exemplarily, organic acids include one or more combinations of gluconic acid, lactic acid, acetic acid, succinic acid, butyric acid, palmitic acid, oxalic acid, tartaric acid, citric acid, propionic acid, hexenoic acid, decanoic acid, octanoic acid, valeric acid, and malic acid, or other types of organic acids in the art. In some embodiments, the target compound is an enzyme preparation; exemplaryly, the enzyme preparation includes one or more combinations of glucosyl amylase, glucose oxidase, catalase, and phytase.

[0034] The term "expression vector" in this invention refers to bacterial plasmids, bacteriophages, yeast plasmids, viruses, or other vectors well known in the art. Plasmids can be linear or closed circular plasmids. In short, any plasmid and vector can be used as long as it can replicate and stabilize within the host cell. The choice of vector generally depends on its compatibility with the host cell in which it is introduced.

[0035] Expression vectors generally include (from 5' to 3'): a promoter that guides the transcription of the target gene and the target gene. If desired, the recombinant vector may further include: a multiple cloning site or at least one restriction enzyme site downstream of the promoter, a ribosome binding site for translation initiation, a 3'-transcription terminator, a 3'-polynucleotide signal, other untranslated nucleic acid sequences, transport and target nucleic acid sequences, resistance selection markers, enhancers, or operators. The target gene is ligated into the suitable multiple cloning site or restriction enzyme site, thereby operatively linking the target gene to the promoter.

[0036] Various ribosome binding sites commonly used in the field for translation initiation, 3'-polynucleotide signals, other non-translated nucleic acid sequences, transport and target nucleic acid sequences, resistance selection markers, enhancers or operators can all be used in this invention.

[0037] The vector can be a self-replicating vector, that is, a vector that exists as an extrachromosomal entity and whose replication does not depend on chromosome replication, such as a plasmid, extrachromosomal element, mini-chromosome, or artificial chromosome. The vector can contain any means necessary to ensure self-replication. Alternatively, the vector can be a vector that, when introduced into a host cell, integrates into the genome and replicates along with the chromosome into which it has already been integrated. Furthermore, a single vector or plasmid, or two or more vectors or plasmids, or transposons, containing the total DNA to be introduced into the host cell's genome, can be used.

[0038] The vector of the present invention preferably contains one or more selectable markers that allow for easy selection of cells for transformation, transfection, transduction, etc. The selectable markers are genes whose products provide resistance to antibiotics or viruses, resistance to heavy metals, prototrophic to auxotrophic traits, etc.

[0039] The vector of the present invention preferably includes elements that allow the vector to integrate into the host cell genome or to replicate autonomously within the cell independently of the genome. The expression vector may contain more than one copy of the target gene of interest to increase the yield of the gene product. The increase in the copy number of the target gene can be achieved by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selector gene and the target gene, wherein cells containing an amplified copy of the selector gene and thereby containing additional copies of the target gene can be screened by culturing the cells in the presence of a suitable selector.

[0040] Methods for preparing recombinant expression vectors are well known to those skilled in the art. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, and in vivo recombination techniques.

[0041] The terms "sequence identity" and "identity percentage" in this invention refer to the percentage of identical (i.e., same) nucleotides or amino acids between two or more polynucleotides or polypeptides. Sequence identity between two or more polynucleotides or polypeptides can be determined by aligning the nucleotide or amino acid sequences of the polynucleotide or polypeptide and scoring the number of positions in the aligned polynucleotide or polypeptide containing the same nucleotide or amino acid residues, comparing this to the number of positions in the aligned polynucleotide or polypeptide containing different nucleotide or amino acid residues. Polynucleotides may differ at a position, for example, by containing different nucleotides (i.e., substitution or mutation) or deleted nucleotides (i.e., nucleotide insertion or deletion in one or two polynucleotides). Polypeptides may differ at a position, for example, by containing different amino acids (i.e., substitution or mutation) or deleted amino acids (i.e., amino acid insertion or deletion in one or two polypeptides). Sequence identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residues by the total number of amino acid residues in the polynucleotide or polypeptide. For example, the identity percentage can be calculated by dividing the number of positions containing the same nucleotide or amino acid residues by the total number of nucleotide or amino acid residues in the polynucleotide or polypeptide and multiplying by 100.

[0042] The term "complementary" in this invention refers to hybridization or base pairing between nucleotides, such as between the two strands of a double-stranded DNA molecule or between an oligonucleotide primer and a primer binding site on a single-stranded nucleotide being sequenced or amplified.

[0043] The term "highly stringent conditions" in this invention refers to, for probes at least 100 nucleotides in length, following a standard DNA blotting procedure: pre-hybridization and hybridization at 42°C in 5X SSPE (saline sodium phosphate EDTA), 0.3% SDS, 200 μg / ml cleaved and denatured salmon sperm DNA, and 50% formamide for 12 to 24 hours. Finally, the vector material is washed three times at 65°C with 2X SSC and 0.2% SDS for 15 minutes each time.

[0044] The term "host cell" as used in this invention has the meaning commonly understood by those skilled in the art, namely, a cell capable of receiving the expression cassette mediated by the promoter of this invention, and after introduction, it is called a recombinant host cell. In other words, this invention can utilize any host cell, as long as its cells contain the promoter sequence of this invention. The host cell of this invention can be a eukaryotic cell, including but not limited to any one of the following strains: *Aspergillus niger*, *Aspergillus nidulans*, *Aspergillus oryzae*, *Penicillium chrysogenum*, *Trichoderma reesei*, *Ustilago maydis*, and *Myceliophthorathermophila*, with *Aspergillus niger*, *Aspergillus nidulans*, *Aspergillus oryzae*, and *Trichoderma reesei* being the most preferred, and mutants or strains prepared from the above strains that produce enzyme preparations and organic acids.

[0045] Recombinant host cells are specifically achieved, for example, through transformation. Here, "transformation" has the meaning commonly understood by those skilled in the art, that is, the process of introducing exogenous DNA into a host. The methods of transformation include any method of introducing nucleic acids into cells, including but not limited to electroporation, calcium phosphate precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and lithium acetate-DMSO method.

[0046] In this invention, the culture of the host cells can be carried out according to conventional methods in the art, including but not limited to plate culture, shake flask culture, batch culture, continuous culture and fed-batch culture, and various culture conditions such as temperature, time and pH of the culture medium can be appropriately adjusted according to actual conditions.

[0047] Example

[0048] Other objects, features, and advantages of the present invention will become apparent from the following detailed description. However, it should be understood that the detailed description and specific embodiments (although illustrating specific implementations of the invention) are given for illustrative purposes only, as various changes and modifications made within the spirit and scope of the invention will become apparent to those skilled in the art upon reading this detailed description.

[0049] Unless otherwise specified, the experimental techniques and methods used in this embodiment are conventional techniques and methods. For example, experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise specified, the materials and reagents used in the embodiments can be obtained through legitimate commercial channels.

[0050] Example 1: Identification of DNA fragments with transcriptional activation function

[0051] Based on the transcriptome data of Aspergillus niger strain M202 (Xiaomei Zheng, Peng Du, Kaiyue Gao, Yimou Du, Timothy C. Cairns, Xiaomeng Ni, Meiling Chen, Wei Zhao, Xinrong Ma, Hongjiang Yang, Ping Zheng, Jibin Sun. Genome-wide transcription landscape of citric acid producing Aspergillus niger in response to glucose gradient. Front Bioeng Biotechnol. 2023.11:1282314), promoters with strong transcriptional activity were predicted. Then, through multiple sequence alignment analysis, UAS elements with potential transcriptional activation functions in the strong promoter were further deduced and named UASa, UASb, and UASc, respectively. The specific sequences are shown in SEQ ID NO: 1-3.

[0052] SEQ ID NO:1

[0053] CGAAGCCCGAACTGAGGGGGTCTCGGTCATTTATCGGGATGAGAGCCAATCAGCGTGCGCTCATCATCTG.

[0054] SEQ ID NO:2

[0055] CACCCTCCAGAGTGACTAGGGGCGGAAATTTAAAGGGATTAATTTCCACTCAACCACAAATCACAGTCGT.

[0056] SEQ ID NO:3

[0057] GCGTTGGACCTGCGTTATAGCTTCCCGTTAGTTATATACCATCGTTATACCAGCCAATCAAGTCACCACGCACGACCGG.

[0058] To detect the transcriptional activation function of these potential UAS elements, this invention utilizes the promoter P of the currently commercially available and recognized strong fungal promoter glyceraldehyde-3-phosphate dehydrogenase. gpdA Different UAS element sequences were added upstream of the target gene, and then a fluorescent reporter plasmid was constructed using the red fluorescent protein mCherry as the reporter gene. Using the primer sequences shown in Table 1, the reporter plasmid pYD1 (Yudan Lu, Xiaomei Zheng, Yu Wang, Lihui Zhang, Lixian Wang, Yu Lei, Tongcun Zhang, Ping Zheng, Jibin Sun. Evaluation of Aspergillus nigersix constitutive strong promoters by fluorescent-auxotrophic selectioncoupled with flow cytometry: a case for citric acid production. J Fungi (Basel). 2022. 8(6): 568.) containing the mCherry gene was used as a template for reverse amplification, and the UAS element sequence was added to P. gpdA Upstream of the promoter.

[0059] The PCR reaction system consisted of 10 μL of 5×FastPfu buffer, 1 μL of 10 mM dNTPs, 2.5 μL each of upstream and downstream primers, 0.5 μL of DNA template, 1.5 μL of FastPfu (TransGene), and 32 μL of ultrapure water.

[0060] The PCR reaction conditions were as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 2 min, for 35 cycles; and a final extension at 72℃ for 10 min.

[0061] After purification, the PCR products were transformed into E. coli Trans-T1. The corresponding recombinant plasmids were extracted and verified by enzyme digestion and sequencing to obtain promoter reporter plasmids pSP1, pSP2, and pSP3 with different UAS element sequences.

[0062] Table 1. Primers used for constructing reporter plasmids of promoters with different UAS element additions.

[0063]

[0064] Fresh spores of Aspergillus niger M202 strain were suspended in 100 mL of CMA liquid medium (20 g / L glucose, 20 g / L malt extract, 1 g / L peptone), with a final concentration of 1 × 10⁻⁶. 5 / mL, cultured at 30℃ and 200r / min for 12-16h. The preparation and transformation of Aspergillus niger protoplast suspension were performed according to patent ZL201710380366.X. Cells were collected under aseptic conditions using a sterile micro-cloth filter and rinsed once with solution A (K2HPO4 5mM, KH2PO4 5mM, MgSO4 96.312g / L, pH 5.8, sterilized by filtration). The cells were then transferred to 20mL of lysis buffer (0.4g lysin in 20mL solution A) using a sterile cotton swab and lysed at 37℃ and 75r / min for approximately two hours. Filter the lysate through a sterile micro-cloth filter and collect protoplasts in two 50 mL sterile centrifuge tubes. Wash with solution B (Tris-HCl 10 mM, CaCl2 5.54 g / L, D-Sorbitol 218.64 g / L, pH 7.5, sterilized by filtration) to bring the volume to approximately 25 mL per tube. Centrifuge at 2000 rpm for 5 min, discard the supernatant, and resuspend the precipitate twice with 20 mL of solution B. Resuspend the precipitate in 10 mL of solution B and count the protoplasts using a hemocytometer. Centrifuge and resuspend once more with an appropriate amount of solution B based on the count results. Add 100 μL of protoplast suspension to a pre-cooled 15 mL centrifuge tube on ice, then add 5 μg of reporter plasmids pSP1, pSP2, pSP3, and pYD1 with different promoters, respectively. Add 1 mL of solution C (Tris-HCl 10 mM, CaCl2 5.54 g / L, PEG6000 50% (w / v), pH 7.5, sterilized by filtration), incubate on ice for 10 min, and add 2 mL of solution B and mix well. Mix with preheated MMSH upper medium containing screening conditions, then spread evenly onto MMSH lower medium plates. Incubate the plates at 30 °C for 3–5 days to obtain Aspergillus niger reporter strains with different promoters, named AnSP1, AnSP2, AnSP3, and AnPgpdA, respectively. The reporter strain with the PgpdA promoter without the UAS element is the control strain.

[0065] Reporter strains with different artificial promoters were cultured on MM solid medium for 3 days, and the fluorescence intensity was detected using a fluorescence imaging system. The results are as follows: Figure 1 As shown, compared with the PgpdA promoter, the reporter strains of the promoters with added UASa and UASb exhibited stronger fluorescence, increasing by 30-50% and 10-30%, respectively. However, the addition of UASc showed no significant enhancement compared to the control. This indicates that both UASa and UASb possess transcriptional activation functions and can further enhance the activity of the PgpdA promoter.

[0066] Example 2: Identification of the core functional DNA sequence of the transcriptional activation UAS element

[0067] This invention utilizes multiple sequence alignment analysis to predict the potential core DNA sequence of the UAS element, as shown in Table 2. Using the method described in Example 1, and employing the primers shown in Table 2, reverse amplification was performed using the reporter plasmid pYD1 (Yudan Lu, Xiaomei Zheng, Yu Wang, Lihui Zhang, Lixian Wang, Yu Lei, Tongcun Zhang, Ping Zheng, Jibin Sun. Evaluation of Aspergillus niger six constitutive strong promoters by fluorescent-auxotrophic selection coupled with flow cytometry: a case for citric acid production. J Fungi (Basel). 2022. 8(6): 568.) containing the mCherry gene as a template. The potential core DNA sequence of the UAS element was then added to pYD1. gpdA Upstream of the promoters, reporter plasmids pSP4-pSP9 for each promoter were further constructed. Following the Aspergillus niger DNA transformation method described in patent ZL201710380366.X, Aspergillus niger reporter strains for each promoter were constructed and named AnSP4 to AnSP9, respectively.

[0068] Reporter strains with different artificial promoters were cultured on MM solid medium for 3 days, and the fluorescence intensity was detected using a fluorescence imaging system. The results are as follows: Figure 2 As shown, compared to the PgpdA promoter, when the core sequence of UASa was shortened to 30 bp and 20 bp, the reporter strains added upstream of the PgpdA promoter still exhibited stronger fluorescence, increasing by 40-60% and 30-50% respectively compared to the control promoter, with no significant difference in transcriptional activation compared to the full-length UASa sequence. This indicates that the core sequence of UASa is the sequence shown in SEQ ID NO: 5, and this series still possesses strong transcriptional activation function.

[0069] Table 2. DNA sequences of UAS element truncated mutants and primers for constructing their reporter plasmids.

[0070]

[0071]

[0072] Example 3: Application Effect of Artificial Promoters Designed and Constructed Based on Transcriptional Activation UAS Elements

[0073] This invention utilizes the UAS elements identified in Example 1, and designs different artificial promoters through copy number optimization and combination of UAS elements. Using the primers shown in Table 3, pSP1 and pSP2 are used as templates to amplify the plasmid backbone. Different copy numbers and combinations of UAS elements are obtained by primer mixing and PCR. The PCR reaction system and conditions follow the method of Example 1.

[0074] After purifying the PCR products of the plasmid backbone and UAS elements with different copy numbers and combinations, recombination reactions were performed using the Novizan non-ligase-dependent single-fragment rapid cloning kit (catalog number: C112-01), followed by transformation into *E. coli* Trans-T1. The corresponding recombinant plasmids were extracted and verified by enzyme digestion and sequencing to obtain artificial promoter reporter plasmids pSP10-14 with 2 to 6 copies of UASb, pSP15-19 with 2 to 6 copies of UASb, pSP20 and pSP21 with different sequences of UASab and UASba (UASa and UASb), and pSP22 and pSP23 with 2 copies of UASab and UASba. Following the *Aspergillus niger* DNA transformation method described in patent ZL201710380366.X, as shown in Example 1, *Aspergillus niger* reporter strains with each promoter were constructed and named AnSP10 to AnSP23, respectively.

[0075] Table 3. Primers for constructing artificial promoter reporter plasmids using UAS elements

[0076]

[0077]

[0078] Reporter strains with different artificial promoters were cultured on MM solid medium for 3 days, and their fluorescence intensity was detected using a fluorescence imaging system. The results are shown in Table 4. Compared with the PgpdA promoter, increasing the copy number of UASa and UASb further enhanced the activity of the PgpdA promoter. When UASa and UASb reached 6 copies, the fluorescence intensity of the corresponding artificial promoter reporter strains was 550-580% and 320-360% of the control promoter reporter strains, respectively. Combining UASa and UASb also further enhanced the activity of the PgpdA promoter. The fluorescence intensity of the artificial promoter reporter strains with added UASab and UASb was 220-280% and 180-220% of the control promoter reporter strains, respectively. Similar to single UAS elements, increasing the copy number of different UAS elements can further enhance promoter activity. The fluorescence intensity of the artificial promoter reporter strains with two copies of the combined UAS elements (UASab)2 and (UASba)2 was 520-580% and 480-520% of that of the control promoter reporter strain, respectively. This demonstrates that the UAS elements provided by this invention can be used to construct a series of high-intensity artificial promoters by increasing or combining copies.

[0079] Table 4. Improvement effect of UAS element combination and copy number optimization artificial promoter.

[0080]

[0081]

[0082] Example 4: Application effect of adding transcription activation UAS element upstream of different promoters

[0083] This invention also provides examples of adding UAS elements upstream of different promoters to illustrate the versatility of UAS elements. In this embodiment, UASa and UASb, along with different copy numbers, were added upstream of the PcitA and PpkiA promoters to construct artificial promoters with different promoters. Using the primers shown in Table 5, reverse amplification was performed using pSP1, pSP10, and pSP15 as templates to obtain plasmid frames with the PgpdA promoter removed. Simultaneously, using M202 genomic DNA as a template, DNA fragments of PcitA and PpkiA were amplified, and the PCR reaction system and conditions followed the method in Example 1. After purifying the PCR products of the plasmid backbone and UAS elements with different copy numbers and combinations, recombination reactions were performed using the Novizan non-ligase-dependent single-fragment rapid cloning kit (catalog number: C112-01), followed by transformation into E. coli Trans-T1. After extracting the corresponding recombinant plasmids, enzyme digestion and sequencing were used to verify and obtain artificial promoter reporter plasmids pSP24-29 with 1, 2 and 4 copies of UASa added upstream of the PcitA and PpkiA promoters.

[0084] Table 5. Primers for constructing artificial promoter reporter plasmids by adding UAS elements to the PcitA and PpkiA promoters.

[0085] Primer name Primer sequence pSP-F CATATGGACCTGGTCGTTGCGTCAG pSP-R CTCGAGCAGATGATGAGCGCACGCTG PcitA-F ccaatcagcgtgcgctcatcatctgCTCGAGCAAAATTGTGGATGAGATGG PcitA-R CTCTGGACTGACGCAACGACCAGGTCCATATGATGGAGAAGCTCTTTTGCG PpkiA-F ccaatcagcgtgcgctcatcatctgCTCGAGGTCCCTGTCTACTGACCAG PpkiA-R CTCTGGACTGACGCAACGACCAGGTCCATATGCTACGGAGTAGTTACAATCACAC

[0086] Reporter strains with different artificial promoters were cultured on MM solid medium for 3 days, and their fluorescence intensity was detected using a fluorescence imaging system. The results are shown in Table 6. Compared with the PcitA promoter, the addition of UASa and its multiple copies further improved the activity of the PcitA promoter. When 1, 2, and 4 copies of UASa were added, the fluorescence intensity of the corresponding reporter strains of the artificial promoters was 180-220%, 260-300%, and 350-400% of that of the control promoter reporter strains, respectively. Similarly, the addition of 1, 2, and 4 copies of UASa upstream of the PpkiA promoter significantly improved promoter activity. When 1, 2, and 4 copies of UASa were added, the fluorescence intensity of the corresponding reporter strains of the artificial promoters was 280-320%, 480-520%, and 680-720% of that of the control promoter PpkiA reporter strains, respectively. This demonstrates that the UAS element provided by this invention has excellent compatibility and versatility, and can be combined with different promoters to construct a series of high-strength artificial promoters.

[0087] Table 6. Effects of adding UAS components to upstream artificial promoters of PcitA and PpkiA promoters on their performance.

[0088]

[0089]

[0090] Example 5: Application and Effect of Artificial Promoters Constructed Based on Transcriptional Activation UAS Elements in the Modification of Citric Acid-Rich Strains

[0091] This invention utilizes the UAS element identified in Example 1 and the artificial strong promoter constructed in Example 3 to modify a citric acid-producing strain. First, using the upstream and downstream primers for the citric acid efflux protein CexA as shown in Table 4, and with the genome of *Aspergillus niger* strain M202 as a template, PCR amplification of the citric acid efflux protein gene fragment was performed. Simultaneously, using pSP-F2 and pSP-R2 as primers, and pPgpdA, pSP1, pSP2, pSP10, pSP12, pSP14, pSP15, pSP17, pSP19, and pSP20-23 as templates, the plasmid backbone was amplified. The PCR reaction system and conditions followed the method of Example 1.

[0092] After purifying the PCR products containing plasmid backbones with different artificial promoters and the CexA gene fragment, recombination reactions were performed using the Novizan non-ligase-dependent single-fragment rapid cloning kit (catalog number: C112-01), followed by transformation into *E. coli* Trans-T1. The corresponding recombinant plasmids were extracted and verified by enzyme digestion and sequencing to obtain the artificial promoter-mediated citrate efflux protein expression enhancement plasmids pPgpdA-cexA and pSP36-47. Following the *Aspergillus niger* DNA transformation method described in patent ZL201710380366.X, as shown in Example 1, *Aspergillus niger* citrate efflux protein expression enhancement strains mediated by each promoter were constructed and named AnPgpdA-cexA, AnSP36 to AnSP47, respectively.

[0093] Table 7. Primers for constructing the expression vector of citrate efflux protein in Aspergillus niger.

[0094] Primer name Primer sequence pSP-F2 gaagaaaaccctggccctCATATGGTGAGCAAGGGCGAGGAG pSP-R2 ggtggctacgtaTTAATTAAGCGGCCGCTGTCTATGTGGCGGGGTAATG CexA-F ATGTCTTCAACCACGTCTTCA CexA-R CTAGTTGCCGTTGGCTTTG

[0095] The *Aspergillus niger* strains with enhanced citrate efflux protein expression, AnPgpdA-cexA, AnSP36, and AnSP47, were inoculated onto PDA medium and cultured at 30°C for 5 days. Spores were then collected using 0.9% physiological saline and counted using a hemocytometer. (The text abruptly ends here, likely due to an incomplete sentence or missing information.) 6The inoculum was inoculated at a rate of 1 mL / mL into citric acid fermentation medium (corn starch medium, total sugar content 12%), and cultured at 34℃ and 250 rpm for 96 h. The fermentation supernatant was collected by rapid filtration, diluted 10-fold, boiled for 10 min, filtered through a membrane, and the citric acid content was determined by HPLC. Specific detection conditions included an Aminex HPX-87H column (300 mm x 7.8 mm x 9 μm, BioRad), a Shimadzu UFLC high-performance liquid chromatograph (equipped with a Shimadzu LC-20AD infusion pump, SPD-20AUV detector, CTO-20A / AC column oven, SIL-20ACHT UFLC-specification autosampler, and a Shimadzu LCsution workstation), mobile phase A being ultrapure water, mobile phase B being 2.75 mM H₂SO₄, flow rate of 0.6 mL / min, injection volume of 10 μL, column temperature of 50℃, and UV detection wavelength of 210 nm.

[0096] The results are shown in Table 8. Compared with the starting strain, the strong promoter P gpdA The citric acid production of the citric acid efflux protein expression-enhancing strain AnPgpdA-CexA was increased by 50%. Compared with AnPgpdA-CexA, the citric acid fermentation level of the citric acid efflux protein expression-enhancing strain mediated by the artificial promoter provided in this invention can be further significantly improved. Specifically, the citric acid fermentation level of the citric acid efflux protein expression-enhancing strain mediated by artificial promoters containing single and two copies of UASa and UASb was increased by 15-35%, with significant effects. The citric acid fermentation level of the citric acid efflux protein expression-enhancing strain mediated by artificial promoters containing four copies of UASa and UASb, as well as the combination of two UAS elements UASab and UASba, was increased by 30-50%, with even more significant effects. Furthermore, the citric acid fermentation level of the citric acid efflux protein expression-enhancing strain mediated by artificial promoters containing six copies of UASa and UASb, as well as the combination of two UAS elements (UASab)2 and (UASba)2, was increased by 50-80%, with the most significant effect.

[0097] Table 8. Citrate efflux protein expression enhancement strains mediated by artificial promoters significantly improved citric acid fermentation.

[0098]

[0099] Example 6: Application and Effect of Artificial Promoters Constructed Based on Transcriptional Activation UAS Elements in the Modification of Citric Acid-Rich Strains

[0100] This invention utilizes the UAS element identified in Example 1 and the artificial strong promoter constructed in Example 3 to modify a citric acid-producing strain. First, using the upstream and downstream primers for the citric acid efflux protein CexA as shown in Table 9, and the genome of *Aspergillus niger* strain M202 as a template, the gene fragment of the citric acid efflux protein was amplified by PCR. Simultaneously, using pSP-F2 and pSP-R2 as primers, and pPgpdA, pSP1, pSP2, pSP10, pSP12, pSP14, pSP15, pSP17, pSP19, and pSP20-23 as templates, the plasmid backbone was amplified. The PCR reaction system and conditions followed the method of Example 1.

[0101] After purifying the PCR products containing plasmid backbones with different artificial promoters and the CexA gene fragment, recombination reactions were performed using the Novizan non-ligase-dependent single-fragment rapid cloning kit (catalog number: C112-01), followed by transformation into *E. coli* Trans-T1. The corresponding recombinant plasmids were extracted and verified by enzyme digestion and sequencing to obtain the artificial promoter-mediated citrate efflux protein expression enhancement plasmids pPgpdA-cexA and pSP36-47. Following the *Aspergillus niger* DNA transformation method described in patent ZL201710380366.X, as shown in Example 1, *Aspergillus niger* citrate efflux protein expression enhancement strains mediated by each promoter were constructed and named AnPgpdA-cexA, AnSP36 to AnSP47, respectively.

[0102] Table 9. Primers for constructing the expression vector of citrate efflux protein in Aspergillus niger.

[0103] Primer name Primer sequence pSP-F2 gaagaaaaccctggccctCATATGGTGAGCAAGGGCGAGGAG pSP-R2 ggtggctacgtaTTAATTAAGCGGCCGCTGTCTATGTGGCGGGGTAATG CexA-F ATGTCTTCAACCACGTCTTCA CexA-R CTAGTTGCCGTTGGCTTTG

[0104] The *Aspergillus niger* strains with enhanced citrate efflux protein expression, AnPgpdA-cexA, AnSP36, and AnSP47, were inoculated onto PDA medium and cultured at 30°C for 5 days. Spores were then collected using 0.9% physiological saline and counted using a hemocytometer. (The text abruptly ends here, likely due to an incomplete sentence or missing information.) 6The inoculum was inoculated at a rate of 1 mL / mL into citric acid fermentation medium (corn starch medium, total sugar content 12%), and cultured at 34℃ and 250 rpm for 96 h. The fermentation supernatant was collected by rapid filtration, diluted 10-fold, boiled for 10 min, filtered through a membrane, and the citric acid content was determined by HPLC. Specific detection conditions included an Aminex HPX-87H column (300 mm x 7.8 mm x 9 μm, BioRad), a Shimadzu UFLC high-performance liquid chromatograph (equipped with a Shimadzu LC-20AD infusion pump, SPD-20AUV detector, CTO-20A / AC column oven, SIL-20ACHT UFLC-specification autosampler, and a Shimadzu LCsution workstation), mobile phase A being ultrapure water, mobile phase B being 2.75 mM H₂SO₄, flow rate of 0.6 mL / min, injection volume of 10 μL, column temperature of 50℃, and UV detection wavelength of 210 nm.

[0105] The results are shown in Table 10. Compared with the starting strain, the strong promoter P gpdA The citric acid production of the citric acid efflux protein expression-enhancing strain AnPgpdA-CexA was increased by 50%. Compared with AnPgpdA-CexA, the citric acid fermentation level of the citric acid efflux protein expression-enhancing strain mediated by the artificial promoter provided in this invention can be further significantly improved. Specifically, the citric acid fermentation level of the citric acid efflux protein expression-enhancing strain mediated by artificial promoters containing single and two copies of UASa and UASb was increased by 15-35%, with significant effects. The citric acid fermentation level of the citric acid efflux protein expression-enhancing strain mediated by artificial promoters containing four copies of UASa and UASb, as well as the combination of two UAS elements UASab and UASba, was increased by 30-50%, with even more significant effects. Furthermore, the citric acid fermentation level of the citric acid efflux protein expression-enhancing strain mediated by artificial promoters containing six copies of UASa and UASb, as well as the combination of two UAS elements (UASab)2 and (UASba)2, was increased by 50-80%, with the most significant effect.

[0106] Table 10. Citrate efflux protein expression enhancement strains mediated by artificial promoters significantly improved citric acid fermentation.

[0107]

[0108] Example 7: Application and Effect of Artificial Promoter Constructed Based on Transcriptional Activation UAS Element in Glucose Oxidase Expression

[0109] This invention utilizes the UAS element identified in Example 1 and the artificial strong promoter constructed in Example 3 to modify a citric acid-producing strain. First, using the upstream and downstream primers for glucose oxidase GoxC as shown in Table 11, and the genome of *Aspergillus niger* strain M202 as a template, the glucose oxidase gene fragment was amplified by PCR. Simultaneously, using pSP-F3 and pSP-R3 as primers, and pPgpdA, pSP1, pSP2, pSP10, pSP12, pSP14, pSP15, pSP17, pSP19, and pSP20-23 as templates, the plasmid backbone was amplified. The PCR reaction system and conditions followed the method of Example 1.

[0110] After purifying the PCR products containing plasmid backbones with different artificial promoters and the GoxC gene fragment, recombination reactions were performed using the Novizan non-ligase-dependent single-fragment rapid cloning kit (catalog number: C112-01), followed by transformation into *E. coli* Trans-T1. The corresponding recombinant plasmids were extracted and verified by enzyme digestion and sequencing to obtain the artificial promoter-mediated citrate efflux protein expression enhancement plasmids pPgpdA-GoxC and pSP48-59. Following the *Aspergillus niger* DNA transformation method described in patent ZL201710380366.X, as shown in Example 1, *Aspergillus niger* citrate efflux protein expression enhancement strains mediated by each promoter were constructed and named AnPgpdA-GoxC, AnSP48 to AnSP59, respectively.

[0111] Table 11. Primers for constructing the expression vector of citrate efflux protein in Aspergillus niger.

[0112] Primer name Primer sequence pSP-F3 agctcacaaggagagtctgcatCATATGGTGAGCAAGGGCGAGGAG pSP-R3 ggactacgcttctatgcagtgaGCGGCCGCTGTCTATGTGGCGGGGTAATG GoxC-F ATGCAGACTCTCCTTGTGAGCT GoxC-R TCACTGCATAGAAGCGTAGTCC

[0113] The *Aspergillus niger* strains with enhanced citrate efflux protein expression, AnPgpdA-GoxC, AnSP48, and AnSP59, were inoculated onto PDA medium and cultured at 30°C for 5 days. Spores were then collected using 0.9% physiological saline and counted using a hemocytometer. 6 The inoculum was inoculated at a rate of / mL into Aspergillus niger protein fermentation medium (2% glucose, 2% maltose, 1.5% ammonium sulfate, 4% trypsin-digested soybean culture, 0.1% sodium dihydrogen phosphate, 0.1% magnesium sulfate), and cultured at 34℃ and 250r / min for 96h. The fermentation supernatant was then separated by filtration, which is the crude enzyme solution.

[0114] For glucose oxidase activity assay, the crude enzyme solution was directly diluted to a suitable concentration with buffer solution. Four test tubes were prepared, each containing 2 mL buffer solution, 0.3 mL glucose, 0.4 mL phenol, 0.1 mL 4-aminoantipyrine, and 0.1 mL horseradish peroxidase. The tubes were preheated at 30°C for 5 min. 0.1 mL distilled water was added to one tube as a blank for zeroing. 0.1 mL of sample solution was added to the sample tube, and timing began. After vortexing, the absorbance was immediately measured at 500 nm using a 1 cm cuvette. The absorbance value was read as A0 after 0.5 min. After another 1 min of reaction, the absorbance value was read as A1. The result was ΔA500 = A1 - A0. The enzyme activity was calculated using the formula: ΔA500 × enzyme solution dilution factor × reaction volume × 1000 / (887 × reaction time × sample volume × cuvette thickness) = 33.82 × ΔA500 × enzyme solution dilution factor. The reaction volume was 3 mL, 1000 was the extinction coefficient conversion factor, 887 was the extinction coefficient (L·mol⁻¹·cm⁻¹), the reaction time was 1 min, the sample volume was 0.1 mL, and the cuvette thickness was 1 cm. An enzyme activity unit (U) is defined as the amount of enzyme required to oxidize 1 μmol of β-D-glucose to D-gluconic acid and hydrogen peroxide per minute under conditions of pH 6.0 and 30℃.

[0115] The results are shown in Table 12. Compared with AnPgpdA-GoxC, the glucose oxidase activity of the glucose oxidase expression-enhancing strains mediated by the artificial promoters provided in this invention was significantly improved. Specifically, the glucose oxidase activity of the glucose oxidase expression-enhancing strains mediated by artificial promoters containing single copies and two copies of UASa and UASb was increased by 10-35%, showing significant effects. The glucose oxidase activity of the glucose oxidase expression-enhancing strains mediated by artificial promoters containing four copies of UASa and UASb, as well as the combinations of two UAS elements (UASab)2 and (UASba)2, was increased by 35-60%, showing even more significant effects. Furthermore, the glucose oxidase activity of the glucose oxidase expression-enhancing strains mediated by artificial promoters containing six copies of UASa and UASb, as well as the combinations of two UAS elements (UASab)2 and (UASba)2, was increased by 60-100%, showing the most significant effects.

[0116] Table 12. Citrate efflux protein expression enhancement strains mediated by artificial promoters significantly improved citric acid fermentation.

[0117]

Claims

1. A UAS element having transcription-enhancing function, characterized by comprising a nucleotide sequence represented by SEQ ID NO:

1. The UAS element contains at least one of the following nucleotide sequences: A. a nucleotide sequence as shown in SEQ ID NO: 1 or 2; B. an element obtained by truncating both ends or one end of the nucleotide sequence as shown in SEQ ID NO: 1 or 2 by 1 to 30 nucleotides, which still has a transcription enhancing function.

2. The UAS element of transcriptional enhancer function according to claim 1, wherein, an element obtained by truncating the nucleotide sequence as shown in SEQ ID NO: 1 and retaining at least the function of the nucleotide sequence as shown in SEQ ID NO:

1.

3. The UAS element of transcriptional enhancer function according to claim 1, wherein, a nucleotide sequence as shown in any one of SEQ ID NO: 4 to 9.

4. A recombinant expression element for enhancing the expression of a target gene, characterized in that, The UAS element having a transcription enhancing function as claimed in any one of claims 1 to 3 is arranged upstream of the promoter of a target gene.

5. A recombinant expression vector for enhancing expression of a target gene, characterized by, The recombinant expression element for enhancing the expression of a target gene as claimed in claim 6, or the UAS element having a transcription enhancing function as claimed in any one of claims 1 to 3.

6. A recombinant fungal host cell, characterized in that, The recombinant host cell containing the UAS element as claimed in any one of claims 1 to 3, or the recombinant expression element as claimed in claim 4, or the recombinant expression vector as claimed in claim 5; Preferably, the fungus is Aspergillus niger (A. niger) Aspergillus niger ), Aspergillus nidulans (A. nidulans) Aspergillus nidulans ), Aspergillus oryzae (A. oryzae) Aspergillus oryzae ), Penicillium chrysogenum (P. chrysogenum) Penicillium chrysogenum ), Trichoderma reesei (T. reesei) Trichoderma reesei ), Ustilago maydis (U. maydis) Ustilago maydis ), Myceliopthora thermophila (M. thermophila) Myceliophthora thermophila ).

7. Use of the UAS element having a transcription enhancing function as claimed in any one of claims 1 to 3 for enhancing the transcription activity of a target gene. Preferably, it is achieved by arranging the UAS element having a transcription enhancing function upstream of the promoter of a target gene.

8. A method of enhancing expression of a gene of interest, comprising, The UAS element having a transcription enhancing function as claimed in any one of claims 1 to 3 is arranged upstream of the promoter of a target gene to increase the transcription expression of the target gene. Preferably, the UAS element having a transcription enhancing function is arranged upstream of the promoter of a target gene in a single copy or multiple copies, and the multiple copies are specifically 2, 3, 4, 5 or 6 copies. Preferably, different UAS elements having a transcription enhancing function are combined or combined in different copy numbers. The promoter is selected from the group consisting of PcitA, PpkiA, P gpdA Promoter.

9. The method of claim 8, wherein, The target gene is a gene encoding an enzyme, a protein or a transcription factor; specifically, the enzyme is a gene required for citric acid synthesis, such as a gene of a citric acid efflux protein or a glucose oxidase gene.

10. A method for producing an organic acid or enzyme preparation, characterized by, The method comprises the steps of culturing the recombinant host cell as claimed in claim 6 to produce an organic acid or an enzyme, and collecting the produced organic acid or enzyme, wherein the target gene is a gene encoding a protein related to the synthesis of the organic acid or enzyme. Optionally, the organic acid is any one of gluconic acid or citric acid; and the enzyme preparation is any one of glucoamylase, glucose oxidase, catalase or phytase. Preferably, it further comprises the step of separating the organic acid or enzyme preparation from the fermentation broth after the culturing.

Images