RanGAP1 gene and its application in regulating reproduction of female citrus psylla

By downregulating the reproductive capacity of female citrus psyllids through dsRNA targeting the DcRanGAP1 gene, the pre-oviposition period was prolonged, the oviposition period was shortened, and the number of eggs laid was reduced, thus solving the problem of the high reproductive capacity of citrus psyllids and achieving effective pest control.

CN121472229BActive Publication Date: 2026-03-17PLANT PROTECTION RES INST OF GUANGDONG ACADEMY OF AGRI SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202610033225.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-01-12
Publication Date
2026-03-17
Estimated Expiration
2046-01-12

AI Technical Summary

Technical Problem

In existing technologies, the citrus psyllid has a high reproductive capacity, which leads to serious damage to citrus plants. There is a lack of effective gene regulation methods to reduce the reproductive capacity of female citrus psyllids.

Method used

By feeding dsRNA targeting the DcRanGAP1 gene, the expression of the DcRanGAP1 gene was downregulated, inhibiting the reproductive process of the citrus psyllid, including prolonging the pre-oviposition period, shortening the oviposition period, reducing the number of eggs laid, and inhibiting ovarian development.

Benefits of technology

It significantly inhibits the reproductive capacity of female citrus psyllids, prolongs the pre-oviposition period, shortens the oviposition period, reduces the number of eggs laid, and lowers the titer of Huanglongbing bacteria in the ovaries, thereby achieving the goal of controlling citrus psyllids.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121472229B_ABST
    Figure CN121472229B_ABST
Patent Text Reader

Abstract

This invention discloses RanGAP1 Genes and their application in regulating the reproduction of female citrus psyllids. DcRanGAP1 The nucleotide sequence of the gene is shown in SEQ ID NO.9. The female citrus psyllid, eight days after emergence, showed a downregulation. DcRanGAP1 After gene expression, the pre-oviposition period is significantly prolonged, the oviposition period is significantly shortened, the number of eggs laid is significantly reduced, and ovarian development is significantly inhibited and the Huanglongbing titer in the ovary is significantly reduced, thereby achieving the goal of controlling citrus psyllids and providing a new approach to the prevention and control of Huanglongbing.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of pest and disease control, specifically involving the application of the RanGAP1 gene in regulating the reproduction of female citrus psyllids. Background Technology

[0002] Asian citrus psyllid ( Diaphorina citri Kuwayama (a type of insect belonging to the family Psyllidaceae in the order Hemiptera) is a major vector insect of citrus Huanglongbing (HLB). Citrus reticulata Nine-mile fragrance Murraya exotica Yellow skin Clausena lansium Citrus psyllids are important pests during the new shoot growth stage of Rutaceae plants. They obtain nutrients by piercing and sucking the tender leaves and shoots of their host plants, primarily by feeding in clusters, causing young buds to wither, young leaves to deform, and new shoots to bend. Plants infected with citrus Huanglongbing (HLB) show uniform yellowing of new shoots, mottled old leaves, rotten and fallen fine roots, numerous small and deformed flowers, and small, bland, easily dropped fruits. The entire plant dies several months to several years after the onset of the disease.

[0003] In recent years, numerous studies have reported that insect oviposition is regulated by a series of hormones and genes. The synthesis and absorption of vitellogenin (Vg) are essential for oocyte maturation and are regulated by multiple signaling pathways, such as juvenile hormone (JH) and ecdysone (20%). hydroxyecdysone (20E), rapamycin target (TOR), insulin-like peptide (insulin) Like peptide-like (ILP) signaling pathways. Juvenile hormone regulates oocyte maturation and vitellogenin biosynthesis in the fat body. Brown planthopper Nilaparvata lugens During reproduction, the female insect's nutrient signaling pathway significantly activates the biosynthesis of juvenile hormone, thereby stimulating the expression of vitamin G in the fat body through endocrine regulation mechanisms and promoting ovarian development. RNA interference in the *Allium tuberosum* leaf beetle. Galeruca daurica The Met gene can induce reproductive diapause, reduce juvenile hormone titers, and inhibit the expression of Kr-h1 and Vg. Silent Cabbage Ape Leaf Beetle Colaphellus bowringi Kr-h1, a key downstream transcription factor in the juvenile hormone signaling pathway, can reduce juvenile hormone titers, inhibit the expression of Met and Vg, and promote reproductive diapause. (American cockroach) Periplaneta americana The insulin / IGF signaling pathway (IIS) and target of rapamycin complex 1 (TORC1) regulate Vg expression by activating juvenile hormone biosynthesis, thereby inducing follicle generation and promoting ovarian development.

[0004] In the case of the citrus psyllid, research findings are relatively limited. In reports on Huanglongbing (HLB) enhancing the fertility of the citrus psyllid, miR-275 negatively regulates the vitellogenin receptor, activates the juvenile hormone signaling pathway, enhances the fertility of the citrus psyllid, and promotes HLB replication in the ovary. HLB enhances the fertility of the citrus psyllid by increasing the expression of lipomotor hormone and its receptor, decreasing the expression of miR-34, promoting lipid metabolism mobilization, and activating the juvenile hormone signaling pathway to promote yolk production. Although some previous studies have preliminarily identified and elucidated the molecular mechanisms of ovarian development and reproduction in female citrus psyllids, further research into more ovary-specific genes and their impact on citrus psyllid reproduction is fundamental to the genetic control of the citrus psyllid.

[0005] Citrus psyllids have a high reproductive capacity and primarily damage host plants by piercing and sucking the tender leaves and shoots. Therefore, reducing or inhibiting the reproductive capacity of female citrus psyllids is one of the effective ways to reduce damage. In natural environments, plant hosts expressing dsRNA can enter the citrus psyllid's body through ingestion, thereby affecting its reproduction and achieving the purpose of pest control. Summary of the Invention

[0006] The first objective of this invention is to provide a downregulation DcRanGAP1 The application of gene expression in suppressing the reproduction of citrus psyllids, as described above. DcRanGAP1 The nucleotide sequence of the gene is shown in SEQ ID NO.9.

[0007] Preferably, the downward adjustment DcRanGAP1 Gene expression is achieved through targeted feeding. DcRanGAP1 The target is achieved through the dsRNA of the gene. DcRanGAP1 The nucleotide sequence of the target region of the gene's dsRNA is shown in SEQ ID NO.10.

[0008] Preferably, the target DcRanGAP1 The concentration of the gene's dsRNA was 300 ng / μL.

[0009] Preferably, the inhibition of citrus psyllid reproduction is achieved by prolonging the pre-oviposition period of female citrus psyllids, shortening the oviposition period of female citrus psyllids, reducing the number of eggs laid by female citrus psyllids, inhibiting the ovarian development of female citrus psyllids, or reducing the titer of Huanglongbing bacteria in the ovaries of female citrus psyllids.

[0010] The second objective of this invention is to provide a targeted DcRanGAP1 The dsRNA of the gene, and the nucleotide sequence of its target region are shown in SEQ ID NO.10.

[0011] A third objective of this invention is to provide a method for preparing the aforementioned target.DcRanGAP1 The primer pair for the dsRNA of the gene, wherein the nucleotide sequence of the upstream primer of the primer pair is shown in SEQ ID NO.5, and the nucleotide sequence of the downstream primer of the primer pair is shown in SEQ ID NO.6.

[0012] A fourth object of the present invention is to provide a formulation for controlling citrus psyllids, containing the aforementioned targeted agent. DcRanGAP1 The dsRNA of the gene is the active ingredient.

[0013] A fifth object of the present invention is to provide the application of the described formulation in the control of citrus psyllids.

[0014] Preferably, the application includes the following steps: feeding citrus psyllids with the preparation.

[0015] Preferably, the targeted component in the formulation DcRanGAP1 The concentration of the gene's dsRNA was 300 ng / μL.

[0016] The present invention has the following advantages and effects compared with the prior art:

[0017] This invention identifies a gene that regulates the reproduction of female citrus psyllids. DcRanGAP1 Female citrus psyllids, eight days after molting, showed a downward trend. RanGAP1 After gene expression, the pre-oviposition period is significantly prolonged, the oviposition period is significantly shortened, the number of eggs laid is significantly reduced, ovarian development is abnormal, and the titer of citrus Huanglongbing fungus is reduced, thereby achieving the purpose of pest control. Attached Figure Description

[0018] Figure 1 It is found in different tissues (A) and ovaries of different ages (B) of the citrus psyllid. DcRanGAP_{1} The expression level graph; different letters indicate significant differences (p<0.05).

[0019] Figure 2 It is a female citrus psyllid that has emerged 8 days ago being fed targeted feeding DcRanGAP_{1} Statistical graphs of pre-ovulatory (A), ovulatory (B), and number of eggs laid (C) after dsRNA administration; *, **, and *** indicate significant differences at the p<0.05, p<0.01, and p<0.001 levels, respectively.

[0020] Figure 3 It is a female citrus psyllid that has emerged 8 days ago being fed targeted feeding DcRanGAP_{1} A diagram of ovarian development following dsRNA administration; O represents the ovary, and the scale bar is 200 µm.

[0021] Figure 4 It is a female citrus psyllid that has emerged 8 days ago being fed targeted feeding DcRanGAP_{1} Citrus Huanglongbing bacteria in the ovary after dsRNA andDcRanGAP_{1} A graph showing the change in titer; O represents the ovary, and the scale bar is 200 µm. Detailed Implementation

[0022] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0023] Example 1

[0024] 1. The insects used were collected from the wild and then kept in a laboratory environment for a long period of time. The temperature was set at 26±2℃, the indoor humidity was controlled at around 65%, and the photoperiod L:D = 14:10 to ensure that the citrus psyllid was in the optimal growth environment and to accelerate its growth and reproduction. The citrus psyllids were reared on lemon trees, and the lemon trees were regularly fertilized, watered, and pruned.

[0025] 2. Total RNA extraction: Ovaries of 30 female adult citrus psyllids were collected on days 4, 8, and 12 after emergence, as well as ovaries, heads, midguts, and fat bodies of 30 female adult citrus psyllids on day 8 after emergence. The samples were ground in liquid nitrogen and total RNA was extracted using TRIzol lysis buffer (Takara, catalog number 9109).

[0026] 3. Synthesis of cDNA first strand: The first strand template for quantitative PCR was reverse transcribed using the PrimeScript™ RT reagent Kit with gDNA Eraser (Takara, catalog number RR047A). 1000 ngRNA was reverse transcribed into cDNA.

[0027] 4. Quantitative PCR detection: qPCR detection was performed using ChamQ SYBR qPCR Master Mix (Nanjing Novizan Biotechnology Co., Ltd., catalog number Q311), with the above-mentioned cDNA as a template. DcRanGAP_{1} and internal reference genes Actin The primers for quantitative PCR amplification are as follows:

[0028] DcRanGAP_{1} F: 5' CCTAGACGAGTGGTTTCATT 3', SEQ ID NO.1;

[0029] DcRanGAP_{1} R: 5' TCTGTACAACAATCAGTTCCT 3', SEQ ID NO.2;

[0030] Actin F: 5' TGTTCCAACCTTCCTTCCTG 3', SEQ ID NO.3;

[0031] Actin R: 5' GTGTTGGCGTACAGGTCCTT 3', SEQ ID NO.4.

[0032] 5. The results showed that in the ovaries of female citrus psyllids... DcRanGAP_{1} The expression level was significantly higher in the head, midgut, and fat body than in the head, midgut, and fat body. Figure 1 (A in the middle); at the same time DcRanGAP_{1} The expression level of ______ increases with the development of the ovaries of female citrus psyllid adults. Figure 1 (B in the middle).

[0033] Example 2

[0034] 1. Download and obtain Citrus Psyllid. DcRanGAP_{1} The gene sequence, with a length of 2339 bp (its nucleotide sequence is shown in SEQ ID NO.9), has GenBank accession number LOC103513674 and nucleotide sequence number XP_008476744.1. The target gene sequence was selected from conserved regions and major functional regions (and the dsRNA of this gene was designed and synthesized). DcRanGAP_{1} Primers; dsRNA (ds) of the GFP gene was designed using the sequence of the green fluorescent protein (GFP) gene (GenBank accession number: AF324407.1). GFP Primers. The sequences of the primers are shown below.

[0035] ds DcRanGAP_{1} F: 5' gatcactaatacgactcactataggggGCCAAAGTGATTGTAGATGC 3', SEQ ID NO.5;

[0036] ds DcRanGAP_{1} R: 5' gatcactaatacgactcactataggggTAACAATCATGCAGAGCCTT 3', SEQ ID NO.6;

[0037] ds GFP F: 5' gatcactaatacgactcactataggggACTCCAGCAGGACCATGTGATC 3', SEQ ID NO.7;

[0038] dsGFP R: 5' gatcactaatacgactcactataggggACCTGAAGTTCATCTGCACCAC 3', SEQ ID NO.8.

[0039] 2. Using the cDNA from Example 1 as a template, the target fragment was amplified and constructed into a T vector using the primers from step 1. Subsequently, the fragments were transformed, pickled, and cultured. Positive clones were selected and sent to the company for sequencing. Clones with correctly sequenced DNA were stored for later use.

[0040] 3. The preserved bacterial culture was activated by shaking, and plasmids were extracted. The plasmids were then used as templates for subsequent steps.

[0041] 4. Using the plasmid as a template, PCR was performed with forward and reverse primers connected to the T7 promoter at the 5' end to amplify the target gene, obtaining a target gene fragment with T7 promoter sequences connected to both ends, which was then used as a template for dsRNA synthesis.

[0042] 5. According to the T7 in vitro transcription kit (MEGAscript) TM Synthesize double-stranded RNA using the T7 Kit (catalog number AM1334, Invitrogen) as per the instructions.

[0043] Therefore, ds DcRanGAP_{1} (targeted) DcRanGAP_{1} The dsRNA of the gene, whose target region has a nucleotide sequence as shown in SEQ ID NO.10) and ds GFP (The nucleotide sequence of its target region is shown in SEQ ID NO.11).

[0044] Example 3

[0045] 1. Take 30 female citrus psyllids that have emerged on day 8 and place them in a glass tube with one end open. Seal the opening of the glass tube with a layer of glutinous rice paper grafting film. DcRanGAP_{1} The concentration was diluted to 300 ng / μL, and the diluted ds DcRanGAP_{1} The solution was dripped into the center of the membrane, and then sealed with a new layer of glutinous rice paper grafting film to form a feed capsule. A glass tube was wrapped with tin foil (excluding the feeding end) and placed in an indoor artificial climate chamber with an L:D ratio of 14:10, a temperature of 26 ± 1℃, and a RH of 65 ± 5%. The end of the glass tube containing the solution was placed towards the light source. The phototaxis of the citrus psyllid was used to encourage it to pierce and suck the solution from its esophagus. The feeding time was 48 hours. Simultaneously, a feeding ds... GFPFemale citrus psyllids on day 8 after emergence were used as a control. Each treated female citrus psyllid was paired 1:1 with an untreated male and transferred to healthy lemon shoots. The shoots and paired psyllids were covered with a transparent mesh bag (15×20 cm) and placed in an indoor artificial climate chamber with L:D=14:10, 26 ± 1℃, and 65 ± 5% RH. Observations were conducted every 24 hours, and data were recorded. Paired psyllids were then transferred to new shoots to continue laying eggs. The pre-oviposition period, oviposition period, and egg production of each female were recorded until all females died. The experimental results showed that compared with feeding ds GFP Compared with the control group, silence DcRanGAP_{1} The pre-oviposition period of citrus psyllids is significantly prolonged ( Figure 2 In A), the spawning period is significantly shortened ( Figure 2 In B), the number of eggs laid decreased significantly ( Figure 2 The C in the text indicates a downward adjustment. DcRanGAP_{1} The expression of this substance can significantly inhibit the reproduction of female citrus psyllids.

[0046] 2. Take 30 female citrus psyllids that have emerged on day 8 and place them in a glass tube with one end open. Seal the opening of the glass tube with a layer of glutinous rice paper grafting film. DcRanGAP_{1} The concentration was diluted to 300 ng / μL, and the diluted ds DcRanGAP_{1} The solution was dripped into the center of the membrane, and then sealed with a new layer of glutinous rice paper grafting film to form a feed capsule. A glass tube was wrapped with tin foil (excluding the feeding end) and placed in an indoor artificial climate chamber with an L:D ratio of 14:10, a temperature of 26 ± 1℃, and a RH of 65 ± 5%. The end of the glass tube containing the solution was placed towards the light source. The phototaxis of the citrus psyllid was used to encourage it to pierce and suck the solution from its esophagus. The feeding time was 48 hours. Simultaneously, a feeding ds... GFP Female citrus psyllids on day 8 after emergence were used as a control. The ovaries of the female citrus psyllids were dissected 48 hours later to observe their development. The results showed that, compared with those fed ds... GFP Compared with the control group, silence DcRanGAP_{1} Citrus psyllid ovarian development is delayed ( Figure 3 ),show DcRanGAP_{1} It can regulate the ovarian development of citrus psyllids.

[0047] Example 4

[0048] Using fluorescence in situ hybridization (FISH), fluorescently labeled nucleic acid probes are mixed with... CLas (GenBank login number is L22532.1) or DcRanGAP_{1} The gene sequence was specifically bound, and the fluorescence signal was detected under a confocal microscope to determine... C Las and DcRanGAP_{1} Location and titer for feeding dsGFP As a contrast. With C The nucleotide sequence of the nucleic acid probe that specifically binds to the Las gene is shown in SEQ ID NO.12. DcRanGAP_{1} The nucleotide sequence of the gene-specific binding nucleic acid probe is shown in SEQ ID NO.13.

[0049] The specific steps of fluorescence in situ hybridization technology are as follows:

[0050] a. Dissection yielded dsRNA (dsRNA) that had been fed 300 ng / μL for 48 h. DcRanGAP_{1} or ds F The ovaries of female psyllids (10 complete ovaries were obtained from each, repeated 3 times) were placed in 1.5 mL enzyme-free centrifuge tubes containing Carnoy's fixative (by volume, glacial acetic acid: anhydrous ethanol: chloroform = 1:3:6) and fixed at 4°C in the dark for 48 h.

[0051] b. Use a pipette to aspirate as much Carnos fixative as possible, add 1 mL of 50% ethanol solution to rinse the ovary for 5 min, repeat 3 times to ensure that the Carnos fixative is completely removed;

[0052] c. Remove the ethanol solution from the tube, then add 6% hydrogen peroxide ethanol decolorizing solution, let it stand at room temperature in the dark until completely decolorized, and then remove the decolorizing solution.

[0053] d. Add 1 mL of PBST and rinse for 10 min, repeat 3 times;

[0054] e. Aspirate PBST, add 500 µL of hybridization buffer without fluorescent probe, let stand for 5 min, repeat 3 times, remove the hybridization buffer without fluorescent probe, add hybridization buffer containing 10 pmol / ml fluorescent probe, and let stand at room temperature in the dark for 12 h.

[0055] f. Remove the hybridization buffer containing 10 pmol / ml fluorescent probe, then rinse with PBST for 10 min, repeat 4 times, remove the PBST, add hybridization buffer containing 0.1 mg / mL DAPI, and let stand at room temperature in the dark for 30 min.

[0056] g. Aspirate the hybridization buffer containing 0.1 mg / mL DAPI, rinse 3 times with PBST for 10 min each time, aspirate the ovary and place it on a glass slide, adjust the position of the ovary, mount the slide, and detect the fluorescence signal under a confocal microscope.

[0057] The results showed that silence GFP It can reduce the titer of Huanglongbing bacteria and DcRanGAP_{1} Gene expression level ( DcRanGAP_{1} Figure 4 Note: There seems to be a formatting issue in the original text where some tags might be missing closing brackets or have incorrect capitalization. I've made assumptions to correct them as best as possible for the translation. Also, the "DcRanGAP1" has been translated as "DcRanGAP_{1}" to follow a more standard naming convention in scientific texts. If there are specific requirements regarding these, please let me know. ).

Claims

1. down-regulation DcRanGAP1 application of the expression of a gene in the inhibition of reproduction of citrus psyllids, characterized in that, The aforementioned DcRanGAP1 The nucleotide sequence of the gene is shown in SEQ ID NO. 9; the downregulation described DcRanGAP1 Gene expression is achieved through targeted feeding. DcRanGAP1 The target is achieved through the dsRNA of the gene. DcRanGAP1 The nucleotide sequence of the target region of the gene's dsRNA is shown in SEQ ID NO.

10.

2. Use according to claim 1, characterized in that, The inhibition of reproduction of the citrus psyllid is to prolong the pre-oviposition period of the female citrus psyllid, shorten the oviposition period of the citrus psyllid, reduce the oviposition amount of the female citrus psyllid, inhibit the ovary development of the female citrus psyllid, or reduce the HLB virus titer in the ovary of the female citrus psyllid.

3. Use according to claim 1, characterized in that, The targeting DcRanGAP1 The concentration of the dsRNA of the gene is 300 ng / μL.

4. A dsRNA targeting the gene of claim 1, characterized in that, DcRanGAP1 the gene of claim 1, characterized in that, The nucleotide sequence of the target region thereof is shown as SEQ ID NO. 10, for preparing a dsRNA targeting DcRanGAP1 The nucleotide sequence of the upstream primer of the primer pair for preparing a dsRNA targeting the gene is shown as SEQ ID NO.

5. DcRanGAP1 The nucleotide sequence of the downstream primer of the primer pair for preparing a dsRNA targeting the gene is shown as SEQ ID NO.

6.

5. A formulation for controlling Diaphorina citri, characterized by, The dsRNA containing the targeting DcRanGAP1 gene of claim 4 is the active ingredient.

6. The use of the preparation of claim 5 in the prevention and treatment of citrus psyllids.

7. Use according to claim 6, characterized in that, comprising the following steps: feeding the citrus psyllid with the preparation.

8. Use according to claim 6, characterized in that The target in the formulation described DcRanGAP1 The concentration of the dsRNA of the gene is 300 ng / μL.

Citation Information

Patent Citations

  • Medicament for controlling liberobacter asiaticum and preparing method thereof

    CN105766987A

  • Application of diaphorina citri insulin-like polypeptide gene DcILP1 in prevention and treatment of diaphorina citri

    CN114456249A