DsOMT011 gene of dactylicapnos scandens O-methyltransferase and application thereof

Abstract

The invention relates to a dactylicapnos root O-methyltransferase DsOMT011 gene and application thereof, and belongs to the technical field of biology. The nucleotide sequence of the dactylicapnos root O-methyltransferase DsOMT011 gene is shown as SEQ ID NO.1, the amino acid sequence of the encoded protein is shown as SEQ ID NO.2, and the dactylicapnos root O-methyltransferase DsOMT011 gene can be used for preparing palmatine. According to the invention, a synthetic pathway and gene family evolution of the dactylicapnos alkaloid are accurately analyzed in basic research; in application and development, accurate targets are provided for directional synthesis of high-value components and innovative breeding; and finally, the dactylicapnos scandens is promoted to be upgraded from experiential medicinal use to molecular regulation and accurate utilization, which is a value which is difficult to cover in the prior art.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of biotechnology, and particularly relates to a Dactylicapnos scandens O-methyltransferase DsOMT011 gene and application thereof. BACKGROUND

[0002] Dactylicapnos plants of Papaveraceae are distributed in the Himalayan region to western China, and there are 7 species in the world, 4 of which are distributed in southwestern China, namely D.scandens, D.torulosa, D.roylei and D.lichiangensis. Dactylicapnos is also known as Chuanzhi Lian, Pea Seven, Pea Bruise, and is called "Zijianlun" in Bai language. It has a light smell and a bitter taste, and is cold in nature. The roots are used as medicine. As a traditional Bai medicine in China, Dactylicapnos is commonly used in folk to treat various pains, high blood pressure, sprains and other diseases. With the continuous research on the active ingredients of Dactylicapnos plants, various skeletal structures such as steroids, phenolic acids, alkanes, fatty acids and alkaloids have been isolated from the plant, among which isoquinoline alkaloids are the main ones. This kind of component has significant anti-inflammatory, antibacterial, anti-arrhythmia, anti-platelet aggregation, analgesic, smooth muscle relaxing effects, etc.

[0003] Palmatine, also known as palmatine, is a kind of isoquinoline alkaloid, which exists in many plants and has certain medicinal value and chemical properties. It belongs to the protoberberine type alkaloid, has a basic mother nucleus structure composed of five rings, contains an isoquinoline ring, and is connected with methoxy and other substituents on the mother nucleus. The structure of palmatine has certain polarity, and because the nitrogen atom has a positive charge, it often exists in the form of salt, such as palmatine hydrochloride.

[0004] At present, the source of palmatine is mainly extracted from plants. This acquisition method is easily limited by plants. To break this limitation, the current hot synthetic biology becomes the first choice. However, to produce palmatine by synthetic biology, it is necessary to analyze the synthesis path of palmatine first. Only when the synthesis path is known and the corresponding enzyme is found, can palmatine be produced by microbial factory through synthetic biology. After analyzing the synthesis path, the mechanism of synthesizing palmatine can be understood, which can provide a reference for the research of plant chassis.

[0005] Therefore, how to overcome the shortcomings of the prior art is a problem that needs to be solved in the field of biotechnology at present. SUMMARY

[0006] The present application aims at solving the problems of the prior art, and provides a purple golden dragon O-methyltransferase DsOMT011 gene and application thereof.

[0007] To achieve the above object, the present application adopts the following technical solutions: The present application provides a purple golden dragon O-methyltransferase DsOMT011 gene in the first aspect, and the nucleotide sequence of the purple golden dragon O-methyltransferase DsOMT011 gene is shown as SEQ ID NO. 1.

[0008] The present application provides a coding protein of the purple golden dragon O-methyltransferase DsOMT011 gene in the second aspect, and the amino acid sequence of the coding protein is shown as SEQ ID NO. 2.

[0009] The present application provides a recombinant plasmid of the purple golden dragon O-methyltransferase DsOMT011 gene in the third aspect.

[0010] Further, the purple golden dragon O-methyltransferase DsOMT011 gene is homologously recombined with a pET28a vector to obtain a pET28a-DsOMT011 recombinant plasmid.

[0011] The present application provides a transgenic engineering bacterium containing the above-mentioned recombinant plasmid or the exogenous purple golden dragon O-methyltransferase DsOMT011 gene integrated in the genome of the engineering bacterium in the fourth aspect.

[0012] Further, the transgenic engineering bacterium is an Escherichia coli BL21 (DE3).

[0013] The present application provides an application of the purple golden dragon O-methyltransferase DsOMT011 gene in the preparation of palmatine in the fifth aspect.

[0014] Further, the palmatine is generated from the African coccodendrine and a methyl donor SAM under the catalysis of the purple golden dragon O-methyltransferase DsOMT011 gene.

[0015] The present application provides a purple golden dragon O-methyltransferase DsOMT011 gene, which can be used as a palmatine biosynthesis regulation gene and applied to the preparation of the purple golden dragon secondary metabolite palmatine. The nucleotide sequence of the purple golden dragon O-methyltransferase DsOMT011 gene is shown as SEQ ID NO. 1, and the sequence has a total length of 1050 bp. The protein encoded by the purple golden dragon O-methyltransferase DsOMT011 gene has a sequence shown as SEQ ID NO. 2, and encodes 350 amino acid residues.

[0016] The purple golden dragon O-methyltransferase DsOMT011 gene is identified from fresh roots, stems and leaves of the purple golden dragon through transcriptome sequencing and bioinformatics technology after a large number of experiments; the RNA of the roots, stems and leaves of the purple golden dragon is extracted by using an RNA reagent, and then the cDNA is reversely converted and subjected to PCR amplification to obtain the purple golden dragon O-methyltransferase DsOMT011 gene. DsOMT011-5'F: cagcaaatgggtcgcggatccatggaagtgaagaatagtgctgatc DsOMT011-3'R: cgacggagctcgaattcggatccttaataagtataagcctcgataacag Finally, the pET-28a-DsOMT011 recombinant vector is transformed into the E.coli BL21 (DE3) competent cell, and a detection primer is used to detect whether the vector is successfully transformed, and the detection primer is as follows: JC-5'F: ccgcgaaattaatacgactcactatagg JC-3'R: ccgtttagaggccccaagg Compared with the prior art, the present application has the following beneficial effects: The DsOMT011 gene is accurately positioned to the methylation step of specific alkaloid synthesis of the purple golden dragon, and fills the blank of the precise correlation of “gene-enzyme-reaction” in the metabolic pathway. The identification of the DsOMT011 gene assists in breeding the purple golden dragon varieties with high alkaloids and specific component enrichment, and shortens the breeding cycle, which cannot be achieved by the prior art (lack of precise correlation of gene-traits). The present application fills the gap in the evolution research of the purple golden dragon gene family, which cannot be provided by the prior art (not focusing on the specific genes of the purple golden dragon). The purple golden dragon O-methyltransferase DsOMT011 gene isolated and identified from the purple golden dragon can be used as an important marker gene for molecular assisted breeding of the purple golden dragon, and also can be used as an important candidate gene for the production of palmatine in the yeast chassis cell construction. The prior art may rely on expensive instruments and a large amount of reagent consumption, and the cost of each gene isolation and identification is high. The present application can reduce the cost by optimizing the experimental process, using more economical reagents and consumables, so that the gene isolation and identification has higher cost performance, and is beneficial to popularization and application in more laboratories. BRIEF DESCRIPTION OF DRAWINGS

[0017] Figure 1 LC-MS analysis of the DsOMT011 enzyme activity reaction; wherein, A is the mass spectrum of the standard palmatine; B is the mass spectrum of the palmatine generated by the enzyme activity reaction of DsOMT011. Figure 2 The results are HPLC analysis of the DsOMT011 enzyme activity reaction; where 1 is tetrandrine, 2 is palmatine; CK is the control group, DsOMT011 is the experimental group, and standard is the standard palmatine. Figure 3 The biosynthetic pathway of palmatine based on the functional construction of DsOMT011; Figure 4 This is a schematic diagram illustrating the construction of the recombinant plasmid pET28a-DsOMT011; Figure 5 This is an SDS-PAGE protein electrophoresis image of Zijinlong O-methyltransferase DsOMT011. Lane M is the protein marker electrophoresis band, and lanes 1, 2 and 3 are DsOMT011 protein electrophoresis bands eluted with 200mM imidazole. Detailed Implementation

[0018] The present invention will now be described in further detail with reference to the embodiments.

[0019] Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be construed as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed in accordance with the techniques or conditions described in the literature in the field or according to the product instructions. Materials or equipment whose manufacturers are not specified are all conventional products that can be obtained by purchase.

[0020] Example 1 Candidate genes related to the palmatine biosynthesis pathway were identified by searching transcriptome data and KEGG protein database annotations using local BLAST. FPKM values ​​were then used to perform differential expression analysis on these genes, and heatmaps of differential gene expression levels were created using TBtool. The expression levels of related genes in the roots, stems, and leaves of *Gynostemma pentaphyllum* were compared. The candidate gene DsOMT011 was functionally identified using the online tool ORF Finder (http: / / www.ncbi.nlm.nih.gov / gorf / gorf.html), which identifies its open reading frames (ORFs) and amino acid sequences. Amino acid sequences of OMT genes from other species were downloaded from existing databases and aligned with the candidate gene DsOMT011 using ClustalW. A phylogenetic tree was constructed using MEGA-X with default parameters and the neighbor-joining method. Then, cDNA preparation, amplification and recovery of the candidate gene DsOMT011, and homologous recombination of the pET-28a digestion vector with the target gene DsOMT011 were performed. Figure 4), pET-28a-DsOMT011 recombinant vector transformed into E. coli BL21 (DE3) competent cells, protein expression ( Figure 5 After a series of procedures including in vitro enzyme activity testing and LC / MS detection, the enzyme that catalyzes the reaction of tetrahydrotetra ... (1) Preparation of cDNA template Fresh roots, stems, and leaves of *Gynostemma pentaphyllum* were collected, sliced, and flash-frozen in liquid nitrogen for RNA extraction. Total RNA was extracted using the HiPure HP Plant RNA Mini Kit from Guangzhou Meiji Biotechnology Co., Ltd. RNA was extracted according to the kit's instructions. After passing quality tests, the RNA was reverse transcribed into cDNA using the TAKARA reverse transcription kit and stored at -20ºC for later use.

[0021] (2) Gene amplification and recovery The ORFs (open reading frames) of 18 candidate genes for DsOMT from *Zijinlong* were identified using NCBI online software (https: / / www.ncbi.nlm.nih.gov / orffinder). Then, specific primers for the full-length coding region of the gene were designed using SnapGene software. The designed primers for the DsOMT011 gene contained homologous arms of the *E. coli* expression vector pET28a. The upstream primer for cloning the DsOMT011 gene was DsOMT011-5'F: cagcaaatgggtcgcggatccatggaagtgaagaatagtgctgatc (SEQ ID NO.3); the downstream primer was DsOMT011-3'R: cgacggagctcgaattcggatccttaataagtataagcctcgataacag (SEQ ID NO.4). Using the cDNA obtained from reverse transcription as a template, gene amplification was performed using DNA polymerase (phanta enzyme). The amplification system consisted of: 2 μL cDNA, 25 μL 2×phantaMax Master mix, 2 μL each of forward and reverse primers (0.2 μM), and ddH2O to a final volume of 50 μL. The amplification cycle was: 95ºC for 3 min; 95ºC for 15 s, 55ºC for 15 s, 72ºC for 1 min, for 40 cycles; 72ºC for 5 min. After the PCR amplification program, the amplified gene band was checked for consistency with the target gene band using 1% agarose gel electrophoresis.

[0022] If the lengths are similar, the target gene (i.e., the DsOMT011 target gene) can be recovered using a GenStar kit, and the recovery concentration can be determined in NanoDrop2000. Finally, it can be stored in a -20°C freezer.

[0023] (3) Construction and identification of gene recombination vectors A. Vector Linearization: DH5α bacteria containing the empty pET-28a vector were amplified and the plasmid extracted. The plasmid was digested with BamHI enzyme and purified using a kit to obtain the linearized pET-28a vector, which was stored at -20℃ for later use. The digestion system consisted of 2 μL of pET28a vector (1 μg / μL), 2 μL of 10×Buffer solution, 2 μL of BamHI enzyme, and ddH2O to a final volume of 20 μL. The vector was incubated at 37℃ for 1 hour using a PCR instrument. The pET28a vector was purified and recovered using the Omega EZNA® Cycle Pure Kit, and its concentration was determined before storage at -20℃ for later use.

[0024] B. Gene recombination: LB liquid medium (1L): Weigh 10g tryptone, 5g yeast extract, and 10g sodium chloride, add 950 mL deionized water to dissolve, adjust the pH to 7.0 with 5 M NaOH solution, and bring the volume to 1L with deionized water. Sterilize by steaming at 121℃ for 20 min.

[0025] LB solid medium (1L): Add 15g of agar powder to LB liquid medium (1L) and autoclave at 121℃ for 15 min.

[0026] LB resistance plates: Add 15g of agar powder to 1L of LB liquid medium and autoclave at 121℃ for 15min. Once the medium temperature has cooled to approximately 55℃, add 1mL of filtered, sterilized kanamycin solution (100 mg / mL), mix well, and pour onto a plate. Store at 4℃.

[0027] The DsOMT011 target gene, amplified using a ready-to-use seamless cloning enzyme kit from Sangon Biotech (Shanghai) Co., Ltd., was ligated into a linearized pET-28a vector. Homologous recombination ligation was performed according to the homologous recombinase instructions. The partition ratio of each group was calculated based on the concentrations of the linearized pET-28a vector and the DsOMT011 target gene, with a DNA molar ratio of linearized pET-28a vector to DsOMT011 target gene of 1.5:1. The total transformation reaction volume was 5 μL, including 2.5 μL of ligase. All components were added to PCR tubes and gently mixed with a pipette. The tubes were incubated at 50°C for 30 min to obtain the pET-28a-DsOMT011 recombinant vector. The transformed strain was E. coli BL21(DE3) competent cells, primarily used for introducing the constructed recombinant vector (containing the target gene) into cells. These competent cells can efficiently take up exogenous DNA and are widely used for the induction of recombinant protein expression. Remove BL21(DE3) competent cells from the -80℃ freezer and thaw on ice at 4℃. Pipette 5 μL of the pET-28a-DsOMT011 recombinant vector plasmid into a 1.5 mL centrifuge tube, add 50 μL of BL21(DE3) competent cells, and gently mix by pipetting. Incubate on ice at 4℃ for 30 min, then heat-shock in a 42℃ metal bath for 45 s, and then incubate on ice at 4℃ for 2 min. Add 200 μL of LB liquid medium to a clean bench and incubate on a shaker at 37℃ for 1 h. Spread 150 μL of the medium onto an LB agar plate, seal with sealing film, and incubate overnight at 37℃ in an E. coli incubator.

[0028] C. Bacterial water detection: On a clean bench, eight colonies of uniform size were randomly selected from the LB resistant plate cultured overnight in (3) and placed in 20 μL of ddH2O. For each of the eight colonies, 3 μL was taken for PCR amplification. Each colony corresponded to one PCR tube to detect whether the pET-28a-DsOMT011 recombinant vector was successfully transformed into Escherichia coli BL21 (DE3). The upstream primer (0.2 μM) was JC-5'F: ccgcgaaattaatacgactcactatagg (SEQ ID NO.5), and the downstream primer (0.2 μM) was JC-3'R: ccgtttagaggccccaagg (SEQ ID NO.6). The PCR reaction system used was 2× Taq Master from Nanjing Novizan Biotechnology Co., Ltd. The reaction system consisted of: 0.5 μL of upstream primer (0.2 μmol / μL), 0.5 μL of downstream primer (0.2 μmol / μL), 12.5 μL of 2×TaqMaster Mix enzyme, and ddH2O to a final volume of 25 μL. The PCR amplification program was as follows: 95℃ for 3 min; 95℃ for 30 s, 55℃ for 15 s, 72℃ for 1 min, 35 cycles; 72℃ for 5 min. After the reaction, the length of the PCR products was determined using 1% agarose gel.

[0029] If the length of the PCR product is within 1500 bp of the target fragment, it is considered positive, indicating successful assembly and ready for sequencing. After successful sequencing, the product is stored in a 1:1 volume ratio of 50% glycerol to E. coli BL21(DE3) positive bacterial culture successfully transformed with the pET-28a-DsOMT011 recombinant vector.

[0030] (4) Protein expression and purification of candidate gene DsOMT011 Protein expression: Take the bacterial culture preserved in (3) and revive it at 37℃ and 220r / min. After the bacterial culture is fully turbid, take 3mL of bacterial culture and inoculate it into 500mL of LB liquid medium containing 100μg / mL kanamycin. When the OD value of the bacterial culture increases to the range of 0.6-0.8, add 1mM IPTG (isopropyl-β-D-thiogalactoside) and induce protein expression at 16℃ for 12-14h.

[0031] Protein purification: After induction of expression, bacterial cells were collected by centrifugation at 4°C and 5000 rpm / min for 20 min using a large high-speed refrigerated centrifuge. The cells were resuspended in 20 mL of Tris-HCl (pH=7.5) buffer containing 50 mM Tris and 200 mM NaCl. After resuspending, the cells were disrupted 1-2 times using a high-pressure cryogenic homogenizer (Guangzhou Juneng Biotechnology Co., Ltd.) at 1000 bar and 4°C. Then, the cells were centrifuged at 4°C and 12000 rpm / min for 30 min. The supernatant was loaded onto a Ni-NTA agarose affinity column and eluted with different concentrations of imidazole in sequence from low to high (20 mM, 50 mM, 60 mM, 200 mM). Each concentration was eluted once with 50 mL of the solution, and the filtrate was collected. The next concentration was then eluted.

[0032] (5) Enzyme activity reaction The in vitro enzyme activity reaction was carried out in a 200 μL mixed system: the experimental group was given 100 μL of purified protein obtained in (4) eluted with 50 mmol / L Tris-HCl (pH=8.0), 6 μL of methyl donor SAM (100 mmol / L), and 3 μL of substrate tetrandrine (100 mmol / L); the control group was given 100 μL of purified protein eluted with 200 mM imidazole obtained in (4) eluted with 50 mmol / L Tris-HCl (pH=7.5), and incubated at 98 °C for 5 min. This incubation was to inactivate the control group protein, so that it would lose its affinity for the substrate tetrandrine (e.g., 100 μL of purified protein eluted with 200 mM imidazole). Figure 3 To assess the catalytic activity of compound 1), after cooling, 6 μL of 100 mmol / L methyl donor SAM and 3 μL of 100 mmol / L substrate tetrandrine were added. The experimental and control groups were incubated overnight at 37°C and 200 r / min. After inactivation with 200 μL of analytical methanol, the mixture was centrifuged at 12000 r / min for 10 min, and the supernatant was filtered for liquid chromatography analysis. Finally, the reaction products were analyzed by LC-MS.

[0033] (6) Product testing The LC-MS detection conditions are as follows: The detection was performed using an Agilent 1290 UPLC / 6540 Q-TOF liquid chromatography-mass spectrometry (LC / MS) system: Mass spectrometry conditions: negative ion source, voltage: 3500 V; fragmentation voltage: 135 V; cone voltage: 60 V; radio frequency voltage: 750 V; scan range: 100-1000 m / z; scan mode: SRM.

[0034] Chromatographic conditions: Agilent Extend-C18 column (250 mm × 4.6 mm, 5 μm), column temperature: 30℃, mobile phase for product determination: acetonitrile (A)-water (B), gradient elution: 0-25 min, 10%-30% acetonitrile; 25-28 min, 30%-90% acetonitrile; 28-33 min, 90%-30% acetonitrile. A linear change was observed during gradient elution. Elution time: 33 min; injection volume: 10 μL; flow rate: 0.4 mL / min; detection wavelength: 282 nm.

[0035] LC-MS detection results: From Figure 2 From the HPLC chromatogram, the enzyme activity reaction of DsOMT011 produced one peak, which had the same time peak as the standard palmatine. Figure 1 According to the mass spectrometry data, the molecular weight of one peak generated by the enzymatic activity of DsOMT011 is consistent with that of the standard palmatine, both being 353. This means that the enzymatic activity of DsOMT011 catalyzes the C-2 methylation of tetrandrine to generate palmatine.

[0036] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.

Claims

1. The *Zijinlong* O-methyltransferase DsOMT011 gene, characterized in that, The nucleotide sequence of the Zijinlong O-methyltransferase DsOMT011 gene is shown in SEQ ID NO.

1.

2. The protein encoded by the *Gynostemma pentaphyllum* O-methyltransferase DsOMT011 gene according to claim 1, characterized in that, The amino acid sequence of the encoded protein is shown in SEQ ID NO.

2.

3. A recombinant plasmid containing the *Zijinlong* O-methyltransferase DsOMT011 gene as described in claim 1.

4. The recombinant plasmid containing the *Gynostemma pentaphyllum* O-methyltransferase DsOMT011 gene according to claim 3, characterized in that, The DsOMT011 gene of Zijinlong O-methyltransferase was homologously recombined with the pET28a vector to obtain the pET28a-DsOMT011 recombinant plasmid.

5. A transgenic engineered bacterium containing the recombinant plasmid of claim 1, or wherein the genome of the transgenic engineered bacterium is integrated with an exogenous *Zijinlong* O-methyltransferase DsOMT011 gene of claim 1.

6. The genetically engineered bacteria according to claim 5, characterized in that, The genetically engineered bacteria is Escherichia coli BL21(DE3).

7. The use of the Zijinlong O-methyltransferase DsOMT011 gene as described in claim 1 in the preparation of palmatine.

8. The application of the *Purple Dragon O-methyltransferase* DsOMT011 gene according to claim 7 in the preparation of palmatine, characterized in that: Palmatine was produced using tetrandrine and methyl donor SAM as raw materials, catalyzed by the O-methyltransferase of Zijinlong, encoded by the aforementioned Zijinlong O-methyltransferase DsOMT011 gene.

Images