Method for creating aphid and thrip resistant cotton with specific low gossypol content in seeds

Abstract

The invention relates to the technical field of plant genetic engineering and crop breeding, in particular to a method for creating specific low-gossypol-content cotton resistant to aphids and thrips, a cis-regulatory element site for regulating seed gland and plant epidermal hair development is identified through epidermal regulatory omics analysis, and a cis-regulatory element site for regulating seed gland and plant epidermal hair development is established by adopting a CRISPR / Cas9 genome editing technology. The cis-regulation element site is directionally deleted or edited and modified, a cotton material with extremely low gossypol content in seeds and normal gossypol content in stalks and leaves can be created, and meanwhile, the epidermal hair density of plants is remarkably improved, so that the plants show relatively strong aphid and thrip resistance. The cis-regulation site has the function of specifically regulating seed gland and plant epidermal hair development, provides a new site for creation and breeding improvement of insect-resistant and low-phenol cotton materials, and can be used for creation of insect-resistant low-phenol new materials or genetic improvement of existing materials after gene editing. Good breeding utilization and market development prospects are realized.

Description

Technical Field

[0001] This invention relates to the fields of plant genetic engineering and crop breeding technology, and in particular to a method for creating cotton that is resistant to aphids and thrips and has seed-specific low gossypol content. Background Technology

[0002] Cotton, as a globally important economic crop, possesses both natural fiber supply and high oil and protein seed resource value. However, the toxicity of gossypol accumulated in its seeds severely limits their safe use in food and feed. Meanwhile, gossypol plays a crucial defense role in vegetative tissues such as stems and leaves. Traditional low-gossypol cotton suffers from a significant decrease in insect resistance due to reduced overall gossypol levels, making it difficult to balance economic value with safe resource utilization. Research indicates that the biosynthesis and storage of gossypol occur in pigment glands, and its formation is precisely regulated by key genes such as Gossypium Pigment Gland Formation (GoPGF). Modern biotechnology, particularly genome editing tools like CRISPR / Cas9, has made it possible to achieve tissue-specific regulation of gossypol accumulation. By intervening in the expression of genes such as GoPGF, it is possible to specifically reduce the gossypol content in seeds while preserving gossypol in the plant's vegetative tissues (stems and leaves) to maintain insect resistance, thereby creating ideal materials where "the plant has glands, but the seeds have no or low glands." Furthermore, cotton's resistance to piercing-sucking pests such as aphids is closely related to morphological characteristics such as the density of epidermal hairs on the plant. Regulating gossypol glands while simultaneously and appropriately adjusting the density of epidermal hairs on the plant may confer new physical insect-resistant properties to cotton without relying on exogenous insecticidal genes.

[0003] Therefore, the purpose of this invention is to overcome the shortcomings of the prior art and provide a new cotton germplasm that achieves ultra-low accumulation of gossypol in seeds without affecting the overall insect resistance of the plant by precisely editing specific cis-regulatory elements, and simultaneously enhances its resistance to pests such as aphids and thrips, thus providing core materials for the development of cotton as a "dual-purpose" crop for cotton, grain, and feed. Summary of the Invention

[0004] The purpose of this invention is to provide a method for creating cotton plants resistant to aphids and thrips and with seed-specific low gossypol content. This method primarily involves identifying specific cis-regulatory elements and genetically editing them to simultaneously improve the development of cotton glands and epidermal hairs without affecting other agronomic traits of the plant. This method is feasible and can be used to create new insect-resistant, low-gossypol materials or for the genetic improvement of existing materials, demonstrating significant application potential.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] A method for creating cotton resistant to aphids and thrips and with seed-specific low gossypol content involves identifying a cis-regulatory element site and using CRISPR / Cas9 genome editing technology to directionally delete or partially edit this cis-regulatory element sequence. This method can create cotton materials with significantly increased epidermal hair density and reduced seed glands, resulting in low gossypol content. Therefore, the creation of cotton materials involving gland, gossypol development, and epidermal hair development through editing or modification of this cis-regulatory element sequence is within the scope of this invention and falls under the protection of this invention.

[0007] Preferably, a high-precision cotton transcriptional regulatory omics map is constructed using epigenetic regulatory omics DNase-seq or ATAC-seq technology; and a cis-regulatory element search is performed on important genes involved in cotton gland development and gossypol synthesis to obtain a potential regulatory site around the key gland development regulatory gene GoPGF, the sequence of which is shown in SEQ ID NO.1.

[0008] SEQ ID NO.1:

[0009] GAAAGCTTTTCTTTTCTTTGGTCATTGTGATCGACTGCCGCTGGTACTATTTTTTGG

[0010] CTGAAAAAAAATTAACTTTTTAGTAGTATTTTATTAAAAAAATAATAATTAGATTTT

[0011] TTTTATCAAATTTAACACTTGTGAAAAAGACTAAATTTAACTAATAAGAAAAATAAT

[0012] GGCCAAAATGATAAAAAAAAATAGAGATTAAGGGCTGAATTTGTGATTACACCATC

[0013] ATTAAATATAGATTATCTTCTTGCACAATGGGCTTACTGGACCCAATTCCCATACTAA

[0014] AAGAAAATAAAAATTGGAGCGACTGACCCAATTCCCAAATGGCATCTTAATTGAAC

[0015] ATTGTAGGCCTAATAAAACATTCTCTCTCGCTTTTTCATTATATTAATATTCTAATATTC

[0016] CATTTAAGACTTAAATTTGAAAAAAAAAAATTATTGTGTTGAGCTTAATGTTCATAC

[0017] AGCTAGCAATTGTTAGGTCGATATAATTCACCAACCTTAATAAGGCGTGCAGATTTA

[0018] ATTTTTAATCTACAAAATTTCTAAGTTAGCTAACATTTCTGCCAATAAACAGTTACC

[0019] CATTTCAATGGTTTTTCTTCCCAAAAAC

[0020] Among them, CRISPR / Cas9 genome editing technology was used to edit genes at regulatory element sites.

[0021] Preferably, the designed gRNA sequences are shown in SEQ ID NO.2 and SEQ ID NO.3, and SEQ ID NO.4 and SEQ ID NO.5, respectively.

[0022] Among them, SEQ ID NO.2: 5'-TCATTGTGATCGACTGCCGCTGG-3'

[0023] SEQ ID NO.3: 5'-TTAACTAATAAGAAAAATAATGG-3'

[0024] SEQ ID NO.4: 5'-CGACTGACCCAATTCCCAAATGG-3'

[0025] SEQ ID NO.5: 5'-TCATACAGCTAGCAATTGTTAGG-3'

[0026] Preferably, the CRISPR / Cas9 genome editing vector containing the designed gRNA sequence is used for genetic transformation of cotton, and offspring with site editing, dense epidermal hairs, and few or no glands in the seeds are identified and screened.

[0027] A novel molecular breeding method, as described above, for creating insect-resistant seeds with low gossypol content.

[0028] Among them, due to the function of the identified cis-regulatory element, and because the sequence exhibits certain variations across different cotton genomes, therefore:

[0029] 1. The sequence of the cis-regulatory element described in this invention may have a few base differences among different cotton species or plants, and these differences are all within the scope of this invention.

[0030] 2. Targeted deletion of all or part of the sequence of the cis-regulatory element described in this invention, as well as editing and altering part of its sequence, can create cotton materials with significantly increased epidermal hair density and low seed phenol content. Therefore, the creation of cotton materials involving gland, gossypol development, and epidermal hair development through editing or modification of this cis-regulatory element sequence falls within the scope of this invention.

[0031] In addition to the gRNA described in this invention, all gRNAs designed for gene editing targeting the cis-regulatory elements described in this invention are also part of this invention.

[0032] In addition to creating new insect-resistant low-phenol materials as described in this patent, the method of this invention can also be directly used for the genetic improvement of existing materials or varieties, and these all fall within the application scope of the technical method of this invention.

[0033] By employing the above-mentioned technical approach—through epigenetics analysis—a cis-regulatory element locus was identified that controls the development of seed glands and plant epidermal hairs. Using CRISPR / Cas9 genome editing technology, this cis-regulatory element locus was specifically deleted or edited, resulting in cotton materials with extremely low gossypol content in seeds but normal gossypol content in stems and leaves. Simultaneously, the density of plant epidermal hairs was significantly increased, leading to stronger resistance to aphids and thrips. This cis-regulatory locus specifically regulates the development of seed glands and plant epidermal hairs, providing a new site for the creation and breeding improvement of insect-resistant and low-phenol cotton materials. After gene editing, it can be used to create new insect-resistant, low-phenol materials or for the genetic improvement of existing materials, showing good prospects for breeding utilization and market development.

[0034] Compared with the prior art, the present invention has the following beneficial effects:

[0035] 1. Innovative Strategy for Precise Regulation of Multiple Traits: Unlike conventional gene knockout techniques, this invention expands the editing target from the coding region to key non-coding cis-regulatory elements. By precisely disrupting seed-specific regulatory modules, a new cotton germplasm with "extremely low seed-specific gossypol content while maintaining normal stem and leaf content" was successfully created, and epidermal hair-mediated physical insect resistance was synergistically enhanced. This strategy overcomes the limitation of a single editing step improving only a single trait, providing a novel solution for the synergistic improvement of complex traits.

[0036] 2. Strong potential for breeding applications: Because the editing target is located in the non-coding region, it only fine-tunes the gene expression pattern without destroying its protein function, thus minimizing side effects such as growth defects caused by gene pleiotropy. The obtained materials have a clear genetic background and stable agronomic traits, and can be directly used as core germplasm resources for hybridization breeding, greatly improving breeding efficiency and accelerating the cultivation and promotion of new cotton varieties with independent intellectual property rights. Attached Figure Description

[0037] Figure 1 This image shows the identification of regulatory element sites around GoPGF in this invention. The image shows an open chromatin site (i.e., a cis-regulatory element site, indicated by the dashed box) downstream of GoPGF, present in roots, stems, and leaves. A region shared by different tissues was selected as the core region, and its sequence is shown in SEQ ID NO.1.

[0038] Figure 2 This image shows the editing site detection of the positive homozygous edited plants TM48_1a and TM42_3a in this invention. As shown in the figure, the 45-131bp sequence of TM48_1a is deleted compared to the wild-type TM-1; while TM42_3a has a deletion at 450.

[0039] Figure 3 This is a diagram illustrating the phenotypic identification of the mutants of this invention. The seed glands of the TM48_1a and TM42_3a edit-positive homozygous plants were significantly reduced compared to the wild-type TM-1; at the same time, the epidermal hairs were denser than those of the wild-type TM-1.

[0040] Figure 4 This invention provides a diagram illustrating the plant type and insect resistance of homozygous positive plants.

[0041] A. Edit the positive homozygous plant TM48_1a;

[0042] B. Comparison of aphid resistance;

[0043] C. Thrips resistance comparison. Detailed Implementation

[0044] The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings, so that those skilled in the art can better understand the advantages and features of the present invention, thereby making a clearer definition of the scope of protection of the present invention. The embodiments described in this invention are only some embodiments of the present invention, not all embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0045] Example 1: Construction of a high-precision cotton transcriptional regulatory element map and screening of candidate cis-regulatory elements based on DNase-seq technology

[0046] 1. Take fresh cotton stems, leaves, and root tissues, and extract cell nuclei;

[0047] 2. Place the cell nuclei in a 37°C metal bath, add different amounts of DNase I, incubate at 37°C for 10 min, and perform enzyme digestion.

[0048] 3. After incubation, add 80 μl of 50 mM EDTA to stop the enzymatic digestion reaction and extract a pure DNA sample;

[0049] 4. Take 5 μl of the above DNA sample and perform electrophoresis on a 1% agarose gel to detect the enzyme digestion effect; collect samples in the hypersensitive state of the reaction for subsequent analysis;

[0050] 5. Use the library construction kit to construct libraries from the above candidate enzyme-digested DNA samples and perform high-throughput sequencing at 100x or higher.

[0051] 6. Popera (https: / / github.com / forrestzhang / Popera) was used to identify DHSs, obtain DHS loci of the whole genome in each tissue, and construct a high-precision map of transcriptional regulatory elements.

[0052] 7. A search was conducted on transcriptional regulatory element maps of major genes involved in cotton gland and epidermal hair development (such as GoPGF, GoPGS, HIC, and GhEXPA2) in different tissues. It was found that a large regulatory element site was present around GoPGF in different tissues, such as... Figure 1 As shown in SEQ ID NO.1, this site contains a large number of motifs that can potentially bind to transcription factors, making it a candidate site for gene editing.

[0053] Example 2: CRISPR / Cas9 Gene Editing of Cis-Regulatory Elements 1. Two pairs (four) of specific gRNAs were designed targeting the sequence of this regulatory element, with the following sequences:

[0054] SEQ ID NO.2:5'-TCATTGTGATCGACTGCCGCTGG-3' and

[0055] SEQ ID NO.3:5'-TTAACTAATAAGAAAAATAATGG-3'

[0056] SEQ ID NO.4:5'-CGACTGACCCAATTCCCAAATGG-3' and

[0057] SEQ ID NO.5:5'-TCATACAGCTAGCAATTGTTAGG-3'

[0058] This design aims to induce homologous recombination repair or non-homologous end joining by using paired gRNA vectors to edit double-strand breaks, resulting in large fragment deletions or edits in this functional region.

[0059] 2. The gRNA pairs encoding the above SEQ ID NO.2 and SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5 were constructed into the plant CRISPR / Cas9 editing vectors pgs4151_1 and pgs4151_2 containing the Cas9 protein encoding gene, respectively. The plasmids with correct sequencing results were transformed into Agrobacterium EHA105 by electroporation and identified by PCR.

[0060] 3. Using cotton embryo tips soaked for 1 day as material, place them in a petri dish containing 50 mL of Agrobacterium strain EHA105 carrying pgs4151_1 and pgs4151_2 vectors for infection at room temperature for 30 min. After infection, discard the Agrobacterium suspension, place the explants in a co-culture medium, and co-culture at 23℃ in the dark for 3 days. After co-culture, transfer the embryos to a resting medium and culture in light at 28℃ for 7 days. Then, transfer them to the corresponding resistance selection medium and culture for 6 weeks to induce resistant shoots. Then, transfer them to an elongation medium and culture in light for 3-6 weeks at 28℃, 5000 lx, until rooting occurs, obtaining T0 generation transgenic plants.

[0061] 4. Genomic DNA was extracted from leaves of T0 generation plants, and PCR amplification and sequencing were performed using primers specific to the target sites to identify mutations that resulted in deletions at the target sites. One plant, named TM48_1a, had a 101 bp deletion in the region of SEQ ID NO: 1 (corresponding to positions 45-131 of SEQ ID NO: 1). Another plant, named TM42_3a, had a 1 bp deletion in the region of SEQ ID NO: 1 (corresponding to position 450 of SEQ ID NO: 1). Figure 2 As shown.

[0062] 5. Self-pollinate the above-mentioned positive edited plants and select homozygous positive edited plants.

[0063] Example 3: Mutant Phenotypic Analysis 1. Phenotypic Identification: Phenotypic identification was performed on the edited homozygous plants of TM48_1a and TM42_3a. It was found that the epidermal hair density of both was significantly different from that of the wild-type TM-1, with the edited plants having denser epidermal hairs and the wild-type plants having significantly sparser hairs. Comparison of glands revealed that the number of edited plants in cottonseed was significantly reduced compared to the wild type, but there was no significant difference in the number of leaves and stems. Figure 3).

[0064] 2. Gossypol content was determined in mature cottonseed kernels, leaves, and stems of homozygous edited plants TM48_1a and wild-type TM-1, respectively. Gossypol was extracted from the samples using an acetonitrile-water-phosphate mixed extract, and detected by high-performance liquid chromatography (HPLC). Qualitative analysis was performed using peak retention time, and quantitative analysis was performed using the external standard method. Results showed that the gossypol content in TM48_1a cottonseed kernels was 6.58 mg / g, significantly lower than the 13.15 mg / g in the control group TM-1. Meanwhile, the contents in leaves and stems were 0.79 mg / g and 0.46 mg / g, respectively, showing no significant difference compared to the leaf and stem contents of the control group TM-1 (0.79 mg / g and 0.45 mg / g), successfully achieving seed-specific inhibition of gossypol synthesis.

[0065] 3. Insect Resistance Identification: In a greenhouse, artificial aphid (cotton aphid) inoculation experiments were conducted on homozygous edited plants and the wild-type TM-1 control. 21 days after inoculation, the average aphid count on TM48_1a plants was 5 aphids / plant, while the wild-type was 210 aphids / plant, representing a 97.6% increase in insect resistance. Thrips resistance experiments showed that the average thrips count on TM48_1a plants was 15 thrips / plant, while the wild-type was 105 thrips / plant, representing an 85.7% increase in insect resistance. Figure 4 ).

[0066] In summary, this invention achieves simultaneous improvement of cotton gland and epidermal hair development by identifying specific cis-regulatory elements and editing their genes, without affecting other agronomic traits of the plant. This method is feasible and can be used to create new insect-resistant, low-phenol materials or for the genetic improvement of existing materials, demonstrating good application potential.

[0067] This invention is applicable not only to upland cotton but also to the genetic improvement of other cotton varieties such as Sea Island cotton. The descriptions and practices disclosed herein are readily apparent and understandable to those skilled in the art, and various modifications and refinements can be made without departing from the principles of this invention. Therefore, any modifications or improvements made without departing from the spirit of this invention should also be considered within the scope of protection of this invention.

Claims

1. A method for creating cotton that is resistant to aphids and thrips and has seed-specific low gossypol content, characterized in that, By identifying a cis-regulatory element site and using CRISPR / Cas9 genome editing technology to selectively delete the sequence of this cis-regulatory element or edit a portion of its sequence, cotton materials with significantly increased epidermal hair density and reduced cottonseed glands resulting in low gossypol content can be created.

2. The method for creating cotton resistant to aphids and thrips and with seed-specific low gossypol content according to claim 1, characterized in that, The cis-regulatory element site sequence is shown in SEQ ID NO.

1.

3. The method for creating cotton resistant to aphids and thrips and with seed-specific low gossypol content according to claim 1, characterized in that, The gRNA sequences involved in the CRISPR / Cas9 genome editing technology are shown in SEQ ID NO.2 and SEQ ID NO.3, and SEQ ID NO.4 and SEQ ID NO.5, respectively.

4. The method for creating cotton resistant to aphids and thrips and with seed-specific low gossypol content according to claim 3, characterized in that, The CRISPR / Cas9 genome editing vector containing the designed gRNA sequence was used to genetically transform cotton, and offspring with site editing, dense epidermal hairs, and few or no glands in the seeds were identified and screened.

Images