Method for creating male sterile line and maintainer line of maize based on CRISPR-Cas12i. 3 system and application of method

Abstract

The invention discloses a method for creating a male sterile line and a maintainer line of maize based on a CRISPR-Cas12i. 3 system and application of the method. The invention belongs to the field of genetic breeding, and particularly relates to a method for creating a male sterile line and a maintainer line of maize based on a CRISPR-Cas12i. 3 system and application of the method. The method for preparing the transgenic corn comprises the following steps: mutating an Ms26 gene of a receptor corn genome to cause Ms26 protein function deletion to obtain the transgenic corn, and the transgenic corn has at least one of the following characteristics: (1) compared with the receptor corn, the tassel of the transgenic corn shows compact spikelet, tight glume protection and incapability of normal pollen scattering, and the transgenic corn has the characteristics that the Ms26 protein function deletion is caused by the mutation of the Ms26 gene of the receptor corn genome; no pollen is exposed; and (2) compared with the receptor corn, the transgenic corn is completely aborted. By establishing an efficient backcross transformation method, the genic male sterile line without transgenic ingredients is rapidly obtained, the breeding period is greatly shortened, and the application cost is reduced.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of genetic breeding, and particularly relates to a method for creating a maize male sterile line and a maintainer line based on a CRISPR-Cas12i.3 system and application thereof. BACKGROUND

[0002] Maize is a major food crop in China, and the application rate of hybrid is close to 100%. However, the traditional hybrid seed production relies on artificial or mechanical detasseling, which has high cost and large loss. Using male sterile line is a fundamental way to solve this problem. At present, the cytoplasmic male sterility (CMS) system has the defects of being susceptible to disease and difficult to find a restorer line. While the nuclear gene male sterility system, such as constructing a fusion gene of pollen lethality and fertility restoration through transgenic strategy, can maintain sterility, but the offspring separation and screening process is complex, and the application cost is high.

[0003] With the development of gene editing technology, using gene editing tools to mutate the key genes of nuclear control of male fertility (such as MS26 gene in maize) has become a new strategy for creating sterile lines. Among them, Pioneer Company has applied for patent protection for the scheme of using CRISPR-Cas9 gene editing system to target edit the 1-4 exons of MS26 gene, forming a patent barrier. In order to avoid this patent, subsequent research attempts to target the 4th intron and 3' UTR region of MS26 gene by CRISPR-Cas9, in order to knockout the functional domain by producing large fragment deletion. However, since CRISPR-Cas9 system is essentially a blunt end nuclease, its editing results are mainly small fragment insertion or deletion (Indel), and the efficiency of large fragment deletion is very low (about 20%), resulting in long breeding cycle and low efficiency, which seriously limits its application in commercial breeding. Therefore, there is an urgent need in the art for a new gene editing tool and scheme that can avoid existing patent barriers while efficiently and accurately achieving large fragment gene deletion to create maize male sterile lines. CRISPR-Cas12i.3 is a newly discovered V-type endonuclease, which has a small protein size and a simple PAM sequence (TTN), and studies have shown that it can achieve efficient editing in animals and plants, especially its mediated large fragment deletion efficiency is significantly higher than that of CRISPR-Cas9. SUMMARY

[0004] The present application aims to solve the problems of low editing efficiency (large fragment deletion efficiency is only about 20%) and being limited by patent barriers in creating maize Ms26 male sterile lines using CRISPR-Cas9 system in the prior art, and provides a method for creating maize male sterile lines and maintainer lines based on a new CRISPR-Cas12i.3 system, which is efficient and accurate.

[0005] The application first provides a method for preparing a transgenic corn, comprising mutating the Ms26 gene in the genome of a receptor corn to cause the Ms26 protein to lose function, obtaining the transgenic corn, and the transgenic corn has at least one of the following characteristics: (1) Compared with the receptor corn, the tassel of the transgenic corn is compact, the glume is tightly closed, and the pollen cannot be normally dispersed, and the pollen is not exposed; (2) Compared with the receptor corn, the transgenic corn is completely sterile.

[0006] Further, the Ms26 gene in the genome of the receptor corn is mutated by gene editing to cause the MS26 protein to lose function; The gene editing is specifically performed by using a CRISPR-Cas12i.3 gene editing system, and the target sequences of crRNA1 and crRNA2 in the CRISPR-Cas12i.3 gene editing system are as follows: 1) as shown in SEQ ID No: 1 1596-1615 nucleotides and / or as shown in SEQ ID No: 5 1-20 nucleotides; 2) as shown in SEQ ID No: 1 2126-2145 nucleotides and / or as shown in SEQ ID No: 6 1-20 nucleotides Further, the CRISPR-Cas12i.3 gene editing system can be any one of the following: (b1) comprising specific crRNA1, crRNA2 and Cas12i.3 nuclease; The target sequence recognition region in the specific crRNA1 is as shown in SEQ ID No: 1 1596-1615 nucleotides and / or as shown in SEQ ID No: 5 1-20 nucleotides; The target sequence recognition region in the specific crRNA2 is as shown in SEQ ID No: 1 2126-2145 nucleotides and / or as shown in SEQ ID No: 6 1-20 nucleotides (b2) comprising a specific DNA molecule and a coding gene of Cas9 protein, and the specific DNA molecule is transcribed to obtain the crRNA1 and crRNA2; (b3) comprising a plasmid with the specific DNA molecule of (b2) and a plasmid with a coding gene of the Cas12i.3 nuclease; (b4) comprising the recombinant plasmid of (b3), and the specific recombinant plasmid expresses the specific DNA molecule of (b2) and the coding gene of the Cas12i.3 nuclease.

[0007] In a specific embodiment, the coding gene of the Cas12i.3 nuclease is a DNA molecule of nucleotide sequence such as SEQ ID No: 4.

[0008] The Cas12i.3 nuclease, under the guidance of the crRNA, produces a double-strand break at the fourth intron and 3' UTR target site of the MS26 gene, and produces a large fragment deletion mutation through a DNA repair mechanism, thereby obtaining a male sterile corn plant with MS26 function loss.

[0009] The present application also provides a method for preparing a transgenic corn, which can be as follows 1) or 2): 1) using the CRISPR-Cas12i.3 gene editing system described above to edit the genes of the recipient corn to obtain a transgenic corn; 2) introducing the specific recombinant plasmid described above into the recipient corn to obtain a transgenic corn; The transgenic corn has at least one of the following characteristics: 1) Compared with the recipient corn, the tassel of the transgenic corn shows compact spikelets, tightly closed husks, and cannot normally shed pollen, with no pollen exposed; 2) Compared with the recipient corn, the transgenic corn is completely sterile.

[0010] The present application also provides a method for preparing a transgenic corn without transgenes, comprising the following steps: 1) preparing the transgenic corn according to the method described above; 2) selfing the transgenic corn to obtain offspring; 3) screening the transgenic corn without transgenes from the offspring; The transgenic corn without transgenes has at least one of the following characteristics: 1) Compared with the recipient corn, the tassel of the transgenic corn shows compact spikelets, tightly closed husks, and cannot normally shed pollen, with no pollen exposed; 2) Compared with the recipient corn, the transgenic corn is completely sterile.

[0011] Further, the mutation of the Ms26 gene in the genome of the recipient corn can be any of the following mutations: 1) 529 nucleotide deletions exist at positions 1601-2129 of the genomic sequence (SEQ ID No: 1) of the MS26 gene, corresponding to positions 1249-1632 of the CDS sequence (SEQ ID No: 2), resulting in premature termination of MS26 translation; 2) 537 nucleotides are deleted from the 1599-2135 of the genomic sequence of the MS26 gene (SEQ ID No: 1), corresponding to the 1249-1632 of the CDS sequence (SEQ ID No: 2), resulting in the premature termination of MS26 translation; 3) 535 nucleotides are deleted from the 1596-2130 of the genomic sequence of the MS26 gene (SEQ ID No: 1), corresponding to the 1249-1632 of the CDS sequence (SEQ ID No: 2), resulting in the premature termination of MS26 translation; 4) 553 nucleotides are deleted from the 1593-2145 of the genomic sequence of the MS26 gene (SEQ ID No: 1), corresponding to the 1249-1632 of the CDS sequence (SEQ ID No: 2), resulting in the premature termination of MS26 translation; 5) 5 nucleotides are deleted from the 1594-1598 of the genomic sequence of the MS26 gene (SEQ ID No: 1), i.e. 5'-TCACG-3' is deleted, 504 nucleotides are deleted from the 1614-2117 of the genomic sequence of the MS26 gene (SEQ ID No: 1), corresponding to the 1249-1632 of the CDS sequence (SEQ ID No: 2), the nucleotide T at the 1589 of SEQ ID No: 1 is changed to A, and the nucleotide C at the 2136 of SEQ ID No: 1 is changed to T, resulting in the premature termination of MS26 translation.

[0012] The application also provides a method for transforming a maize male sterile line, comprising the following steps: 1) preparing the transgenic maize according to the method described above; 2) crossing the transgenic maize of step 1) with a recipient maize inbred line as the female parent to obtain F1 generation seeds; 3) planting the F1 generation plants, selecting sterile plants in the F1 generation as the female parent, and backcrossing with the recipient line A of step 2) to obtain BC1F1 generation seeds; 4) planting the BC1F1 generation plants, selecting sterile plants in the BC1F1 generation as the female parent, and continuing to backcross with the recipient line A as the male parent to obtain BC2F1 and higher generation backcross populations, so that the genetic background of the offspring gradually deviates to the recipient line A; 5) detecting the plants using Bar test strips, eliminating plants that test positive and still contain Cas12i.3 transgenic elements; and screening for plants that do not contain transgenic elements; 6) Self-crossing the hybrid of step 5), and screening the completely male sterile homozygous plants by phenotype observation, which is the male sterile line of the system A.

[0013] The application of the method described above in the preparation of a maize male sterile line also belongs to the scope of protection of the present application.

[0014] Compared with the prior art, the present application has the following advantages: 1) The target is ingeniously designed in the fourth intron and 3' UTR region of the MS26 gene, which is obviously different from the prior art.

[0015] 2) The CRISPR-Cas12i.3 system is applied to maize male sterility research for the first time, and the unique mechanism of efficiently generating large fragment deletions is used to greatly improve the large fragment deletion efficiency from about 20% of the Cas9 system to 95.2%, solving the long-standing technical bottleneck in this field.

[0016] 3) By deleting a large fragment at one time, the key functional domain containing the fifth exon of Ms26 is precisely knocked out, the function of the Ms26 protein is completely destroyed, and the mutant obtained has complete sterility, no residual function, and no fertile pollen is produced, and the phenotype is stable after the next generation.

[0017] 4) By establishing an efficient backcrossing method, using the edited element as a "moving scissors", the sterile trait is quickly introduced into any excellent inbred line, and finally a nuclear sterile line without transgenic components is obtained, greatly shortening the breeding cycle and reducing the application cost. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 is a structural schematic diagram of the recombination editing vector CPB-26E5DEL.

[0019] Figure 2 is a sequence alignment of the wild type MS26 gene (line 1) and a typical large fragment deletion mutant (below).

[0020] Figure 3 is a comparison diagram of the tassel phenotype of the wild type ZC01 (left) and the Ms26 male sterile mutant (right).

[0021] Figure 4 is a diagram of anther iodine staining detection of the wild type ZC01 (left) and the Ms26 male sterile mutant (right) (microscopy).

[0022] Figure 5 is a flowchart of quickly transferring the male sterile trait to other maize receptor lines. DETAILED DESCRIPTION

[0023] The present application is further described in detail by the specific embodiments below, the examples given are only to illustrate the present application, and are not intended to limit the scope of the present application. The examples provided below can serve as a guide for further improvement by those skilled in the art, and do not in any way constitute a limitation on the present application.

[0024] The experimental methods in the following examples are all routine methods, unless otherwise specified, which are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained commercially.

[0025] Unless otherwise specified, the quantitative tests in the following examples are all set up with three repeated experiments, and the results are averaged.

[0026] The enzymes used in the following examples are: high success rate PCR enzyme KOD FX (Beijing Bailingke Biotechnology Co., Ltd.), NEBuilder HiFi DNA Assembly Master Mix (Beijing Bailingke Biotechnology Co., Ltd.), 2xM5 HiPer plus Taq HiFi PCR mix (with blue dye) (Beijing Julongmei Biotechnology Co., Ltd.), Taq Pro Universal SYBR qPCR Master Mix (Nanjing Novozyme BioTech Co., Ltd.), restriction endonuclease (Thermo Fisher Scientific), etc.

[0027] The reagents used in the following examples are: UE plasmid small amount preparation kit (Beijing Wanjing Lizhi Biotechnology Co., Ltd.), M5 Hiper Gel Extraction Kit (with column) (agarose gel recovery kit), nucleic acid dye (Julongmei Biotechnology Co., Ltd.), Agarose (Quanshi Gold Biotechnology Co., Ltd.), etc.

[0028] The plant material corn inbred line ZC01 in the following examples is purchased from Unime Biotechnology (Jiangsu) Co., Ltd.

[0029] The editing vector CPB in the following examples has been described in: Li C, Liu C, Qi X, et al. RNA-guided Cas9 as an in vivo desired-target mutator in maize [J]. Plant Biotechnology Journal, 2017, 15(12): 1566-1576. The biological material can be obtained from the applicant, which is only used for repeating the experiments of the present application and cannot be used for other purposes.

[0030] Example 1, Construction of ΔMS26-Editor gene editing vector ZmMs26 The coding sequence (CDS) of the gene in the maize variety ZC01 is SEQ ID No: 2, which encodes the ZmMs26 protein of SEQ ID No: 3. The genomic gene encoding the ZmMs26 protein in the genomic DNA of the maize variety ZC01 is shown in SEQ ID No: 1 of the sequence listing.

[0031] 1. Selection and verification of gene editing target gene The sequence information (SEQ ID No: 1) of the maize ZmMs26 gene (Zm00001eb005300) was retrieved through the NCBI website, and specific primers were designed using Primer-BLAST on NCBI, and the primer sequences are as follows: ZmMS26F1: 5'- ATGGAGGAAGCTCACCTCAC -3'; ZmMS26R1: 5'- CAGGGGTGGACACCGTATTT -3'.

[0032] Genomic DNA of maize inbred line ZC01 was extracted as a template to amplify the Ms26 gene. KODFX high-fidelity enzyme was selected for gene amplification, and the reaction system is shown in Table 1: Table 1, PCR reaction system

[0033] The PCR reaction program is shown in Table 2: Table 2, PCR reaction program

[0034] The PCR product was detected by electrophoresis with 1% agarose gel. The electrophoresis results of the PCR product were detected under the ultraviolet gel imager and saved by taking pictures. The PCR product with correct band size was subjected to sanger sequencing analysis to confirm the sequence of the MS26 gene in ZC01.

[0035] The sequence of the target gene subjected to Sanger sequencing was input into the sequence column of the CRISPR-P website (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR), and the Target Genome was selected as Zea mays. According to the analysis results, two target points were finally selected: crRNA1: 5'-ACGACCTCCGGTCCGCGATG-3' (SEQ ID No. 5), and the target sequence is located at positions 1541-1560 of SEQ ID No. 1 (fourth intron region); crRNA2: 5'-ACAAATAACGCTCGTGTTAC-3' (SEQ ID No. 6), and the target sequence is located at positions 2071-2090 of SEQ ID No. 1 (3' UTR region).

[0036] 2. Construction of Ms26 gene editing vector based on CRISPR-Cas12i.3 Step 1: Construction of CPB-Cas12i.3 vector The Cas12i.3 gene fragment was obtained by codon optimization of the amino acid sequence in Lv P, Su F, Chen F, et al. Genome editing in rice using CRISPR / Cas12i3. Plant Biotechnol Journal. 2024;22(2):379-385. The Cas12i.3 DNA sequence information (SEQ ID NO: 4) was synthesized by gene synthesis (Shanghai Generay). The Cas12i.3 gene fragment was synthesized between the BamHI and AfiII enzyme cutting sites of the CPB vector to form a new gene editing vector CPB-Cas12i.3 (the sequence characteristics of which are included in SEQ ID No: 7).

[0037] The structure of the gene editing vector CPB-Cas12i.3 is described as follows: a DNA fragment with the sequence of SEQ ID No: 4 is inserted between the BamHI and AfiII enzyme cutting sites of the starting vector CPB, and the other sequences of the vector CPB remain unchanged to obtain a recombinant vector.

[0038] Step 2: Construction of CPB-26E5DEL The coding gene of the crRNA is driven by the maize U6 polymerase III promoter (Zm U6-2, nucleotide sequence is SEQ ID No: 8). The crRNA scaffold sequence is used according to the information disclosed in Lv et al., 2023.

[0039] The designed primers were used to amplify U6-2-crRNA1 (SEQ ID No: 9) and U6-2-crRNA2 (SEQ ID No: 10) fragments from the maize ZC01 genomic DNA as a template, and the primers were designed as follows: Table 3, PCR amplification primers of U6-2-crRNA1 and U6-2-crRNA2 fragments

[0040] KOD FX high-fidelity enzyme was used for amplification, and the sample addition system and amplification procedure are shown in Tables 1 and 2. After amplification, 1% agarose gel was used for detection, and the target band was purified and recovered to obtain U6-2-crRNA1 and U6-2-crRNA2 fragments.

[0041] Hind III restriction enzyme was used to cut the CPB-Cas12i.3 vector at 37°C to obtain a linearized vector. The purified U6-2-crRNA1 and U6-2-crRNA2 fragments were recombined with the CPB-Cas12i.3 linearized large fragment using NEBuilder HiFi DNA Assembly Master Mix (E2621L, New England Biolabs) at 50°C for 30 min. The recombination product was transformed into competent cells, and single colonies were picked for sequencing verification. After correct sequencing, the final edited vector was obtained, named CPB-26E5DEL (the schematic diagram of the vector structure is shown in Figure 1 ), and high-purity plasmid was extracted using the UE plasmid miniprep kit for preservation and standby use.

[0042] The structure of the recombined vector CPB-26E5DEL is described as follows: the U6-2-crRNA1 (SEQ ID No: 9) and U6-2-crRNA2 (SEQ ID No: 10) fragments are inserted between the Hind III enzyme cutting sites of the vector CPB-Cas12i.3 (SEQ ID No: 7). This vector can express Cas12i.3 nuclease and two crRNAs targeting the MS26 gene at the same time.

[0043] Example 2, obtaining and identifying mutant plants 1. Obtaining of Ms26 mutant plants The CPB-26E5DEL plasmid constructed in Example 1 was transformed into Agrobacterium EHA105 (Beijing Zhongke Yubo Biotechnology Co., Ltd., BC303-01) by electroporation, and YEP liquid medium containing the corresponding antibiotic was used for culture at 28°C, 200 rpm shaking, until OD 600≈0.8; collect the bacteria by centrifugation at 5000 rpm for 10 min; resuspend the bacteria with the infection buffer, and adjust the OD600 to 0.5 to obtain the Agrobacterium infection suspension; take 1 mL of the Agrobacterium suspension and add it into an EP tube containing freshly peeled maize inbred line ZC01 embryos, and stand at room temperature for 5 min; transfer the embryos to co-culture medium, and cultivate in the dark at 23°C for 3 days; transfer the embryos to recovery medium, and cultivate in the dark at 28°C for 6 days; transfer the embryos to screening medium containing a screening agent (dialphosine), and subculture every two weeks to screen positive calli; Transfer the resistant calli to induction medium, and cultivate in the dark at 28°C for 2 weeks; transfer the calli to differentiation medium, and cultivate under the condition of 5000 lx light at 25°C for 3 weeks to induce differentiation of green seedlings; cut off the green seedlings, and transfer them to rooting medium to cultivate under the same light condition until the root system is developed; transplant the seedlings to a greenhouse after hardening, and normally manage them until maturation.

[0044] 2. PCR identification of T0 generation transgenic plants Genomic DNA of the T0 generation resistant plants was extracted by the CTAB method. PCR detection was performed using specific primers of the Cas12i.3 gene, with wild-type ZC01 DNA as a negative control and the CPB-26E5DEL plasmid as a positive control. The Cas12i.3 specific detection primer information is as follows: Cas12 Forward: 5'-CAAGTCCGTTAAGAGCCTGCTC-3'; Cas12 Reverse: 5'-TGCTGCCGGTCCTCCTTCTTG -3'.

[0045] The PCR reaction system and procedure were the same as those in Table 1 and Table 2. The amplification products were detected by agarose gel electrophoresis.

[0046] The results showed that 47 T0 generation resistant plants could all amplify a specific band of 468 bp, while the wild-type control had no such band, proving that the Cas12i.3 editing element had been successfully integrated into the genomes of the 47 transgenic plants.

[0047] 3. Genotype identification of ms26 mutant plants The genomic DNA of the above 47 T0 generation positive transgenic plants was used as a template, and the primers ms26-F / ms26-R covering the target region of the MS26 gene were used for PCR amplification.

[0048] ms26-F: CGGCGTACCTGCAGATGAAGATG; ms26-R: CCGGCGAAGAAAGAGGATAAT.

[0049] PCR products were subjected to agarose gel electrophoresis and then sent to a sequencing company for Sanger sequencing. The sequencing results were compared with the wild-type sequence (SEQ ID No: 1) to analyze the mutation type.

[0050] The results show that among the 47 T0 generation positive transgenic plants, 42 plants have target site editing, and the total editing efficiency is 89.4% (42 / 47); among the 42 mutants, 40 plants have large fragment deletion between two target sites, and the large fragment deletion efficiency is as high as 95.2% (40 / 42). This efficiency far exceeds the level of about 20% of the existing CRISPR-Cas9 system, fully proving the unique advantage of the Cas12i.3 system in mediating large fragment deletion.

[0051] The obtained large fragment deletion mutations mainly include five types Figure 2 ): Mutation type 1, compared with the wild type of corn inbred ZC01 variety, the MS26 gene in the genome is mutated: in the two homologous chromosomes, 529 nucleotides are deleted from the 1601-2129th position of the genomic sequence (SEQ ID No: 1) of the MS26 gene, corresponding to the 1249-1632th nucleotide of the CDS sequence (SEQ ID No: 2), which causes the MS26 translation to terminate prematurely; Mutation type 2, compared with the wild type of corn inbred ZC01 variety, the MS26 gene in the genome is mutated: in the two homologous chromosomes, 537 nucleotides are deleted from the 1599-2135th position of the genomic sequence (SEQ ID No: 1) of the MS26 gene, corresponding to the 1249-1632th nucleotide of the CDS sequence (SEQ ID No: 2), which causes the MS26 translation to terminate prematurely; Mutation type 3, compared with the wild type of corn inbred ZC01 variety, the MS26 gene in the genome is mutated: in the two homologous chromosomes, 535 nucleotides are deleted from the 1596-2130th position of the genomic sequence (SEQ ID No: 1) of the MS26 gene, corresponding to the 1249-1632th nucleotide of the CDS sequence (SEQ ID No: 2), which causes the MS26 translation to terminate prematurely; Mutation type 4, compared with the wild type of corn inbred ZC01 variety, the MS26 gene in the genome is mutated: in the two homologous chromosomes, 553 nucleotides are deleted from the 1593-2145th position of the genomic sequence (SEQ ID No: 1) of the MS26 gene, corresponding to the 1249-1632th nucleotide of the CDS sequence (SEQ ID No: 2), which causes the MS26 translation to terminate prematurely; The mutation type 5 is compared with the wild type of corn inbred line ZC01, and the MS26 gene in the genome is mutated: in the two homologous chromosomes, 5 nucleotide deletions exist in the 1594-1598 positions of the genomic sequence (SEQ ID No: 1) of the MS26 gene, that is, 5'-TCACG-3' is deleted, 504 nucleotide deletions exist in the 1614-2117 positions of the genomic sequence (SEQ ID No: 1) of the MS26 gene, corresponding to the 1249-1632 positions of the CDS sequence (SEQ ID No: 2), the nucleotide T at the 1589 position of SEQ ID No: 1 is changed to A, and the nucleotide C at the 2136 position of SEQ ID No: 1 is changed to T, resulting in premature termination of MS26 translation.

[0052] The above deletions all result in the removal of the key sequence containing the entire fifth exon, causing the complete deletion of the MS26 protein functional domain, which is expected to cause loss of function.

[0053] Example 3, phenotype identification of mutant plants The ms26-5 (mutation type 5) mutant line was selected for key phenotype identification, with wild type ZC01 as the control.

[0054] 1. Observation of tassel phenotype The corn plants were sown in the China Agricultural University Nankou Pilot Base in May of each year and in the China Agricultural University Crop Science Institute Hainan Test Station in November, and were cultured outdoors throughout the growth period. The tassel phenotype of the plants was observed and recorded at the full flowering stage. Each sample was repeated 3 times.

[0055] The results are shown in Figure 3 The wild type ZC01 tassel is loose, the spike glume is open, and the pollen amount is large; while the ms26-5 mutant tassel shows compact spike, closed glume, and cannot normally shed pollen, with no pollen exposed, showing a typical complete male sterile phenotype.

[0056] 2. Pollen fertility detection (iodine staining method) Fresh anthers of wild type and mutant were taken on a glass slide, 1-2 drops of I2-KI solution (Beijing Coolab Science and Technology Co., Ltd., SL72602-100mL) were added, the anthers were squeezed to release pollen with tweezers, a cover glass was covered, and after 1-2 min, observation was performed under a microscope. The results are shown in Figure 4 The pollen grains of the wild type ZC01 are full and regular in shape, and are stained dark blue by iodine solution, indicating that they are rich in starch and have normal fertility; while in the ms26-5 mutant anther, almost no complete pollen grains can be seen, only a small amount of abnormal, non-staining or very lightly staining abortive pollen residues are seen, confirming complete sterility.

[0057] The above phenotype identification results are completely consistent with the genotype analysis results, proving that the MS26 gene function loss, stable maize male sterile line is successfully created.

[0058] Example 4, efficient transformation method of maize male sterile line In order to quickly introduce the obtained sterile traits into other excellent maize inbred lines (taking the recipient line "A" as an example), the backcross transformation process as shown in Figure 5 is adopted, and the specific steps are as follows: 1) The ms26-5 mutant (genotype Cas12i.3 / Cas12i.3; ms26 / ms26) obtained in Example 2 is used as the female parent, and the recipient maize inbred line A (genotype - / -; MS26 / MS26) is used as the male parent to carry out hybridization, and F1 generation seeds (Cas12i.3 / -; ms26 / MS26) are obtained; 2) Planting F1 generation plants, due to the action of the cytoplasm of the female parent and the sterile nuclear gene, the F1 generation plants exhibit male sterility; 3) Selecting sterile plants as the female parent, and backcrossing with the recipient line A (- / -; MS26 / MS26) again to obtain BC1F1 generation seeds (population genotype Cas12i.3 / -; ms26 / MS26 or - / -; ms26 / MS26); 4) Repeating step 2, and continuing to backcross with the recipient line A as the male parent to obtain BC2F1 and higher generation backcross populations, so that the genetic background of the offspring gradually deviates to the recipient line A.

[0059] In the BC2F1 or BC3F1 generation, plants are detected by using Bar test strips (detecting herbicide resistance markers on the CPB vector), and plants (Cas12i.3 / -) still containing the Cas12i.3 transgenic elements which are positive in the detection are eliminated, and plants (- / -) not containing the transgenic elements are screened out, and the genotype of the plants is MS26 / ms26, i.e. heterozygous.

[0060] The screened heterozygous plants (- / -; MS26 / ms26) not containing the transgenic elements are self-crossed. In the offspring of the self-crossing, about 1 / 4 of the plants have the genotype - / -; ms26 / ms26 (i.e. pure mutant plants not containing transgenes). The pure mutant plants completely male sterile are screened out through phenotype observation (compact and closed tassels).

[0061] Finally, the sterile line (- / -; ms26 / ms26) is obtained, and the nuclear and cytoplasmic genetic backgrounds of the sterile line are highly consistent with the recipient line A, and the sterile line does not contain any exogenous transgenic components, i.e. the sterile line is the male sterile line of the recipient line A.

[0062] By the above method, the ms26 sterile trait can be quickly transferred to any excellent maize inbred line in 2-3 backcross generations, and the corresponding male sterile line is efficiently created for hybrid seed production.

[0063] The application has been described in detail. For those skilled in the art, the application can be implemented in a wider range under the same parameters, concentrations and conditions without departing from the purpose and scope of the application and without unnecessary experiments. Although the application gives a special example, it should be understood that the application can be further improved. In summary, according to the principle of the application, the application intends to include any change, use or improvement of the application, including changes made by conventional techniques known in the art, which deviates from the range disclosed in the application.

Claims

1. A method for preparing transgenic maize, characterized in that, This includes inducing a mutation in the Ms26 gene in the recipient maize genome, resulting in the loss of function of the Ms26 protein, to obtain the transgenic maize. The genetically modified corn has at least one of the following characteristics: (1) Compared with the recipient maize, the tassels of the transgenic maize are characterized by compact spikelets, tightly closed glumes, inability to release pollen normally, and no exposed pollen. (2) Compared with the recipient maize, the transgenic maize was completely sterile.

2. The method according to claim 1, characterized in that: The Ms26 gene in the recipient maize genome was mutated using gene editing, resulting in the loss of function of the MS26 protein. The gene editing was specifically performed using the CRISPR-Cas12i.3 gene editing system. The target sequences for crRNA1 and crRNA2 in the CRISPR-Cas12i.3 gene editing system are as follows: 1) Nucleotides 1596-1615 of SEQ ID No:1 and / or nucleotides 1-20 of SEQ ID No:5; 2) Nucleotides 2126-2145 of SEQ ID No:1 and / or nucleotides 1-20 of SEQ ID No:

6.

3. The method according to claim 2, characterized in that, The CRISPR-Cas12i.3 gene editing system is any one of the following: (b1) includes specific crRNA1, crRNA2 and Cas12i.3 nucleases; The target sequence recognition region in the specific crRNA1 is shown as nucleotides 1596-1615 in SEQ ID No:1 and / or nucleotides 1-20 in SEQ ID No:5; The target sequence recognition region in the specific crRNA2 is shown as nucleotides 2126-2145 in SEQ ID No:1 and / or nucleotides 1-20 in SEQ ID No:

6. (b2) Includes a specific DNA molecule and a gene encoding the Cas9 protein, wherein the specific DNA molecule is transcribed to obtain the crRNA1 and crRNA2; (b3) includes a plasmid having the specific DNA molecule described in (b2) and a plasmid having the encoding gene of the Cas12i.3 nuclease; (b4) includes the recombinant plasmid described in (b3), wherein the specific recombinant plasmid expresses the encoding gene of the specific DNA molecule described in (b2) and the Cas12i.3 nuclease.

4. The method according to claim 3, characterized in that, The gene encoding the Cas12i.3 nuclease is a DNA molecule with a nucleotide sequence such as SEQ ID No:

4.

5. A method for preparing transgenic maize, characterized in that, For example, 1) or 2): 1) Gene editing of recipient maize is performed using the CRISPR-Cas12i.3 gene editing system as described in any one of claims 2-4 to obtain transgenic maize; 2) The specific recombinant plasmid described in claim 3 is introduced into recipient maize to obtain transgenic maize; The genetically modified corn has at least one of the following characteristics: (1) Compared with the recipient maize, the tassels of the transgenic maize are characterized by compact spikelets, tightly closed glumes, inability to release pollen normally, and no exposed pollen. (2) Compared with the recipient maize, the transgenic maize was completely sterile.

6. A method for preparing non-transgenic gene-edited maize, characterized in that, Includes the following steps: 1) The genetically modified corn is prepared according to the method of claims 1-4 or according to the method of claim 5; 2) The genetically modified maize was self-pollinated to obtain self-pollinated offspring; 3) Select non-transgenic gene-edited maize from the self-pollinated offspring; The non-GMO gene-edited corn has at least one of the following characteristics: (1) Compared with the recipient maize, the tassels of the transgenic maize are characterized by compact spikelets, tightly closed glumes, inability to release pollen normally, and no exposed pollen. (2) Compared with the recipient maize, the transgenic maize was completely sterile.

7. The method according to any one of claims 1-6, characterized in that, The mutation that causes a change in the Ms26 gene in the recipient maize genome specifically refers to any of the following mutations: 1) A deletion of 529 nucleotides exists at positions 1601-2129 of the MS26 gene genome sequence (SEQ ID No:1), corresponding to positions 1249-1632 of the CDS sequence (SEQ ID No:2), which leads to premature termination of MS26 translation; 2) A deletion of 537 nucleotides exists at positions 1599-2135 of the MS26 gene genome sequence (SEQ ID No:1), corresponding to positions 1249-1632 of the CDS sequence (SEQ ID No:2), which leads to premature termination of MS26 translation; 3) A deletion of 535 nucleotides exists at positions 1596-2130 of the MS26 gene genome sequence (SEQ ID No:1), corresponding to positions 1249-1632 of the CDS sequence (SEQ ID No:2), which leads to premature termination of MS26 translation; 4) A deletion of 553 nucleotides exists at positions 1593-2145 of the MS26 gene genome sequence (SEQ ID No:1), corresponding to positions 1249-1632 of the CDS sequence (SEQ ID No:2), which leads to premature termination of MS26 translation; 5) At positions 1594-1598 of the MS26 gene genome sequence (SEQ ID No:1), there is a 5-nucleotide deletion, namely a 5'-TCACG-3' deletion. At positions 1614-2117 of the MS26 gene genome sequence (SEQ ID No:1), corresponding to positions 1249-1632 of the CDS sequence (SEQ ID No:2), there is a 504-nucleotide deletion. Nucleotide T at position 1589 of SEQ ID No:1 is changed to A, and nucleotide C at position 2136 of SEQ ID No:1 is changed to T, causing premature termination of MS26 translation.

8. A method for converting male-sterile maize lines, characterized in that, Includes the following steps: 1) The genetically modified corn is prepared according to the method of claims 1-4 or according to the method of claim 5; 2) Using the transgenic maize described in step 1) as the female parent and the recipient maize inbred line as the male parent, crossbreed to obtain F1 generation seeds; 3) Plant F1 generation plants, select sterile plants from the F1 generation as female parents, and backcross them with the recipient system A described in step 2) to obtain BC1F1 generation seeds; 4) Plant BC1F1 generation plants, select sterile plants from BC1F1 generation as female parents, and continue to backcross with the aforementioned recipient system A as male parent to obtain BC2F1 and higher generation backcross populations, so that the genetic background of the offspring gradually shifts towards recipient system A. 5) Use Bar test strips to test the plants, discard plants that test positive and still contain Cas12i.3 transgenic elements; select heterozygous plants that do not contain transgenic elements; 6) Self-pollinate the heterozygotes described in step 5), and screen out homozygous plants that are completely male-sterile through phenotypic observation. These are the male-sterile lines of system A.

9. The application of the method according to claims 1-4 in the preparation of male-sterile maize lines.

10. The application of the method of claim 8 in the preparation of male-sterile maize lines.

Images