Y chromosome detection fluorescent probe kit based on SRY and TSPY1 double genes and application method

Abstract

The invention discloses a Y chromosome detection fluorescent probe kit based on SRY and TSPY1 double genes and an application method, and belongs to the technical field of molecular biological detection. The kit comprises a primer pair and a fluorescence labeling probe which are used for specifically amplifying and detecting an SRY gene and a TSPY1 gene on a Y chromosome, and a primer pair and a fluorescence labeling probe of a GAPDH gene serving as an internal reference. Two Y chromosome functional genes which are crucial to male gonad development are synchronously detected in a reaction system through a multiplex fluorescent PCR technology. The kit is mainly used for (1) auxiliary diagnosis of Y chromosome linked genetic diseases; (2) evaluating the integrity of the key gene region of the Y chromosome of the fetus, and providing non-invasive prenatal risk evaluation for sexual development related diseases (such as gonadal insufficiency); and (3) the kit is used as an auxiliary screening tool for male infertility factors. Through double-site detection, the accuracy and reliability of detection are effectively improved, and the limitation of single-site detection is avoided.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology detection technology, specifically relating to a kit and method for gene detection, and particularly to a method for combined detection of Y chromosome. SRY (Y protein gene, the sex-determining region) and TSPY1 (Testis-specific protein Y-encoding gene 1) These two key functional genes are used in a fluorescent probe PCR kit to assist in the diagnosis of Y chromosome-related genetic diseases and to assess the integrity of the Y chromosome. Background Technology

[0002] The Y chromosome carries numerous genes crucial for male gonadal development and spermatogenesis. Y chromosome microdeletions (such as deletions in the azoospermia factor AZF region) are a major cause of male infertility. Furthermore, genes located on the Y chromosome (such as...) SRY Mutations or deletions of the Y chromosome can lead to sex development-related disorders (DSDs) such as gonadal dysgenesis (e.g., Swyer syndrome). Furthermore, the genetic risk of some X-linked recessive disorders (such as hemophilia A and Duchenne muscular dystrophy) is highly correlated with whether the fetus carries the Y chromosome (i.e., whether it is male). Therefore, accurate prenatal genetic counseling and risk assessment are of significant medical importance.

[0003] Traditional techniques such as chromosome karyotype analysis are time-consuming and have limited resolution. However, the development of non-invasive prenatal testing (NIPT) has made it possible to perform early and safe genetic assessments using cell-free fetal DNA (cffDNA) in the maternal peripheral blood. Currently, Y chromosome testing largely relies on single genes (such as...). SRY However, relying solely on single-gene testing has limitations: if the gene is naturally deleted or mutated, it may lead to false negative results, thus affecting the accurate assessment of Y chromosome status and related disease risks.

[0004] Therefore, there is an urgent need in this field for a new Y chromosome detection technology that can improve detection accuracy, provide more genetic information, and be rigorously applied in the field of medical diagnostics. Summary of the Invention

[0005] The purpose of this invention is to address the existing problems by providing a method based on... SRY and TSPY1 A fluorescent probe kit for detecting Y chromosome with two genes and its application method, with its application strictly limited to legitimate medical diagnostic scenarios.

[0006] This invention is achieved through the following technical solution: The first objective of this invention is to provide a method based on... SRY and TSPY1A dual-gene Y chromosome detection fluorescent probe kit, the kit comprising: Specific amplification and detection of human SRY The first primer pair and the first fluorescently labeled probe of the gene; Specific amplification and detection of human TSPY1 The second primer pair and the second fluorescently labeled probe of the gene; And specific amplification and detection of human internal reference genes GAPDH The third primer pair and the third fluorescently labeled probe.

[0007] Furthermore, the first primer pair is selected from the sequences shown in SEQ ID NO. 1 and SEQ ID NO. 2; The first fluorescently labeled probe is the sequence shown in SEQ ID NO. 3, with a FAM fluorescent reporter group labeled at its 5' end and a BHQ1 quencher group labeled at its 3' end.

[0008] Furthermore, the second primer pair is selected from the sequences shown in SEQ ID NO. 4 and SEQ ID NO. 5; The second fluorescently labeled probe is the sequence shown in SEQ ID NO. 6, with a HEX or VIC fluorescent reporter group labeled at its 5' end and a BHQ2 quencher group labeled at its 3' end.

[0009] Furthermore, the third primer pair is selected from the sequences shown in SEQ ID NO. 7 and SEQ ID NO. 8; The third fluorescently labeled probe is the sequence shown in SEQ ID NO. 9, with a ROX or CY5 fluorescent reporter group labeled at its 5' end and a BHQ3 quencher group labeled at its 3' end.

[0010] Furthermore, the first, second, and third primer pairs and the corresponding fluorescently labeled probes are configured to enable multiplex quantitative PCR reactions to be performed in the same reaction tube.

[0011] A second objective of this invention is to provide a reaction solution for nucleic acid amplification, characterized in that it comprises the first, second, and third primer pairs and corresponding fluorescently labeled probes, a hot-start DNA polymerase, dNTPs, magnesium ions, and PCR buffer as described in any one of claims 1-5.

[0012] A third objective of this invention is to provide a kit or reaction solution for use in the preparation of products for assisting in the diagnosis of Y-chromosome-linked genetic diseases, products for assessing the integrity of key gene regions of the fetal Y chromosome, and products for assisting in the diagnosis of factors related to male infertility.

[0013] The fourth objective of this invention is to provide a method for detecting the presence and integrity of the Y chromosome, comprising the following steps: (1) Obtain the sample to be tested and extract genomic DNA from it; (2) Using the DNA extracted in step (1) as a template, perform a real-time PCR amplification reaction using the kit described in any one of claims 1-5 or the reaction solution described in claim 6; (3) Analyze the amplification results, based on SRY Genes and TSPY1 The detection of fluorescent signals in genes helps determine the presence of the Y chromosome and the integrity of key regions.

[0014] Furthermore, the result interpretation in step (3) includes: like SRY Genes and TSPY1 If all genes are effectively detected, it is determined that the Y chromosome is present; like SRY Genes and TSPY1 None of the genes were detected, and the internal reference gene was also undetectable. GAPDH If it is effectively detected, it is determined that the Y chromosome was not detected; like SRY Genes and TSPY1 If only one gene is detected, it suggests that there may be a deletion or mutation in the region of the Y chromosome corresponding to the undetected gene.

[0015] The present invention has the following advantages over the prior art: This invention creatively combines two functionally independent, location-distinct specific genes on the Y chromosome— SRY and TSPY1 —Combined, detection is performed simultaneously in a multiplex fluorescent PCR reaction system. This provides a highly accurate and specific fluorescent probe kit and detection method capable of assessing Y chromosome integrity, with its application strictly limited to legitimate medical diagnostic scenarios. It offers significant advantages compared to existing technologies: (1) High accuracy and reliability: The dual-gene joint detection constitutes an internal verification mechanism. When assessing the integrity of the Y chromosome, if both Y-specific genes are positive at the same time, the presence of the Y chromosome is confirmed; if only one gene is positive, it suggests that the other gene region may be missing, providing more in-depth genetic information for clinical use and effectively avoiding the limitations of single-gene detection.

[0016] (2) Clear medical application value: This invention is strictly limited to legitimate medical scenarios such as assisting in the diagnosis of Y-chromosome-linked genetic diseases, assessing the risk of sexual developmental abnormalities, and screening for male infertility factors. It provides a more reliable molecular tool for clinical genetic counseling, eugenics and disease diagnosis, and has important clinical application value and market prospects.

[0017] (3) High sensitivity and convenience: Multiple real-time fluorescence PCR technology is used, and multiple targets can be detected in a single tube reaction. The closed tube operation avoids cross-contamination and the process is fast. It is especially suitable for detecting trace DNA samples (such as cffDNA in peripheral blood of pregnant women). Attached Figure Description

[0018] Figure 1 This is a flowchart of the detection process for the reagent kit of the present invention; Figure 2 for SRY - Two primer pairs were used to identify the RT-PCR amplification curves of two male and two female samples; Figure 3 for DYS14 -2 (i.e.) TSPY1 RT-PCR amplification curves of two male and two female samples were identified using primers. Figure 4 for GADPH-2 RT-PCR amplification curves of two male and two female samples were identified using primer genes; Figure 5 To identify target genes in preliminary RT-PCR experiments SRY , DYS14 Genetic results; Figure 6 To identify target genes in preliminary RT-PCR experiments SRY , DYS14 Electrophoresis results of gene amplification products.

[0019] Note: The contents of this instruction manual and images... DYS14 That is TSPY1 . Detailed Implementation

[0020] To further explain the present invention, the following specific embodiments are described.

[0021] Example 1: Composition of the reagent kit The kit of the present invention comprises the following main components: PCR reaction premix: contains hot-start DNA polymerase, dNTPs, MgCl2 and PCR buffer.

[0022] Primer-probe mixture: Contains primers and probes with the sequences shown in the table below. The final concentrations of each component in the working solution are as follows: SRY primer pairs: 0.2-0.6 μM each SRY probe (FAM-BHQ1): 0.1-0.3 μM TSPY1 primer pairs: 0.2-0.6 μM each TSPY1 probe (HEX-BHQ2): 0.1-0.3 μM GAPDH primer pairs: 0.1-0.3 μM each GAPDH probe (ROX-BHQ3): 0.05-0.2 μM Positive control sample: contains SRY and TSPY1 Male genomic DNA fragments.

[0023] Negative control products: Free of SRY and TSPY1 The female genomic DNA of the gene or TE buffer.

[0024] Nuclease-free water.

[0025] sequence list SEQ ID NO. 1 (SRY-F): TCCTCAAAAGAAAACCGTGCAT SEQ ID NO. 2 (SRY-R): AGATTAATGGTTGCTAAGGACTGGAT SEQ ID NO. 3 (SRY-Probe): [FAM]TCCCCACAACCTCTT[BHQ1] SEQ ID NO. 4 (TSPY1-F): GGGCCAATGTTGTATCCTTCTC SEQ ID NO. 5 (TSPY1-R): GCCCATCGGTCACTTACACTTC SEQ ID NO. 6 (TSPY1-Probe): [HEX]TCTAGTGGAGAGGTGCTC[BHQ2] SEQ ID NO. 7 (GAPDH-F): CCCCACACACATGCACTTACC SEQ ID NO. 8 (GAPDH-R): CCTAGTCCCAGGGCTTTGATT SEQ ID NO. 9 (GAPDH-Probe): [ROX]AAAGAGCTAGGAAGGACAGGCAACTTGGC[BHQ3] Example 2: Preliminary Experiment 1. Regarding the specificity validation of the reagent kit To verify the specificity of the kit of the present invention, preliminary experiments were conducted. Figure 2 , Figure 3 and Figure 4 They respectively demonstrated the use of targeting SRY , DYS14 and GAPDH The primer pairs for the gene are used to perform RT-PCR detection of peripheral blood genomic DNA from two healthy men (P1, P2) and two healthy non-pregnant women (N1, N2), and the resulting amplification curves are shown.

[0026] In the above preliminary experiments, P1 and P2 were healthy males, and the genes related to males were... SRY , DYS14 All tests were positive, while N1 and N2 were two healthy, non-pregnant women. SRY , DYS14 None had CT values. The RT-PCR products were subjected to electrophoresis to verify primer specificity, such as... Figure 6 As shown, SRY1 Two bands are specific. DYS14 With internal reference GADPH The presence of non-specific bands in RT-PCR under the same system still requires optimization, but preliminary experiments can verify that the accuracy rate of sex gene identification is 100% for both males and females.

[0027] 2. Regarding primer specificity and product validation To further confirm the specificity of the amplification products, the amplification products from the above RT-PCR preliminary experiment were analyzed by agarose gel electrophoresis. The results are as follows: Figure 6 As shown.

[0028] exist SRY In the gene detection channel, male samples (P1, P2) showed clear, single, specific bands at the expected size, while female samples (N1, N2) did not have such bands. This was completely consistent with the amplification curve results, confirming the specificity of the SRY primer pair.

[0029] Example 3: Method for detecting the presence and integrity of the Y chromosome like Figure 1 As shown, the complete detection process of the kit of the present invention includes the following steps: Sample processing: Collect the sample to be tested (such as peripheral blood from a pregnant woman, semen or tissue sample from a man). If it is peripheral blood, use EDTA anticoagulation, separate the plasma by centrifugation, and extract total cell-free DNA from the plasma using a commercial magnetic bead nucleic acid extraction kit.

[0030] PCR amplification: Take an appropriate amount of PCR reaction system (e.g., 20 μL), including PCR premix, primer-probe mixture, template DNA, and nuclease-free water.

[0031] Amplification was performed on a real-time fluorescence PCR instrument. The recommended reaction program was: pre-denaturation at 95℃ for 2-5 min; followed by denaturation at 95℃ for 15-30 s, annealing / extension at 60℃ for 30-60 s (fluorescence signal was collected during this stage), for 40-45 cycles.

[0032] Result interpretation: Quality control standards: Among the positive control samples, SRY and TSPY1 The CT value of the gene should be ≤ 35, and the internal reference should be... GAPDH There should be normal amplification; in the negative control, SRY and TSPY1 There should be no amplification (no CT value).

[0033] Analysis of the test samples: The presence of the Y chromosome was determined. SRY Genes and TSPY1 The CT values ​​of all genes were ≤ 35. This result indicates the presence of the Y chromosome in the sample. In non-invasive prenatal testing, if the pregnant woman is a carrier of an X-linked genetic disease, this result suggests a risk of fetal disease, requiring further confirmation using other diagnostic methods.

[0034] The Y chromosome was not detected. SRY Genes and TSPY1 None of the genes had CT values, and the internal reference... GAPDH A CT value is present (indicating that the sample quality is acceptable).

[0035] This suggests a possible abnormality in the Y chromosome: like SRY The gene is negative and TSPY1 A positive gene result suggests... SRY The gene region may be missing, which is associated with 46,XY gonadal dysgenesis and has important clinical implications.

[0036] like SRY The gene is positive. TSPY1 The gene was negative, suggesting the presence of the long arm of the Y chromosome (Yq11.2). TSPY1 The region where the gene is located may be deleted. This region is adjacent to the AZF site and can be used as an auxiliary screening indicator for male infertility factors (such as AZF microdeletions).

[0037] The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above description is only a specific embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A method based on SRY and TSPY1 A dual-gene Y chromosome detection fluorescent probe kit, characterized in that, The kit contains: Specific amplification and detection of human SRY The first primer pair and the first fluorescently labeled probe of the gene; Specific amplification and detection of human TSPY1 The second primer pair and the second fluorescently labeled probe of the gene; And specific amplification and detection of human internal reference genes GAPDH The third primer pair and the third fluorescently labeled probe.

2. The reagent kit according to claim 1, characterized in that, The first primer pair is selected from the sequences shown in SEQ ID NO. 1 and SEQ ID NO. 2; The first fluorescently labeled probe is the sequence shown in SEQ ID NO. 3, with a FAM fluorescent reporter group labeled at its 5' end and a BHQ1 quencher group labeled at its 3' end.

3. The reagent kit according to claim 1, characterized in that, The second primer pair is selected from the sequences shown in SEQ ID NO. 4 and SEQ ID NO. 5; The second fluorescently labeled probe is the sequence shown in SEQ ID NO. 6, with a HEX or VIC fluorescent reporter group labeled at its 5' end and a BHQ2 quencher group labeled at its 3' end.

4. The reagent kit according to claim 1, characterized in that, The third primer pair is selected from the sequences shown in SEQ ID NO. 7 and SEQ ID NO. 8; The third fluorescently labeled probe is the sequence shown in SEQ ID NO. 9, with a ROX or CY5 fluorescent reporter group labeled at its 5' end and a BHQ3 quencher group labeled at its 3' end.

5. The kit according to any one of claims 1-4, characterized in that, The first, second, and third primer pairs and the corresponding fluorescently labeled probes are configured to enable multiplex quantitative PCR reactions to be performed in the same reaction tube.

6. A reaction solution for nucleic acid amplification, characterized in that, The kit comprises the first, second, and third primer pairs and corresponding fluorescently labeled probes, hot-start DNA polymerase, dNTPs, magnesium ions, and PCR buffer as described in any one of claims 1-5.

7. The use of the kit according to any one of claims 1-5 or the reaction solution according to claim 6 in the preparation of products for assisting in the diagnosis of Y-chromosome-linked genetic diseases, products for assessing the integrity of key gene regions of the fetal Y chromosome, and products for assisting in the diagnosis of factors related to male infertility.

8. A method for detecting the presence and integrity of the Y chromosome, characterized in that, Includes the following steps: (1) Obtain the sample to be tested and extract genomic DNA from it; (2) Using the DNA extracted in step (1) as a template, perform a real-time PCR amplification reaction using the kit described in any one of claims 1-5 or the reaction solution described in claim 6; (3) Analyze the amplification results, based on SRY Genes and TSPY1 The detection of fluorescent signals in genes helps determine the presence of the Y chromosome and the integrity of key regions.

9. The method according to claim 8, characterized in that, The result interpretation in step (3) includes: like SRY Genes and TSPY1 If all genes are effectively detected, it is determined that the Y chromosome is present; like SRY Genes and TSPY1 None of the genes were detected, and the internal reference gene was also undetectable. GAPDH If it is effectively detected, it is determined that the Y chromosome was not detected; like SRY Genes and TSPY1 If only one gene is detected, it suggests that there may be a deletion or mutation in the region of the Y chromosome corresponding to the undetected gene.

Images