InDel molecular marker related to flower stalk anthocyanin accumulation in brassica napus bolting period and application of InDel molecular marker

Abstract

The invention belongs to the technical field of genetic breeding of rape, and particularly discloses an InDel molecular marker related to anthocyanin accumulation of a flowering stalk in a brassica napus bolting period and application of the InDel molecular marker. The InDel molecular marker provided by the invention is closely linked with the enrichment of anthocyanin in brassica napus flower stems, and the marker is used for detecting early seedlings of brassica napus, so that whether the flower stems of brassica napus varieties have anthocyanin accumulation in a bolting period or not can be accurately and efficiently identified in an early stage; the variety of the purple-bolted brassica napus with the flower stems rich in anthocyanin under the natural condition can be identified under the condition that illumination is weak and anthocyanin accumulation is not facilitated, and rapid breeding of the purple-bolted brassica napus with the flower stems having anthocyanin accumulation can be carried out in a greenhouse. Compared with an identification technology of other marker types such as SNP, a reagent developed based on the InDel molecular marker can complete detection by utilizing common PCR and agarose gel electrophoresis, sequencing is not needed, the operation is simple, convenient and rapid, and the cost is low.

Description

Technical Field

[0001] This invention belongs to the field of rapeseed genetic breeding technology, specifically involving the InDel molecular marker and its application related to anthocyanin accumulation in the flower stems of Brassica napus during the bolting stage. Background Technology

[0002] Rapeseed, primarily cultivated as Brassica napus (AACC, 2n=38), belongs to the Brassica genus of the Brassicaceae family. It is a hybrid variety evolved from Chinese cabbage and cabbage through interspecific hybridization and chromosome doubling. In the past five years, the planting area and rapeseed yield of rapeseed have shown a steady upward trend.

[0003] Rapeseed's versatility is reflected in multiple dimensions. Besides being an important oilseed crop, it also has value for honey production, animal feed, fertilizer, flowering (tourism, leisure, and sightseeing), and vegetable production (sprouting). Among these, the rapeseed bolting stem, the main stem or branching sprout that emerges during the bolting stage, is a key storage organ for nutrients. It is known for its robust shape, crisp and juicy texture, and sweet aftertaste. Rich in vitamin C, it has the effects of lowering blood lipids and strengthening the body.

[0004] Studies have reported that anthocyanins possess remarkable antioxidant and anti-inflammatory bioactivities, and their accumulation in rapeseed flower stalks can significantly enhance the nutritional value of rapeseed. Therefore, cultivating new rapeseed varieties with anthocyanins-rich flower stalks is of profound significance for expanding the multifunctional utilization of rapeseed. Chinese patent CN115725772B (Shenyang Agricultural University) discloses an InDel molecular marker for identifying the seed coat color of Chinese cabbage-type rapeseed. The development process includes: constructing an F2 segregating population using brown-seeded material CSSL-38 and yellow-seeded material RcBr as parents; genetic analysis indicating that yellow seed color is controlled by a single recessive gene; and locating the Chinese cabbage-type rapeseed seed coat color gene within a 41.1 kb region on chromosome A03 of the Chinese cabbage genome. Further analysis identified the BrSCC1 (BraA03g040800.3C) gene as a candidate gene controlling the seed coat color of Chinese cabbage-type rapeseed. Subsequently, comparison of resequencing results between the brown-seeded parent CSSL-38 and the yellow-seeded parent RcBr revealed that, compared to parent CSSL-38, the BrSCC1 gene in parent RcBr has a 19-kb segment on its third exon. The deletion of bp, with the nucleotide sequence GTGAACTGGAGGGTTTTCA, was verified using primer design software to design upstream and downstream primers flanking the mutation site. The results showed that when the characteristic band of the amplified product was 180 bp, the seed coat color of the self-pollinated seeds of this type of rapeseed was brown; when the characteristic band of the amplified product was 161 bp, the seed coat color was yellow; when both 180 bp and 161 bp were present, the seed coat color was a mixture of brown and yellow. This indicates that the InDel molecular marker is 100% accurate in identifying the seed coat color of this type of rapeseed.

[0005] However, materials with anthocyanin accumulation characteristics in the flower stems of Brassica napus are currently scarce. In traditional breeding processes, the selection of stem bark color mainly relies on manual naked-eye observation, which is not only inefficient but also highly susceptible to environmental interference. With the rapid development of molecular marker technology, screening for target traits through molecular markers has become a core method in modern breeding. Developing functional molecular markers that can accurately, rapidly, and efficiently identify whether the stem bark of Brassica napus is enriched with anthocyanins during the bolting stage in the early seedling stage, and that can accurately distinguish between purple and green bolting varieties of Brassica napus, is of great value for breeding anthocyanin-rich purple bolting varieties and accelerating the multifunctional development and utilization of rapeseed. Summary of the Invention

[0006] The main technical problem solved by this invention is to provide an InDel molecular marker related to anthocyanin accumulation in the flower stems of Brassica napus during the bolting stage. This molecular marker can be used to accurately, rapidly and efficiently identify whether rapeseed varieties have anthocyanin accumulation in the flower stems during the bolting stage at an early stage, so as to distinguish between purple and green bolting rapeseed varieties. This provides a simple, efficient and low-cost molecular marker for molecular-assisted selection of new anthocyanin-rich purple bolting varieties of Brassica napus in the future.

[0007] Secondly, this invention provides an application of the InDel molecular marker related to anthocyanin accumulation in the flower stems of Brassica napus during the bolting stage.

[0008] Furthermore, this invention provides a reagent for identifying InDel molecular markers associated with anthocyanin accumulation in the flower stalks of Brassica napus during the bolting stage.

[0009] To solve the above-mentioned technical problems, the present invention provides the following technical solutions: InDel molecular markers associated with anthocyanin accumulation in flower stalks during the bolting stage of Brassica napus, wherein the InDel molecular markers contain nucleotide sequences as shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0010] Specifically, the source sequence of the InDel molecular marker in *Brassica napus* var. *purpureus* with anthocyanin accumulation in its flowering stems during the bolting stage is shown in SEQ ID NO: 1, and the source sequence of the InDel molecular marker in *Brassica napus* var. *greenaniae* without anthocyanin accumulation in its flowering stems during the bolting stage is shown in SEQ ID NO: 2. *Brassica napus* var. *purpureus* has a 10.48 kb InDel mutation (positions 219-10,698 in SEQ ID NO: 2) compared to *Brassica napus* var. *greenaniae*.

[0011] Applications of InDel molecular markers related to anthocyanin accumulation in flower stalks during the bolting stage of Brassica napus include, but are not limited to, one or more of the following: (1) Application in identifying whether there is anthocyanin accumulation in the flower stems of Brassica napus during the bolting stage; (2) Application in distinguishing between purple-sprouting and green-sprouting rapeseed in the early seedling stage; (3) Application in the cultivation of new varieties of Brassica oleracea purple shoots rich in anthocyanins.

[0012] As a preferred embodiment of the present invention, the application includes: Design specific primer pairs based on the sequence differences of the InDel molecular markers; Using genomic DNA from the sample to be tested as a template, PCR amplification was performed using specific primer pairs; The determination is based on the nucleotide sequence and / or length of the amplified product.

[0013] Specifically, the primer pair comprises two upstream primers and one downstream primer, with the nucleotide sequences shown below: Upstream primer PF1: 5'-GAAGGGTAGGCAAGTCCAAC-3'; Upstream primer PF2: 5'-AAGAGGAAGAGGAGTGCTTGT-3'; Downstream primer PR: 5'-CGAGCCCAAACCAGATCAGA-3'.

[0014] Specifically, the amplification product sequence of purple-sprouted rapeseed is shown in SEQ ID NO: 1, and the amplification product sequence of green-sprouted rapeseed is shown in SEQ ID NO: 6.

[0015] Specifically, the amplification product length of purple-sprouted rapeseed was 299 bp, and the amplification product length of green-sprouted rapeseed was 463 bp.

[0016] A reagent for identifying InDel molecular markers associated with anthocyanin accumulation in flower stalks during the bolting stage of Brassica napus, comprising specific primers and / or probes designed based on sequence differences of the InDel molecular markers.

[0017] In a preferred embodiment of the present invention, a specific primer pair is designed based on the sequence differences of the InDel molecular marker, comprising two upstream primers and one downstream primer, the nucleotide sequences of which are shown below: Upstream primer PF1: 5'-GAAGGGTAGGCAAGTCCAAC-3'; Upstream primer PF2: 5'-AAGAGGAAGAGGAGTGCTTGT-3'; Downstream primer PR: 5'-CGAGCCCAAACCAGATCAGA-3'.

[0018] In a preferred embodiment of the present invention, the reagents further include DNA polymerase and Mg. 2+ One or more of dNTPs, etc.

[0019] This invention provides an InDel molecular marker that can identify and distinguish between purple and green-sprouted Brassica napus varieties based on whether their flower stems accumulate anthocyanins during the bolting stage. Using this marker to detect early-stage Brassica napus seedlings allows for accurate, rapid, and efficient identification of whether rapeseed varieties accumulate anthocyanins in their flower stems during the bolting stage. Furthermore, even in light-enhanced cultivation chambers where low light levels are unfavorable for anthocyanin accumulation, it accurately and rapidly identifies purple-sprouted Brassica napus varieties with anthocyanin-rich flower stems under natural conditions. This facilitates the rapid breeding of purple-sprouted Brassica napus varieties with anthocyanin-rich flower stems using greenhouses.

[0020] Purple-flowering Brassica napus with anthocyanin accumulation on its flower stalks during the bolting stage not only possesses high ornamental value but also has potential applications in improving human nutrition and health, which is conducive to promoting the multifunctional development and economic benefits of Brassica napus. The InDel molecular marker provided by this invention is closely linked to the purple-flowering trait of anthocyanin accumulation on the flower stalks during the bolting stage of Brassica napus. It can be used for molecular assistance in the early identification of anthocyanin-rich purple-flowering Brassica napus, significantly shortening the breeding cycle and providing an efficient, convenient, and low-cost molecular tool for the early molecular-assisted selection of new anthocyanin-rich purple-flowering Brassica napus varieties.

[0021] The reagents developed based on this InDel molecular marker, compared to other marker-based identification techniques such as SNPs, can be detected using conventional PCR and agarose gel electrophoresis, eliminating the need for sequencing. This method is simple, rapid, and cost-effective. In specific experiments, the InDel molecular marker was validated in different green and purple-sprouting varieties of Brassica napus, achieving 100% accuracy. Therefore, using this molecular marker for early identification of anthocyanin accumulation in the flower stalks of Brassica napus during bolting is accurate and reliable. Attached Figure Description

[0022] Figure 1 In the experimental example, the BSR technology was used to initially locate the associated sites that control anthocyanin accumulation in the flower stems of Brassica napus during the bolting stage; The figure shows a Manhattan plot of the SNP-index or Δ(SNP-index) value of each SNP calculated based on DNA pooling sequencing; the horizontal axis represents the chromosome name, and the black line represents the value after sliding window fitting of the SNP-index or Δ(SNP-index). A: Manhattan plot of SNP-index values ​​for mixed pools of DNA from green-sprouted rapeseed; B: Manhattan plot of SNP-index values ​​for mixed pools of DNA from purple-sprouted rapeseed; C: Manhattan plot of Δ(SNP-index) values, where the red line represents the 99th percentile threshold.

[0023] Figure 2 In the experimental example Pfs-C06 Map-based cloning of loci; A: Pfs-C06 A: Initial location of chromosomal segment markers; B: Utilizing newly developed marker typing results in conjunction with phenotypes. Pfs-C06 Fine-tuning of the site; C: Pfs-C06 Locus fine-mapping interval; D: Candidate gene display.

[0024] Figure 3 For the green rapeseed J9707, ZS11 and purple rapeseed S100 in the experimental examples BnaC06.PAP2c A schematic diagram of the differential sequence structure of the promoter region of the gene (A) and the typing results of some plants in the F2 population based on the PfsC06-Tran molecular marker developed based on this difference (B).

[0025] Figure 4 This is a verification result showing that the PfsC06-Tran molecular marker in the experimental example can be used for rapid and stable screening of purple and green rapeseed.

[0026] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings obtained in the experimental examples have been briefly described above. It should be understood that the above drawings only show some experimental examples of the present invention and should not be considered as any limitation on the scope of protection of the claims. For those skilled in the art, other related drawings can be obtained based on these drawings without any creative effort. Detailed Implementation

[0027] The technical solution of the present invention will be clearly and completely described below with reference to specific embodiments and experimental examples. However, those skilled in the art should understand that the embodiments are only used to illustrate the technical solution of the present invention and should not be regarded as limiting the scope of protection of the present invention. Based on the following embodiments, all other implementation schemes obtained by those skilled in the art without creative effort, such as implementation schemes obtained by modification, variation or simple substitution, should fall within the scope of protection of the present invention.

[0028] Unless otherwise specified, the experimental methods used in the following examples and experimental cases are conventional methods; the raw materials (including biological materials), reagents, culture media, instruments, etc. used are all commonly used in the field and commercially available to the public unless otherwise specified; the terms and abbreviations used have their conventional meanings in the field, such as PBS buffer being phosphate buffer.

[0029] Example This embodiment provides an InDel molecular marker related to anthocyanin accumulation in the flower stems of Brassica napus during the bolting stage, comprising the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2. Specifically, the source sequence at the InDel molecular marker for purple-sprouting Brassica napus with anthocyanin accumulation in its flower stems during the bolting stage is shown in SEQ ID NO: 1, and the source sequence at the InDel molecular marker for green-sprouting Brassica napus without anthocyanin accumulation in its flower stems during the bolting stage is shown in SEQ ID NO: 2.

[0030] This embodiment provides an application of the InDel molecular marker related to anthocyanin accumulation in the flower stems during the bolting stage of Brassica napus, including but not limited to one or more of the following aspects: (1) Application in identifying whether there is anthocyanin accumulation in the flower stems of Brassica napus during the bolting stage; (2) Application in distinguishing between purple-sprouting and green-sprouting rapeseed in the early seedling stage; (3) Application in the cultivation of new varieties of Brassica oleracea purple shoots rich in anthocyanins.

[0031] Specifically, the application in distinguishing between purple and green-sprouted rapeseed in the early seedling stage includes: Specific primer pairs were designed based on the sequence differences of the InDel molecular marker, consisting of two upstream primers and one downstream primer, with the nucleotide sequences shown below: Upstream primer PF1: 5'-GAAGGGTAGGCAAGTCCAAC-3'; Upstream primer PF2: 5'-AAGAGGAAGAGGAGTGCTTGT-3'; Downstream primer PR: 5'-CGAGCCCAAACCAGATCAGA-3'; Using genomic DNA from the sample to be tested as a template, PCR amplification was performed using specific primer pairs; The determination was made based on the nucleotide sequence and / or length of the amplified product. The amplified product of purple rapeseed was 299 bp in length, as shown in SEQ ID NO: 1, and the amplified product of green rapeseed was 463 bp in length, as shown in SEQ ID NO: 6.

[0032] This embodiment also provides a reagent for identifying InDel molecular markers associated with anthocyanin accumulation in the flower stalks of Brassica napus during bolting, comprising the aforementioned specific primer pair, as well as DNA polymerase and Mg... 2+ dNTP, etc. (available commercially; follow the instructions).

[0033] In other embodiments of the present invention, other specific primers and / or probes can be designed based on the sequence differences of the InDel molecular marker.

[0034] Experimental Example The discovery of associated loci controlling anthocyanin accumulation in the flower stalk during the bolting stage in Brassica napus included the following steps: (1) Identification of the regulatory sites for the purple bolting trait that control anthocyanin accumulation in the flower stalks of Brassica napus. To determine the genetic characteristics of the purple bolting trait, the F1 generation was obtained by crossing S100 (a purple bolting Brassica napus variety with anthocyanin accumulation in its flower stalks at the bolting stage) and J9709 (a green bolting Brassica napus variety with no anthocyanin accumulation in its flower stalks at the bolting stage). The F1 plants obtained from reciprocal crosses all exhibited purple bolting bark, but the color was lighter than that of S100, and the phenotype was stable. The F1 plants were bagged and self-pollinated to obtain the F2 segregating population. Phenotypic observation of the bolting bark of the F2 population revealed significant differences between the light purple, purple, and green phenotypes. In the F2 population, there were 552 purple-stemmed plants, 1005 light purple-stemmed plants, and 497 green-stemmed plants, conforming to Mendelian segregation law of 1:2:1, indicating that the purple bolting trait in Brassica napus with anthocyanin accumulation in its flower stalks at the bolting stage is controlled by a pair of incompletely dominant nuclear genes.

[0035] Sixteen plants each of the extreme purple and green *Sedum aizoon* species were selected from the F2 segregating population. Equal amounts of RNA were extracted from the stem bark of the flowering stems at the bolting stage and mixed to construct two RNA pools: one for purple *Sedum aizoon* and one for green *Sedum aizoon*. Sequencing was performed on both pools using next-generation high-throughput sequencing technology. After filtering low-quality data, 354.57 Mb and 369.48 Mb of clean reads were obtained from the purple and green *Sedum aizoon* pools, respectively. These were compared with the ZS11 reference genome (ZS11.v0: https: / / yanglab.hzau.edu.cn / BnIR / germplasm_info?id=ZS11.v0), with alignment efficiencies of 88.40% and 88.08%, respectively. This indicates that the sequencing data for each sample was sufficient and of acceptable quality, suitable for subsequent variant detection and related analysis. Based on the resequencing results of both parents, 115,736 high-quality, reliable SNP loci were obtained, and the SNP-indexes for the two extreme pools were calculated. Δ(SNP-index) was calculated by subtracting the SNP-index of the corresponding SNP in the purple mixed pool from the SNP-index of the green mixed pool. Figure 1 To eliminate false positive sites, the DISTANCE method was used to fit the Δ(SNP-index) value, and then regions associated with the trait were identified based on the association threshold. Through the above BSR analysis, the associated region C06: 43.15-49.66 Mb was identified on chromosome C06, named... Pfs- C06 .

[0036] (2) Pit sites of purple peony Pfs-C06 Precise positioning The F2 population (2054 plants) constructed by crossing S100 and J9709 was used for further research. Pfs-C06Fine-grained locus mapping was performed. The bolting phenotype of each rapeseed plant in the F2 population was identified and statistically analyzed, and the plants were numbered. DNA was extracted from young leaves, and genotyping was conducted using KASP markers designed for the associated region C06: 43.15-49.66 Mb. Because the intermediate light purple and purple bolting traits are easily influenced by the environment, to ensure mapping accuracy, plants exchanging between homozygous and heterozygous S100 genotypes were excluded; only plants with dark purple and green bolting were selected for mapping. Pfs-C06 Locator map cloning.

[0037] First, exchangeable single plants were selected by flanking KASP25, KASP24, and KASP21 of the four candidate genes initially located within the 6.51 Mb interval. Figure 2 A). Specifically, KASP25 (42.76 Mb) and KASP24 (43.26 Mb) were used to screen 12 and 18 exchangeable plants from 375 extreme green plants and 558 extreme purple plants, respectively. KASP24 (43.26 Mb) and KASP21 (48.10 Mb) were used to screen 11 and 31 exchangeable plants from 375 extreme green plants and 558 extreme purple plants, respectively, for a total of 72 exchangeable plants. Pfs-C06 The locus range was narrowed down to 42.76-48.10 Mb. Next, the genotypes of 72 exchanged monoclonal isolates were analyzed using KSAP6 and KASP17 markers located at 43.38 Mb and 46.79 Mb on chromosome C06, respectively. Based on the exchange pattern, the target gene was located at 42.76-46.79 Mb. Subsequently, using KASP27 (43.22 Mb) and KASP7 (43.56 Mb), 8 exchanged monoclonal isolates were identified. Combined with the phenotypic identification results, the Pfs-C06 locus was narrowed down to 43.22-43.56 Mb. Figure 2 B). Within the narrowed interval, the eight individual plants were analyzed using KASP28 and KASP29 markers. Combined with the phenotypic identification results, the interval was narrowed down to 43.22-43.49 Mb. Then, within this narrowed interval, one exchanged plant was identified using the KASP30 marker (43.39 Mb). Based on the genotype and phenotypic identification results of this exchanged plant, and combined with the sequence information of chromosome C06 in the ZS11 reference genome, the Pfs-C06 site was finally located within a 173.51 kb interval between the KASP27 and KASP30 markers, with a physical distance of 43.22-43.39 Mb. Figure 2 C).

[0038] (3) Identification of candidate genes for regulating traits in purple peony Combining gene function annotation of ZS11 in this region from the reference genome and gene expression differential information obtained from BSR sequencing, only 5 genes showed differential expression between the two extreme pools within the 173.51 kb fine-mapping region. These are, in order: BnaC06G0328300ZS , BnaC06G0328600ZS , BnaC06G0329000ZS , BnaC06G0329100 ZS and BnaC06G0329200ZS . BnaC06G0329100ZS It is a transcription factor that regulates anthocyanin accumulation in Arabidopsis thaliana. PAP2 ( MYB90 This gene is a homolog of [a specific gene], and has been reported to participate in the regulation of anthocyanin biosynthesis (Table 1). Combining fine mapping results, gene function annotation information, and differential gene expression analysis, it can be inferred that [the gene is involved in the regulation of anthocyanin biosynthesis]. BnaC06G0329100ZS (named) BnaC06.PAP2c () is a regulator of the traits of purple peony Pfs-C06 Candidate genes at the locus ( Figure 2 D).

[0039] Table 1. Identification of differentially expressed genes in candidate regions of chromosome C06 in *Raphanus sativus*

[0040] (4) Develop InDel molecular markers associated with traits of purple peony Using the ZS11 reference genome ZS11.V0 as a reference, clones of ZS11, J9707, and S100 were created. BnaC06.PAP2c The full-length gene and promoter region sequence were obtained and sequence alignment analysis was performed. During the cloning process, it was found that the ZS11 and J9709 genes actually have a 10.48 kb fragment (CMC-EnSpm type transposon) inserted upstream of the codon (-824 bp), while the S100 promoter region does not have this sequence insertion. Figure 3 A). The source sequence of the purple-stalked Brassica napus phenotype here is shown in SEQ ID NO: 1, and the source sequence of the green-stalked Brassica napus phenotype here is shown in SEQ ID NO: 2.

[0041] The source sequence of the purple-flowered Brassica napus phenotype at this location is as follows: GAAGGGTAGGCAAGTCCAACTTTGGACTCGGTTACAAAGGGGTGCAAAACTACAGTAAAACAGAGTTTGTTCGGACTAAGACTTAAGAGATTAGCTATGATACAGGAAGAAAGTATCAACCATGATCATCTATTGTAAACCAGTAAGAACC ATAATGGAGGCTACTTCTGTGGTAAATACATGCACATTGCAAGATATACTTACAAATTTCGAAACAGAATCACTCCATATTTGACTTTGCTTTCCAATCTTTACTGCTTTATGTAACTTGTTAACTAGTCTGATCTGGTTTGGGCTCG (SEQ ID NO: 1).

[0042] The source sequence of the green-stalked phenotype of Brassica napus at this location is as follows:

[0043] Based on the difference in the InDel sequence between loci 43329913-43340693 on chromosome C06 of *Brassica napus* var. *purpureus*, a specific primer pair was designed, consisting of upstream primers F1 (43329913-43329932) and F2 (43340231-43340251) and downstream primer R (43340674-43340693).

[0044] The primer pair (2 upstream primers and 1 downstream primer) sequences are shown below: Upstream primer PF1: 5'-GAAGGGTAGGCAAGTCCAAC-3' (SEQ ID NO: 3); Upstream primer PF2: 5'-AAGAGGAAGAGGAGTGCTTGT-3' (SEQ ID NO: 4); Downstream primer PR: 5'-CGAGCCCAAACCAGATCAGA-3' (SEQ ID NO: 5).

[0045] Using genomic DNA as a template, PCR amplification was performed using the primer pairs described above. The amplified sequence of the purple-flowered rapeseed (Brassica napus) phenotype is shown below: GAAGGGTAGGCAAGTCCAACTTTGGACTCGGTTACAAAGGGGTGCAAAACTACAGTAAAACAGAGTTTGTTCGGACTAAGACTTAAGAGATTAGCTATGATACAGGAAGAAAGTATCAACCATGATCATCTATTGTAAACCAGTAAGAACC ATAATGGAGGCTACTTCTGTGGTAAATACATGCACATTGCAAGATATACTTACAAATTTCGAAACAGAATCACTCCATATTTGACTTTGCTTTCCAATCTTTACTGCTTTATGTAACTTGTTAACTAGTCTGATCTGGTTTGGGCTCG (SEQ ID NO: 1, 299 bp in total).

[0046] The amplified sequences of the green-stalked phenotype of Brassica napus are shown below: AAGAGGAAGAGGAGTGCTTGTATTTATAGTTTAAATCTTGCCGACAGACCGAGGAAATTCCGACGGAATTCCGACGGAAAAGGCTAGTTCGTCGGAATTTCCTCGGAATTTTGTAAAATCCCCCAACGGCTCTCCAACGGCTATAATATTTCCTCGGAATTCATCGGTTTTTTCCGAGGAACCCATTTTTCCTCGGAATTTCCTCAGAATATTCCGACGGATTGATATTTCCT CGGAATTCCGTCGGTATATTCCGAGGAAATTCCGAGGAAACCCAATTTTGTGTTTCCTCGGAATTTCCTCGGAAATTCCTCGGGATATTCCGAGGATTTCATTTTCCGTCGGAATGTCCGTCAGAATACCGATGTTTTCTTGTAGTGAGAATCACTCCATATTTGACTTTGCTTTCCAATCTTACTGCTTTATGTAACTTGTTAACTAGTCTGATCTGGTTTGGGCTCG (SEQ ID NO: 6, total 463 bp).

[0047] Genotyping of the F2 population and parents was performed using the designed marker (named PfsC06-Tran). The PCR amplification product of green-flowered plants was approximately 460 bp, indicating the presence of the aforementioned transposon fragment in the promoter region of the BnaC06.PAP2c gene. The PCR amplification product of plants with dark purple flower stems was approximately 300 bp, indicating the absence of the aforementioned transposon fragment in the promoter region of the BnaC06.PAP2c gene. Plants with light purple flower stems produced two PCR amplification products, approximately 460 bp and 300 bp in size, respectively, indicating a heterozygous genotype. Figure 3 B). Population PCR amplification and agarose gel electrophoresis results showed that the marker was closely linked to the Aster tataricus phenotype.

[0048] The PCR expansion reaction system and reaction conditions are shown in Tables 2 and 3, respectively.

[0049] Table 2 PCR amplification reaction system

[0050] Table 3 PCR amplification reaction conditions

[0051] (5) Identification of purple-green rapeseed varieties using PfsC06-Tran molecular markers Different varieties of purple and green-sprouted rapeseed were selected based on whether their flower stalks accumulated anthocyanins during the bolting stage. In the early seedling stage, the flower stalk color phenotype could not be determined. At this time, young leaves were taken, genomic DNA was extracted, and PCR amplification was performed using the primer pairs described above (reaction system and conditions are shown in Tables 2-3). After PCR, agarose gel electrophoresis was performed, and the flower stalk color phenotype at the bolting stage could be clearly determined based on the band size. Figure 4 ).

[0052] The results showed that the band corresponding to the green-flowering phenotype of Brassica napus at the bolting stage was a single band, with a size of 463 bp; the band corresponding to the purple-flowering phenotype of Brassica napus at the bolting stage was also a single band, with a size of 299 bp; and no band was observed in non-Brassica napus varieties (purple-leafed Chinese cabbage). This indicates that the molecular marker PfsC06-Tran can accurately and rapidly identify purple-flowering and green-flowering Brassica napus varieties in the early seedling stage.

[0053] The above experimental results show that the molecular markers provided by this invention are closely associated with the purple bolting phenotype of Brassica napus, which is characterized by anthocyanin accumulation in the flower stems during the bolting stage. This marker can be used for early molecular assistance in identifying purple-green bolting Brassica napus, significantly shortening the breeding cycle. It also provides an efficient molecular tool for breeding new purple bolting Brassica napus varieties rich in anthocyanins, contributing to the multifunctional development and industrial upgrading of rapeseed. Furthermore, the molecular markers developed in this invention can assist in the efficient breeding of new purple bolting Brassica napus varieties in greenhouses. Because greenhouses typically have insufficient light and weak anthocyanin accumulation, the PfsC06-Tran molecular marker-assisted screening can accurately and conveniently screen for materials that will accumulate anthocyanins in the flower stems during the bolting stage, promoting the efficient breeding of new purple bolting Brassica napus varieties.

[0054] Although the technical solution of the present invention has been described in detail above with general descriptions, specific embodiments, and experimental examples, it should be noted that the embodiments and experimental examples are only used to illustrate the technical solution and technical effects of the present invention, and should not be regarded as any limitation on the scope of protection of the present invention. Simple modifications, alterations, or improvements made based on the technical concept of the present invention are all within the scope of protection claimed by the present invention.

Claims

1. An InDel molecular marker associated with anthocyanin accumulation in the flower stalks of Brassica napus during bolting, characterized by: The InDel molecular marker contains a nucleotide sequence as shown in SEQ ID NO:1 or SEQ ID NO:

2.

2. The InDel molecular marker according to claim 1, characterized in that: The source sequence of the purple-sprouted rapeseed at the InDel molecular marker is shown in SEQ ID NO: 1, and the source sequence of the green-sprouted rapeseed with no anthocyanin accumulation on the flower stem during the bolting stage is shown in SEQ ID NO:

2.

3. The application of the InDel molecular markers related to anthocyanin accumulation in flower stalks during the bolting stage of Brassica napus, as described in claim 1 or 2, is characterized in that: Including but not limited to one or more of the following aspects: (1) Application in identifying whether there is anthocyanin accumulation in the flower stems of Brassica napus during the bolting stage; (2) Application in distinguishing between purple-stalked and green-stalked rapeseed during the seedling stage; (3) Application in the cultivation of new varieties of Brassica oleracea purple shoots rich in anthocyanins.

4. The application according to claim 3, characterized in that: The applications include: Design specific primer pairs based on the sequence differences of the InDel molecular markers; Using genomic DNA from the sample to be tested as a template, PCR amplification was performed using specific primer pairs; The determination is based on the nucleotide sequence and / or length of the amplified product.

5. The application according to claim 4, characterized in that: The primer pair consists of two upstream primers and one downstream primer, with the following nucleotide sequences: Upstream primer PF1: 5'-GAAGGGTAGGCAAGTCCAAC-3'; Upstream primer PF2: 5'-AAGAGGAAGAGGAGTGCTTGT-3'; Downstream primer PR: 5'-CGAGCCCAAACCAGATCAGA-3'.

6. The application according to claim 5, characterized in that: The amplification product sequence of the purple-sprouted rapeseed is shown in SEQ ID NO: 1, and the amplification product sequence of the green-sprouted rapeseed is shown in SEQ ID NO:

6.

7. The application according to claim 5, characterized in that: The amplification product of the purple-striped rapeseed was 299 bp in length, and the amplification product of the green-striped rapeseed was 463 bp in length.

8. A reagent for identifying the InDel molecular markers as described in claim 1 or 2 that are associated with anthocyanin accumulation in the flower stalks of Brassica napus during bolting, characterized in that: It includes specific primers and / or probes designed based on the sequence differences of the InDel molecular marker.

9. The reagent according to claim 8, characterized in that: Specific primer pairs were designed based on the sequence differences of the InDel molecular marker, consisting of two upstream primers and one downstream primer, with the nucleotide sequences shown below: Upstream primer PF1: 5'-GAAGGGTAGGCAAGTCCAAC-3'; Upstream primer PF2: 5'-AAGAGGAAGAGGAGTGCTTGT-3'; Downstream primer PR: 5'-CGAGCCCAAACCAGATCAGA-3'.

10. The reagent according to claim 8, characterized in that: The reagents also include DNA polymerase and Mg. 2+ One or more of dNTPs.

Images