Application of targeted JOSD1 inhibitor in preparation of tumor treatment medicine

By targeting and inhibiting JOSD1, blocking its interaction with PGAMA1, and regulating glycolytic activity, the problem of JOSD1 promoting metabolic reprogramming and immune escape in HCC was solved, thereby improving the efficacy of tumor growth inhibition and immunotherapy.

CN121622902APending Publication Date: 2026-03-10JIANGSU PROVINCE HOSPITAL (THE FIRST AFFILIATED HOSPITAL OF NANJING MEDICAL UNIVERSITY)
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610045708.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-14
Publication Date
2026-03-10

AI Technical Summary

Technical Problem

In the existing technology, how JOSD1 affects the metabolic reprogramming and immune escape of tumor cells by regulating the post-modification interaction of glycolytic enzymes is not fully understood in hepatocellular carcinoma, and the effect of targeted therapy on HCC is limited.

Method used

Targeted inhibition of JOSD1 can be achieved by suppressing JOSD1 activity through siRNA, shRNA, antibodies, or small molecule compounds, interfering with its interaction with PGAM1, blocking its deubiquitination and lactation modifications, regulating glycolytic activity, and restoring the immune system's surveillance of tumors.

Benefits of technology

It effectively inhibits tumor growth, restores the immune system's surveillance of tumors, and enhances the sensitivity of hepatocellular carcinoma cells to PD-1 therapy, providing a new treatment strategy with broad prospects for clinical translation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121622902A_ABST
    Figure CN121622902A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of biological medicine, and particularly relates to application of a targeted JOSD1 inhibitor in preparation of tumor treatment drugs. Researches find that deubiquitinating enzyme JOSD1 is highly expressed in HCC and is closely related to poor prognosis of a patient. The JOSD1 stabilizes PGAM1 protein on a key lysine site by regulating ubiquitination-lactic acid post-modification (PTM) interaction of a glycolysis key enzyme PGAM1, enhances the enzymatic activity and lactic acid generation of the PGAM1 protein, and promotes glycolysis metabolism and malignant progression of tumor cells. The accumulation of lactic acid causes infiltration and function inhibition of CD8T cells, so that an immunosuppressive tumor microenvironment is formed. Targeted inhibition of JOSD1 can significantly reduce the proliferation and transfer ability of HCC cells and recover immune response. Animal experiments show that the liver-specific JOSD1 inhibitor can effectively inhibit tumor progression and has a remarkable synergistic effect with anti-PD-1 immunotherapy, and the lifetime is prolonged.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of life science research, specifically to the use of JOSD1-targeting inhibitors in the preparation of tumor therapeutic drugs. Background Technology

[0002] Hepatocellular carcinoma (HCC) is the most common malignant tumor of the liver worldwide, ranking among the top cancers in terms of incidence and mortality. According to the World Health Organization, HCC is the third leading cause of cancer death globally, after lung and stomach cancer. Despite the adoption of various treatment methods in recent years, including surgery, liver transplantation, targeted therapy, and immunotherapy, the prognosis of HCC remains poor, especially in advanced and metastatic cases, where patient survival and treatment outcomes are severely limited. Therefore, developing new treatment strategies and targeted therapies has become an important direction in HCC research.

[0003] The occurrence and development of hepatocellular carcinoma (HCC) are closely related to multiple factors, including hepatitis virus infection (such as hepatitis B and C virus infection), long-term alcohol consumption, and the presence of chronic liver diseases such as fatty liver. However, recent studies have shown that the molecular mechanisms of liver cancer are not limited to traditional pathogenic factors, but also involve more complex molecular-level changes, especially the emergence of metabolic reprogramming. Metabolic reprogramming is one of the key means for cancer cells to maintain their rapid proliferation, adapt to environmental changes, and resist treatment stress. Enhanced glycolysis, often referred to as the Warburg effect, is a common feature of many tumor cells, especially evident in HCC.

[0004] Altered glycolytic metabolism is not only a key characteristic of tumor cell energy metabolism, but it also induces a series of changes affecting immune function within the tumor microenvironment (TME). In the HCC immune microenvironment, lactate accumulation and an acidic environment caused by metabolic reprogramming recruit immunosuppressive cells (such as M2 macrophages and regulatory T cells) and promote immune escape, allowing tumors to continue growing under immune surveillance. Therefore, glycolytic metabolism not only affects tumor proliferation but also exerts a profound regulatory effect on immune cell function by altering the immune microenvironment.

[0005] Beyond transcriptional regulation, a growing body of research indicates that post-modification mechanisms (PTMs) play a crucial role in regulating metabolic reprogramming. PTMs, including ubiquitination, acetylation, and lactation, are key mechanisms regulating protein function, stability, and interactions. In particular, the interaction between ubiquitination and lactation (i.e., PTM crosstalk) plays a vital role in the regulation of glycolysis and other metabolic pathways. Ubiquitination, a common protein degradation mechanism, promotes protein degradation via the proteasome by adding ubiquitin molecules to label proteins, while lactation, a relatively new form of modification, alters protein function or interactions through the addition of lactate. Although some studies have revealed the roles of these modifications in tumor cell metabolism, the synergistic effects and mutual regulatory mechanisms between them are not fully understood, especially in hepatocellular carcinoma (HCC). How to influence metabolic reprogramming and immune escape in tumor cells by regulating these PTMs remains a pressing scientific question.

[0006] JOSD1, a member of the deubiquitinase family, removes ubiquitin tags from proteins, thereby participating in the regulation of protein stability and function. As a deubiquitinase, JOSD1 primarily affects protein degradation pathways by hydrolyzing ubiquitin chains. Recent studies have found that JOSD1 not only plays an important role in protein degradation but may also participate in the regulation of tumor metabolic reprogramming by modulating the stability of metabolism-related enzymes. In hepatocellular carcinoma (HCC), JOSD1 overexpression is closely associated with poor patient prognosis, potentially promoting malignant transformation and immune escape by affecting the stability and function of key metabolic enzymes such as PGAAM1. However, how JOSD1 drives metabolic reprogramming and immune escape in HCC by regulating post-modification interactions of glycolytic enzymes remains a subject of systematic research. Summary of the Invention

[0007] To address the shortcomings of existing technologies, this invention explores the role of JOSD1 in the ubiquitination-lactation tandem regulation of the key glycolytic enzyme PGAM1, and reveals the function and clinical value of this mechanism in hepatocellular carcinoma (HCC). Further research revealed that JOSD1 stabilizes the PGAM1 protein through deubiquitination, regulates its lactation modification, thereby enhancing the glycolytic activity of PGAM1 and promoting lactate accumulation. This metabolic alteration not only promotes HCC cell proliferation but also inhibits CD8⁺ T cell function, leading to immune escape. Targeted inhibition of JOSD1 effectively suppresses tumor growth and restores the immune system's surveillance of tumors, suggesting that JOSD1 has broad prospects as a therapeutic target for HCC. Therefore, the proposed use of JOSD1-targeted inhibitors in the preparation of tumor therapeutic drugs is discussed.

[0008] The technical solution adopted by this invention to solve the technical problem is as follows:

[0009] A first aspect of the present invention provides the use of a JOSD1-targeting inhibitor in the preparation of a tumor therapeutic agent.

[0010] In one embodiment, the tumor treatment drug has at least one of the following functions:

[0011] It inhibits the proliferation of tumor cells and inhibits tumor growth.

[0012] In one embodiment, the JOSD1 inhibitor inhibits JOSD1 activity, or inhibits JOSD1 gene transcription or expression.

[0013] The JOSD1 inhibitor is siRNA, shRNA, antibody, or small molecule compound.

[0014] The tumor described in this invention is a tumor that overexpresses JOSD1, and more specifically, hepatocellular carcinoma that overexpresses JOSD1.

[0015] In a second aspect, the present invention provides a tumor therapeutic agent comprising an effective amount of a JOSD1 inhibitor and a pharmaceutical carrier.

[0016] A third aspect of the present invention provides a tumor therapeutic pharmaceutical composition comprising an effective amount of a JOSD1 inhibitor and at least one other tumor therapeutic agent.

[0017] In a fourth aspect, the present invention discloses a method and composition for improving the sensitivity of hepatocellular carcinoma cells to PD-1 therapy.

[0018] Compared with existing technologies, the beneficial effects of this invention are as follows: This invention reveals for the first time the JOSD1-mediated ubiquitination-lactation modification tandem regulatory mechanism, providing a new molecular target for metabolic reprogramming and immune escape in hepatocellular carcinoma (HCC). It provides a strategy to inhibit glycolysis in HCC cells and enhance the efficacy of immunotherapy by targeting JOSD1, focusing on identifying JOSD1 as a key factor promoting glycolysis in HCC cells, thereby providing a novel therapeutic strategy applicable to the early diagnosis, prognostic assessment, and targeted drug development of HCC, with broad prospects for clinical translation. Attached Figure Description

[0019] Figure 1 Survival analyses performed on the GSE14520, ICGC-LIRI-JP, and TCGA-LIHC datasets revealed significant metabolic alterations, with carbohydrate metabolism showing the most pronounced changes.

[0020] Figure 2Survival analysis showed that glycolysis was the pathway with the most significant prognosis across all cohorts. Figure 3 Twenty candidate genes related to glycolysis were identified through multi-cohort integration. Figure 4 Spatial transcriptomics analysis divided tumor regions into groups with high and low expression of glycolysis. Figure 5 JOSD1 was consistently upregulated in the glycolysis-high expression regions across the three spatial datasets.

[0021] Figure 6 Xenograft model study. A. Photographs of mouse xenograft tumors induced by subcutaneous inoculation with Hep3B and Huh7 transfected cells; B. Growth curve of xenograft tumor volume; C. Statistical graph of xenograft tumor weight.

[0022] Figure 7 Representative images of H&E staining and JOSD1 and Ki-67 immunohistochemical staining of xenograft tumors (scale bar: 100 µm).

[0023] Figure 8 Orthotopic liver model study; A representative image and photograph of bioluminescence, B. Relative fluorescence intensity (RFI) plot, C. Tumor volume in an orthotopic tumor transplantation model established using Hep3B and Huh7 transfected cells. Overall survival of mice in the D orthotopic tumor transplantation model.

[0024] Figure 9 Study on tail vein injection transfection model A bioluminescent image of mice transfected with Hep3B and Huh7 cells via tail vein injection. Relative fluorescence intensity (RFI) of mice injected with Hep3B and Huh7 transfected cells. Overall survival of mice transfected with Hep3B and Huh7 cells by injection C.

[0025] Figure 10 Heatmap of differentially expressed proteins identified by proteomics (red indicates upregulated proteins, blue indicates downregulated proteins).

[0026] Figure 11 Gene ontology (GO) enrichment analysis of differentially expressed proteins, categorized by biological process.

[0027] Figure 12 Gene set enrichment analysis (GSEA) of glycolysis-related genes based on KEGG annotation.

[0028] Figure 13 Bar chart of relative abundance of metabolites in metabolic flux analysis: A. In vitro analysis results, B. In vivo analysis results.

[0029] Figure 14 Mass spectrometry analysis was used to identify proteins that interact with JOSD1.

[0030] Figure 15 Overlap between ubiquitomics, immunoprecipitation / mass spectrometry (IP / MS), and glycolysis-related protein datasets.

[0031] Figure 16 Co-IP experiments were used to verify the interaction between JOSD1 and PGAM1, using endogenous proteins from HCC cells (A) and exogenous proteins expressed in HEK293T cells (B, C).

[0032] Figure 17 GST pull-down experiments confirmed the direct binding of JOSD1 and PGAM1.

[0033] Figure 18 .JOSD1 and PGAM1 truncated mutant design.

[0034] Figure 19 Simulated 3D structures of JOSD1 and PGAM1 show the hypothetical binding sites (blue for JOSD1, red for PGAM1, and yellow for hydrogen bonds).

[0035] Figure 20 IP and WB analyses confirmed the interaction between HA-JOSD1-Mut and Flag-PGAM1-WT or HA-JOSD1-WT and Flag-PGAM1-Mut in HEK293T cells. Figure 21 .JOSD1 enhances the stability of PGAM1 by removing K48 linker ubiquitination at the K251 site. A. Protein levels of PGAM1 in Hep3B and Huh7 cells transfected. B. PGAM1 levels in Hep3B and Huh7 cells after CHX treatment at different time points. C. The PGAM1 level of Hep3B cells transfected with CHX and treated with MG132 (10 μM) or CQ (10 μM) concurrently, The ubiquitination level of PGAM1 in cell lines after D. JOSD1 knockdown or overexpression E. Screening for JOSD1-regulated PGAM1 ubiquitination in HEK293T cells using different types of ubiquitin (K6O, K11O, K27O, K29O, K33O, K48O, and K63O). F. Effect of JOSD1 overexpression on PGAM1 ubiquitination levels in HEK293T cells after transfection with mutant Myc-Ub plasmids (K48O Ub is ubiquitin containing only the complete Lys48 residues; K48R Ub is ubiquitin with only mutated Lys48 residues). G. Schematic diagram illustrating different ubiquitination sites of PGAM1 identified through ubiquitomics. H. Ubiquitination levels of PGAM1 mutants in HEK293T cells transfected with the indicator mutant Flag-PGAM1 plasmid I. Sequence alignment of amino acids around the K251 site of PGAM1 in nine species, and illustrated by sequence marker diagram. Figure 22 JOSD1-mediated PGAM1 deubiquitination acts as a molecular switch to expose the K251 site, promoting AARS1-regulated lactation. A. Detection of common lysine modifications in PGAM1, B. Lactic acidification level of PGAM1 after JOSD1 overexpression RMSD analysis of C.PGAM1 before and after lactation at K251 RMSF analysis of D.PGAM1 before and after K251 lactation E.Co-IP assay was used to detect the interaction between AARS1 and PGAM1 in HEK293T cells. F.AARS1 overexpression leads to higher levels of PGAM1 lactation. G. Lactic acidification level of PGAM1 after AARS1 knockdown. H. Co-IP analysis showed the effect of JOSD1 on the AARS1-PGAM1 interaction. I.GST pull-down experiments show that JOSD1 promotes the direct interaction between AARS1 and PGAM1. J. PLA experiments verified that JOSD1 enhances the AARS1-PGAM1 interaction. Lactic acidification and ubiquitination levels of PGAM1 are jointly regulated by K. AARS1 and JOSD1. Figure 23 t-SNE diagrams of 13 major cell types identified based on surface marker expression. Figure 24In the mIHC analysis, the proportion of CD8⁺GZMB⁺ cytotoxic T cell subsets was assessed using automated cell segmentation results from digital image analysis (A), and quantitative analysis of related immune cells was performed (B). Figure 25 3D scatter plots of PanKla, JOSD1, PGAM1, CD8, and GZMB in HCC patient tissues based on mIHC staining analysis. Figure 26 .right Figure 25 The pairwise correlation of markers was analyzed. Figure 27 A. In situ liver tumor volume after treatment with LNP-siNC or LNP-siJosd1; B. Kaplan-Meier survival curves obtained from the specified groups. Figure 28 Studies of mice with in situ tumors treated with IgG or anti-PD-1 antibodies in combination with LNP-siNC or LNP-siJosd1. A. Quantitative analysis of RFI in in situ tumors, B. Tumor volume, C. Kaplan-Meier survival curves obtained from the specified groups. Figure 29 The proportion of CD8⁺GZMB⁺ cytotoxic T cell subsets was assessed using automated cell segmentation results from digital image analysis (A), and the immune cells were quantitatively analyzed by mIHC staining (B). In all statistical charts, data are expressed as mean ± standard deviation (SD). *p<0.05, **p<0.01, ***p<0.001; ns, no significant difference. Detailed Implementation

[0036] To provide a further understanding of the purpose, structure, features, and functions of the present invention, detailed descriptions are provided below with reference to specific embodiments.

[0037] This invention provides the use of JOSD1 inhibitors in the preparation of tumor therapeutic drugs.

[0038] This invention discloses a method and composition for improving the sensitivity of hepatocellular carcinoma cells to immunotherapy. The key findings of the invention are as follows:

[0039] JOSD1 identification: Through multi-omics analysis to screen glycolytic pathways, combined with ubiquitomics and IP / MS analysis, JOSD1 was identified as a key regulator of glycolysis. Furthermore, elevated JOSD1 expression in hepatocellular carcinoma patients and its association with poor prognosis highlight the clinical significance of targeting JOSD1.

[0040] Mechanism study: JOSD1 enhances glycolytic activity, regulates the immune microenvironment, promotes HCC progression, and enhances the efficacy of anti-PD-1 therapy by deubiquitination and lactylation of PGAM1.

[0041] Therapeutic potential: Targeting JOSD1 can improve the efficacy of anti-programmed cell death ligand-1 (PD-1) therapy in hepatocellular carcinoma.

[0042] The tissue samples used in the following examples were obtained from patients who underwent hepatocellular carcinoma surgery. Patients and their families were fully informed of the research purpose and procedures before surgery and signed informed consent forms. This study has been approved by the institution's ethics committee.

[0043] The hepatocellular carcinoma cell lines Huh7, Hep3B, and H22 used were all purchased from Shanghai Anwei Biotechnology Co., Ltd.

[0044] The cell culture medium used was prepared with DMEM / F12, 10% fetal bovine serum, 1% penicillin and 1% streptomycin, Gibco Technologies.

[0045] TRIzol used for RNA extraction was purchased from Invitrogen.

[0046] All reagents used in qRT-PCR were purchased from Nanjing Novizan Biotech Co., Ltd.

[0047] The interfering gene sequences involved in the examples are as follows:

[0048] shJOSD1HumanshRNA1: CTACGATGTGAATGTCATTAT (SEQ ID NO.1)

[0049] shRNA2: CGAGCTCAGGAAGTTTCTAAA (SEQ ID NO.2)

[0050] shRNA3: GGTGTCATTGCCCTCACTAAC (SEQ ID NO.3)

[0051] shJOSD1MouseshRNA: CGAGAGTGAGCTCAGGAAA (SEQ ID NO.4)

[0052] Example 1: Integrated analysis identified glycolysis as a key metabolic pathway in HCC and nominated JOSD1 as a potential regulator.

[0053] To investigate metabolic reprogramming in HCC, we analyzed whole transcriptome datasets with survival information from three independent cohorts (GSE14520, ICGC-LIRI-JP, and TCGA-LIHC). For each metabolic pathway, samples were divided into high-enrichment and low-enrichment groups based on Gene Set Variation Analysis (GSVA) ​​scores, and overall survival differences were assessed. Pathways exhibiting consistent prognostic significance across cohorts are shown below, with carbohydrate metabolism showing the strongest prognostic correlation (…). Figure 1 Among carbohydrate-related pathways, glycolysis exhibits the strongest enrichment and prognostic correlation. Figure 2 Given that enhanced glycolysis is a hallmark of cancer metabolism, we focused on the mechanisms of glycolytic reprogramming in HCC. In TCGA samples, higher glycolysis scores were positively correlated with later clinical stage and pathological T-classification. Gene set enrichment analysis stratified by glycolysis scores (GSEA) showed that tumors with high glycolytic activity exhibited significant enrichment in oncogenic pathways, suggesting that enhanced glycolysis is closely associated with the malignant phenotype of HCC. Subsequently, a multi-cohort analysis identified 20 potential glycolysis-related genes (…). Figure 3 We further investigated the spatial heterogeneity of glycolysis by analyzing public HCC spatial transcriptome datasets, dividing tumor regions into high-expression and low-expression glycolysis groups. Figure 4 In the three datasets, only JOSD1 showed consistent differential expression, highlighting its role as a candidate regulator of glycolysis in HCC. Figure 5 ).

[0054] Example 2: Elevated JOSD1 levels promote malignant phenotypes of HCC in vivo and in vitro.

[0055] In a subcutaneous xenograft model, JOSD1 knockdown significantly inhibited tumor growth, while JOSD1 overexpression had the opposite effect. Figure 6 A, B, C). Further analysis of the harvested xenograft tumors using H&E staining and immunohistochemical (IHC) analysis confirmed that JOSD1 knockdown reduced tumor cell proliferation in vivo, while its overexpression enhanced tumor cell proliferation. Figure 7 To further investigate the biological significance of JOSD1, we employed an orthotopic liver transplantation model. Consistent with the subcutaneous xenograft model, bioluminescence imaging showed that JOSD1 knockdown inhibited orthotopic tumor progression, while its overexpression promoted tumor progression. Gross images of representative liver tumors further support these findings. Figure 8 A, B, C). Kaplan-Meier survival analysis further showed that mice in the JOSD1 knockdown group and overexpression group had prolonged and shortened survival, respectively (A, B, C). Figure 8D). Furthermore, in a tail vein injection-induced lung metastasis model, bioluminescent imaging showed that JOSD1 knockdown significantly inhibited lung colonization, while its overexpression promoted lung metastasis. Figure 9 A, B). Consistently, Kaplan-Meier survival analysis showed that mice injected with JOSD1-shRNA-transfected cells had prolonged overall survival (OS), while mice injected with JOSD1-overexpressing cells had shortened overall survival (OS). Figure 9 C). These in vitro and in vivo studies establish JOSD1 as a potent oncogen in HCC, promoting tumor growth, invasion, and distant metastasis.

[0056] Example 3: JOSD1 enhances glycolytic activity in HCC cells

[0057] To investigate the metabolic function of JOSD1 in HCC, we performed tag-free proteomics analysis on transfected Huh7 cells, setting up a JOSD1 overexpression group and an empty vector control group. After transfection of Huh7 cell lines, proteomics analysis was performed. Principal component analysis (PCA) showed significant differences between the JOSD1 overexpression group and the vector group, indicating that JOSD1 upregulation led to significant changes in the cellular proteome. Notably, in JOSD1-overexpressing cells, 591 proteins were significantly upregulated, and 576 proteins were significantly downregulated (fold change > 1.5 or < 0.67 compared to the control group). Figure 10 Gene Ontology (GO) enrichment analysis highlighted metabolic processes as a significantly enriched biological process (BP) item. Figure 11 Consistently, Kyoto Gene and Genome Encyclopedia (KEGG) pathway analysis of differentially expressed proteins revealed a significant enrichment of carbohydrate metabolic pathways. Specifically, in the JOSD1 overexpression group, key glycolytic enzymes were upregulated, while enzymes related to the tricarboxylic acid (TCA) cycle showed no significant changes. Subsequent gene set enrichment analysis (GSEA) confirmed that the glycolytic pathway was significantly activated in JOSD1-overexpressing cells. Figure 12 These results indicate that JOSD1 plays a crucial role in the glycolytic reprogramming of HCC cells.

[0058] A mouse orthotopic liver transplantation model with JOSD1 overexpression or knockdown was established. In JOSD1 knockdown tumors, 18F-FDG uptake was significantly reduced, while JOSD1 overexpression tumors showed significantly increased 18F-FDG uptake, reflected by a higher maximum normalized uptake value (SUVmax), indicating increased glucose metabolic activity in JOSD1-overexpressing tumors. Metabolic flux analysis using [13C]-glucose was used to directly assess the effect of JOSD1 on glycolysis in Huh7 cells and mouse orthotopic liver tumors. In vitro and in vivo metabolic flux analysis showed that, compared with the control group, the abundance of the glycolytic metabolite M3-lactic acid was significantly increased in the JOSD1 overexpression group, while metabolites related to the TCA cycle showed no significant changes. Figure 13 A, B).

[0059] Example 4: JOSD1 specifically interacts with PGAM1, a key enzyme in glycolysis.

[0060] JOSD1 is a known deubiquitinizing enzyme, but its role in glycolysis regulation has not been previously reported. To elucidate how JOSD1 regulates glycolysis and drives the malignant progression of HCC cells, immunoprecipitation-mass spectrometry (IP / MS) was combined with ubiquimics to reveal downstream targets of its regulatory effects. 581 differentially ubiquitinated proteins were identified in the ubiquimic analysis, and intersection analysis was performed with proteins interacting with JOSD1 in IP / MS. Further overlap analysis of these 581 proteins with KEGG glycolysis-related genes identified the key glycolysis enzyme PGAM1 as a candidate target of JOSD1. Figure 14 ,15).

[0061] This study investigated the interaction between JOSD1 and PGAM1. Endogenous co-immunoprecipitation (Co-IP) in Hep3B cells revealed the interaction between JOSD1 and PGAM1. Figure 16 A). In HEK293T cells that co-express Flag-JOSD1 and HA-PGAM1, Co-IP further confirmed the specific binding of the two ( Figure 16 B, C). Glutathione S-transferase (GST) pull-down assays further demonstrated that these two proteins bind directly ( Figure 17 Consistent with these results, immunofluorescence staining and close proximity assays (PLA) validated their interactions at the cellular level.

[0062] Thrusted mutants of JOSD1 and PGAM1 were constructed to locate the region mediating this interaction. Figure 18Molecular mapping revealed that the N-terminal domain (N1: residues 1-67) and intermediate domain (M1: residues 68-134) of JOSD1 are primarily responsible for binding to PGAM1, while the JOSD1 binding region in PGAM1 is located in its central segment (M2: residues 85-169). The crystal structure of PGAM1 was extracted from the RCSB PDB database, and the structure of JOSD1 was predicted using AlphaFold3. Subsequently, molecular docking simulations were performed to reconstruct the three-dimensional structure of the JOSD1-PGAM1 complex. Analysis identified residues potentially responsible for the JOSD1-PGAM1 interaction. Figure 19 To verify these predictions, the hypothesized binding residues were replaced in JOSD1 and PGAM1. Co-IP experiments showed that mutations in the L63, N66, D83, and V84 residues of JOSD1, and the R86, R140, and D144 residues of PGAM1, completely disrupted their interactions.

[0063] Example 5: JOSD1 stabilizes PGAM1 by removing K48 linker ubiquitination at the K251 site.

[0064] Combined with reference Figure 21 Proteomics analysis revealed a positive correlation between JOSD1 and PGAM1 protein levels. Consistent with this, Western blot analysis showed that PGAM1 expression increased after JOSD1 overexpression. Figure 21 A). Given that JOSD1 can interact with PGAM1, and ubiquitination analysis showed that PGAM1 ubiquitination was altered after JOSD1 overexpression, we performed deubiquitination experiments. Treatment with cyclohexylimide (CHX, a protein synthesis inhibitor) showed that JOSD1 was able to maintain the protein stability of PGAM1. Figure 21 B). Furthermore, the reduction in PGAM1 caused by JOSD1 knockdown can be reversed by the proteasome inhibitor MG132, while chloroquine has a lesser effect. Figure 21 C). Consistent with these findings, PGAM1 ubiquitination increased after JOSD1 knockdown and decreased after JOSD1 overexpression. Figure 21 D). Specifically, JOSD1 suppresses K48 linker ubiquitination of PGAM1 ( Figure 21 (E, F). The mutated JOSD1-PGAM1 binding site (HA-JOSD1-BS-Mut) weakens the ability of JOSD1 to deubiquitinate PGAM1. Furthermore, consistent with previous reports, the JOSD1-C36A mutant loses enzymatic activity, and Western blot analysis shows that JOSD1-C36A has a reduced ability to decrease PGAM1 ubiquitination, indicating that the enzymatic activity of JOSD1 is essential for the deubiquitination of PGAM1.

[0065] Ubiquitinomics further identified three lysine residues on PGAM1, whose ubiquitination levels decreased after JOSD1 overexpression. Figure 21 G). To explore the functional significance of each lysine, we mutated it to arginine. Western blot analysis revealed that lysine K251 is a key site for JOSD1-mediated PGAM1 deubiquitination (G). Figure 21 H). Cross-species conservation analysis further indicated that the K251 site is highly conserved, suggesting its important role in PGAM1 function. Figure 21 I). These results indicate that JOSD1 stabilizes PGAM1 and protects it from proteasome degradation by directly interacting with PGAM1 and removing the K48 linker ubiquitin chain at the K251 site.

[0066] Example 6: AARS1 mediates PGAM1-K251 lactation and enhances PGAM1 enzyme activity.

[0067] JOSD1 acts as a molecular switch, prompting AARS1-mediated lactation of PGAM1 at the K251 site.

[0068] Combined with reference Figure 22 PGAM1 enzyme activity assays showed that JOSD1 increased PGAM1 activity. However, this effect was eliminated when the PGAM1-K251 site was mutated, and PGAM1 activity decreased. This indicates that JOSD1 regulates PGAM1 activity in a K251-dependent manner. Since K48-linked ubiquitination typically regulates protein stability rather than directly regulating enzyme activity, and the observed regulation is dependent on the K251 site, it was hypothesized that this residue might undergo other modifications. Western blot analysis examined alternative modifications before and after the K251 mutation, revealing a significant change in lactation at this site. Figure 22 A). Previous studies have shown that the K251 residue of PGAM1 can undergo lactation modification. Furthermore, JOSD1 enhances the lactation of PGAM1 in a K251-dependent manner. Figure 22 B). Enzyme activity assays showed that the PGAM1-K251R mutation reduced enzyme activity, while the lactation-mimicking mutant K251Q exhibited enhanced activity. It was hypothesized that lactation alters the protein conformation of PGAM1, thereby regulating its enzyme activity. Molecular dynamics (MD) simulations were performed to compare the structural changes of PGAM1 before and after lactation. Simulation results indicated that lactation of K251 induced conformational rearrangement, increasing the flexibility of residues in specific protein domains. Figure 22 C, D).

[0069] Since JOSD1 has no known direct role in mediating protein lactation, an attempt was made to identify the responsible modifying enzyme. IP-MS data analysis of PGAM1 identified AARS1 as the sole candidate lactation-writing enzyme. Co-IP experiments confirmed the interaction between AARS1 and PGAM1. Figure 22 E). Furthermore, AARS1 overexpression increased PGAM1 lactation levels, while AARS1 knockdown decreased lactation levels, and both effects were dependent on the PGAM1-K251 site (E). Figure 22 F, G). Finally, enzyme activity assays showed that AARS1 enhanced the activity of PGAM1 in a K251-dependent manner.

[0070] Co-IP experiments showed that JOSD1 significantly enhanced the interaction between AARS1 and PGAM1. Figure 22 H). Consistently, the GST pull-down experiment confirmed that JOSD1 promotes the interaction between AARS1 and PGAM1 (H). Figure 22 I), and the close proximity experiment (PLA) further validated these results ( Figure 22 Next, we examined whether the deubiquitinating enzyme activity of JOSD1 affected AARS1-mediated PGAM1 lactation. As expected, AARS1 overexpression significantly increased PGAM1 lactation levels, and JOSD1 overexpression further enhanced this effect, consistent with its role in deubiquitin chain removal. These effects were dependent on the K251 site of PGAM1 (J). Figure 22 PGAM1 enzyme activity assays also showed that JOSD1 overexpression significantly enhanced the ability of AARS1 to increase PGAM1 activity, while JOSD1 knockdown attenuated this effect. These findings suggest that JOSD1-mediated PGAM1 deubiquitination acts as a molecular switch, promoting lactation at the AARS1-dependent K251 site, thereby regulating PGAM1 enzyme activity.

[0071] Example 7: Elevated JOSD1 levels are associated with reduced CD8⁺ T cell infiltration in HCC

[0072] To further investigate how JOSD1 alters the immune microenvironment of HCC tumors, we performed time-of-flight mass cytometry (CyTOF) analysis on orthotopic tumors derived from Hepa1-6 cells of C57BL / 6 mice. t-SNE analysis of 38 markers revealed 13 distinct immune cell clusters (…). Figure 23JOSD1 knockdown reduced the proportion of myeloid-derived suppressor cells (MDSCs) and regulatory T cells (Tregs), while increasing the proportion of CD8⁺ T cells. Furthermore, JOSD1 knockdown enhanced the effector function of CD8⁺ T cells, manifested by increased expression of interferon-γ (IFN-γ) and granzyme B (GZMB).

[0073] Next, multiplex immunohistochemical (mIHC) staining was performed on orthotopic tumors established from Hepa1-6 cells stably expressing shJosd1 or Josd1-OE. Automated cell segmentation and quantitative analysis showed that JOSD1 knockdown increased CD8⁺ T cell infiltration and the proportion of CD8⁺GZMB⁺ cells among CD8⁺ T cells, while JOSD1 overexpression produced the opposite effect. Figure 24 A, B). Finally, mIHC was used in tissue microarrays (TMAs) of HCC patients who had not received immunotherapy to assess the levels of PanKla, JOSD1, PGAM1, CD8, and GZMB. Correlation analysis showed that JOSD1 was positively correlated with PGAM1 expression (R = 0.44), while JOSD1 was negatively correlated with CD8⁺ T cell abundance (R = −0.39) and GZMB expression (R = −0.36). Figure 25 , Figure 26 These findings expand the role of the JOSD1-PGAM1-glycolysis axis, including its regulation of the HCC immune microenvironment.

[0074] Example 8: Inhibiting JOSD1 slows tumor growth and enhances the effect of anti-PD-1 treatment in mice

[0075] Based on our previous findings that JOSD1 plays a crucial role in HCC progression, we evaluated the therapeutic potential of targeting JOSD1 in an HCC model. Since there are no specific JOSD1 inhibitors, we used an FDA-approved lipid nanoparticle (LNP) formulation to deliver JOSD1-targeting siRNA. To improve in vivo stability, all siRNA strands were modified with 2′-O-methylated pyrimidine bases. Following intravenous injection, LNP-siJosd1 significantly accumulated in the liver. In a xenograft model, C57BL / 6 mice were randomly assigned to receive either LNP-siJosd1 or LNP-siNC treatment 7 days after Hepa1-6 cell implantation. Compared to the LNP-siNC control group, LNP-siJosd1 treatment significantly reduced tumor volume and prolonged overall survival, highlighting the therapeutic potential of JOSD1 inhibition in HCC. Figure 27 A, B).

[0076] Given that targeting the tumor microenvironment (TME) has become a powerful anti-cancer strategy, and considering the limited clinical efficacy of immune checkpoint inhibitors such as anti-programmed death protein-1 (anti-PD-1) in HCC, it is hypothesized that combining JOSD1 inhibition with anti-PD-1 therapy may produce a synergistic effect. Mice with orthotopic tumors received IgG or anti-PD-1 antibodies in combination with LNP-siNC or LNP-siJosd1. Tumor growth was monitored by bioluminescence on days 7, 14, and 21. No significant changes in body weight were observed, indicating limited side effects. Both LNP-siJosd1 and anti-PD-1 monotherapy inhibited tumor growth, while combination therapy achieved better tumor control, consistent with survival analysis results. Figure 28 AC). Further mIHC staining of tumor sections confirmed that, compared with monotherapy, combination therapy was more effective in enhancing CD8⁺ T cell infiltration and increasing the proportion of CD8⁺GZMB⁺ effector T cells. Figure 29 (A, B). Overall, these findings suggest that inhibiting JOSD1 can limit the progression of HCC and enhance the response to anti-PD-1 therapy, highlighting the value of JOSD1 as a potential therapeutic target for overcoming HCC immune checkpoint resistance.

[0077] The above examples illustrate that JOSD1, discovered in this invention, can be used as a therapeutic target to enhance the sensitivity of HCC cells to PD-1 monoclonal antibodies, thereby providing a new strategy in the immunotherapy of hepatocellular carcinoma.

[0078] The present invention has been described in the above-described embodiments; however, these embodiments are merely examples for implementing the present invention. It must be noted that the disclosed embodiments do not limit the scope of the present invention. Conversely, any modifications and refinements made without departing from the spirit and scope of the present invention are within the scope of patent protection of the present invention.

Claims

1. Use of a JOSD1 inhibitor in the preparation of a tumor treatment drug.

2. The use of the JOSD1 inhibitor targeting agent according to claim 1 in the manufacture of a medicament for the treatment of a tumor, characterized in that, The tumor treatment drug has at least one of the following functions: inhibiting the proliferation of tumor cells; inhibiting the growth of tumors.

3. The use of the JOSD1 inhibitor targeting agent according to claim 2 in the manufacture of a medicament for the treatment of a tumor, characterized in that, The tumor is a tumor overexpressing JOSD1.

4. The use of the JOSD1 inhibitor targeting agent according to claim 1 in the manufacture of a medicament for the treatment of a tumor, characterized in that, The tumor is hepatocellular carcinoma.

5. The use of the JOSD1 inhibitor targeting agent according to claim 1 in the manufacture of a medicament for the treatment of a tumor, characterized in that, The JOSD1 inhibitor is siRNA, shRNA, antibody or small molecule compound.

6. The use of the JOSD1 inhibitor targeting agent according to claim 1 in the manufacture of a medicament for the treatment of a tumor, characterized in that: The JOSD1 inhibitor is the only effective component or one of the effective components of the tumor treatment drug.

7. Use of a JOSD1 inhibitor in the preparation of a preparation for inhibiting glycolysis of tumor cells.

8. Use of a JOSD1 inhibitor in the preparation of a drug for improving the sensitivity of hepatocellular carcinoma cells to anti-PD-1 treatment.

9. A pharmaceutical composition for treating a tumor, comprising: a) a compound of claim 1 ; and b) a pharmaceutically acceptable carrier. It comprises an effective amount of a JOSD1 inhibitor and at least one other tumor treatment drug.