Efficient screening method for genetic transformation of plant single-base editing mutants
By constructing a dual-resistance base editing vector containing P2A self-cleaving peptide and combining it with a high-concentration screening agent, the problem of low base editing efficiency in plants was solved, enabling efficient and low-cost generation and screening of target base editing mutant plants.
Patent Information
- Application Number
- CN202512015646.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-29
- Publication Date
- 2026-04-07
AI Technical Summary
Existing base editing technologies are inefficient and unstable in plants, making it difficult to efficiently generate and screen mutant plants with target base editing, especially due to factors such as cell wall obstruction of delivery, difficulty in cell regeneration, and polyploid genomes.
A dual-resistance base editing vector containing first and second resistance genes was constructed using a P2A self-cleaving peptide. Base editing-positive plants were obtained through two screening processes during plant tissue culture using a combination of high-concentration and commonly used screening agents.
It significantly improves the efficiency of genome base editing, achieving a C-to-T editing efficiency of 65% in rice, saving breeding time, reducing costs, and obtaining more homozygous or biallelic mutants of the target base editing.
Smart Images

Figure CN121801957A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant genetic transformation technology, specifically to a method for efficient screening of plant single-base editing mutants through genetic transformation. Background Technology
[0002] CRISPR / Cas9-based base editing technology can achieve nucleotide substitution without creating DNA double-strand breaks. A commonly used base editing system is composed of a RuvC-domain-inactivated Cas9-D10A nickase (nCas9, which only produces single-strand cuts) fused with a deaminase [Komor et al., 2016]. Base editing was first achieved in mammalian cells using the cytosine base editor CBE (for C-to-T conversion) and the adenine base editor ABE (for A-to-G conversion) [Gaudelli et al., 2017], and subsequently in plants [Molla et al., 2021; Li et al., 2024]. Recently, novel base editors gGBE and gTBE, based on DNA glycosylation enzyme variants and independent of deaminases, have achieved G-to-Y (C / T) and T-to-S (G / C) base conversions in plants and animals, respectively, filling gaps in the development of four base editing technologies [Tong et al., 2023; Tong et al., 2024; Tian et al., 2024; Kuang et al., 2025]. However, the editing efficiency of base editing in plants is not as high as in animals, which may be due to unfavorable factors such as the plant cell wall hindering delivery, the difficulty of plant cell regeneration, polyploid genomes, and local heterochromatin states.
[0003] Thanks to directed protein evolution, base editing technology has been rapidly upgraded, achieving significant breakthroughs in the precise modification of plant genomes. Currently, the most commonly used CBE and ABE systems in plants are BE3, composed of a Cas9 nickase (nCas9), cytosine deaminase (APOBEC1), and a uracil glycosylation inhibitor (UGI), and ABE8e, composed of a bacterial tRNA adenosine deaminase variant TadA8e (V106W) and nCas9, respectively [Li et al., 2017; Qin et al., 2019; Wei et al., 2021; Wang et al., 2024]. Their editing efficiencies vary across different plants and target sites. For example, the rice CBE editor pCXUN-BE3 achieved C-to-T base editing efficiencies of 28.95% and 44.23% at two target sites, respectively; however, it showed almost no editing at one target site in the OsPDS gene, yielding only one C-to-T heterozygous edited seedling and one C-to-G edited seedling among 88 positive seedlings. The cotton CBE editor (GhBE3) achieved C-to-T base editing efficiencies of 26.67%–57.78% at three target sites, but the C-to-T substitution efficiency within the "editing window" was only 18.63% of the total DNA sequence. The rice ABE editor rABE8e achieved 100% editing efficiency at three target sequences and over 80% at eight target sequences. However, the GhABE8e constructed in cotton showed an average A-to-G base editing efficiency of 11.3% at some target sites and as high as 90.2% at others. The novel base editors gGBE and gTBE also performed worse than the mature CBE and ABE systems. OsGTBE composed of gMPGv6.3 achieved a G-to-T editing efficiency of only 39.1% in rice, and 51.5% of the edited plants were chimeras; TGBEs composed of engineered UNGv3 had an average editing efficiency of 12.50% to 62.50% in rice.
[0004] Although the upgraded base editing system can improve the effectiveness of rice, cotton and other plants to some extent, the base editing system can also produce various unexpected nucleotide insertions and deletions (Indels) in addition to the expected base substitutions. These further increase the difficulty of obtaining homozygous or biallelic edited mutants of the target base, so the large-scale application of base editing technology is still limited by the low editing efficiency and instability.
[0005] Therefore, there is a need in the field for an efficient screening method for genetic transformation of base-editing mutants applicable to a variety of plants, so as to generate and screen target base-editing mutant plants more efficiently and at low cost. Summary of the Invention
[0006] This invention provides a highly efficient screening method for genetic transformation of plant single-base editing mutants, enabling the generation and screening of mutant plants with target base editing at a more efficient and lower cost.
[0007] In view of this, the solution of the present invention is as follows: This invention proposes a highly efficient screening method for genetic transformation of plant single-base editing mutants, comprising: A dual-resistance base editing vector based on nCas9, containing a first resistance gene and a second resistance gene, was constructed based on the P2A self-cleaving peptide. The first resistance gene is linked to the C-terminus of the nCas9 protein. The dual-anti-base editing vector was transferred into Agrobacterium strain, infected plant callus tissue, and cultured. The cultured tissues were subjected to first and second resistance screenings using a first screening agent and a second screening agent, respectively, to obtain base editing-positive plants; the first screening agent was at a high concentration, and the second screening agent was at a commonly used concentration. The first resistance gene and the second resistance gene are different resistance genes, corresponding to the resistance genes of the first selection agent and the second selection agent, respectively.
[0008] Furthermore, the first resistance gene exhibits superior screening specificity in plants compared to the second resistance gene.
[0009] Furthermore, the dual-anti-base editing vector is used for editing any one of the bases, that is, it can mutate any one of the bases A, G, C, and T.
[0010] Furthermore, the method for constructing the nCas9 base editing vector involves fusing the P2A self-cleaving peptide-first resistance gene fragment to the C-terminus of nCas9 in the original base editing vector, replacing or retaining the resistance gene in the original base editing vector as the second resistance gene.
[0011] Furthermore, the first and second resistance screening processes each used a basal culture medium.
[0012] Furthermore, the plant is a monocotyledonous plant such as rice or a dicotyledonous plant such as cotton.
[0013] Furthermore, the plant is rice, the first screening agent is hygromycin at a concentration of 60-150 mg / L, and the second screening agent is G418 at a concentration of 30-50 mg / L.
[0014] Preferably, when the plant is rice, the method for constructing the nCas9 base editing vector includes any one of the following: 1) P2A-HPT was fused into the C-terminus of nCas9 in GhBE3 to obtain the intermediate vector CBE-MfeI-HG; then the GhU6.7 promoter in CBE-MfeI-HG was replaced with an OsU3 promoter and an tRNA sequence to obtain the C-to-T base editing vector CBE-HG. 2) The tRNA sequence was introduced into GhABE8e to obtain 8eABE-A0. P2A-HPT was fused into the C-terminus of nCas9 in 8eABE-A0 to obtain the intermediate vector 24EV225. Then, the OsU3 promoter was used to replace the GhU6.7 promoter in 24EV225 to obtain the A-to-G base editing vector ABE-HG. 3) Replace TadA8e on the ABE-HG vector with the human uracil DNA glycosylation enzyme variant UNGv3 to obtain the base editing vector TBE-HG with T-to-G or C. 4) Based on the ABE-HG vector backbone, TadA8e was replaced with a 19-amino acid nuclear localization peptide; in the second step, the human N-methylpurine DNA glycosylation enzyme variant MPGv6.3 was fused to the C-terminus of nCas9 to obtain the G-to-T or C base editing vector GBE-HG.
[0015] Furthermore, the plant is cotton, the first screening agent is glyphosate at a concentration of 150-500 mg / L, and the second screening agent is kanamycin at a concentration of 30-50 mg / L.
[0016] Preferably, when the plant is cotton, the method for constructing the nCas9 base editing vector includes any one of the following: 1) P2A-CTP-EPSPs were fused into the C-terminus of nCas9 in 8eABE-A0 to obtain the base editing vector GhABE-EK with A-to-G conversion; 2) P2A-CTP-EPSPs were fused into the C-terminus of nCas9 in GhBE3 to obtain the intermediate vector CBE-MfeI-EK. Then, the tRNA sequence was introduced into CBE-MfeI-EK to obtain the C-to-T base editing vector GhCBE-EK.
[0017] In another aspect, the present invention provides a method for transgenic plants, comprising constructing a plant receptor with resistance to a target gene, and screening the plant receptor for genetic transformation; wherein: The genetic transformation screening process includes transferring a dual-resistance base editing vector into an Agrobacterium strain and infecting the callus tissue of a plant recipient and culturing it, and screening using at least two screening agents; The method for constructing the dual-resistance base editing vector is as follows: a base editing vector based on nCas9 containing at least one resistance marker gene is constructed based on the P2A self-cleaving peptide, wherein an resistance marker gene is linked to the C-terminus of the nCas9 protein; The resistance marker gene is different from the target gene that the plant receptor is resistant to. The screening agent includes a screening agent corresponding to the target gene that the plant receptor is resistant to, and a screening agent corresponding to the resistance marker gene.
[0018] Based on the dual-resistance base editing vector used in the aforementioned genetic transformation screening method of this invention, when re-editing the recipient of a plant transformant containing the target gene resistance, if the resistance gene does not conflict with the marker gene, the dual-resistance base editing vector can be used for genetic transformation screening; if the resistance gene conflicts with one of the resistance marker genes, the other resistance marker gene can be selected for screening. The screening process uses a high-concentration screening agent corresponding to the resistance gene for the first screening, and then uses the screening agent formulation corresponding to the resistance marker gene for subsequent screening, thereby obtaining more target base-edited mutant plants.
[0019] In this invention, the high concentration of the screening agent is higher than the concentration commonly used in plant genetic transformation, and varies depending on the plant and variety. Because plants have varying sensitivities to screening agents, the commonly used concentration of the same screening agent differs among different plants. For plants that are difficult to transform genetically, the commonly used concentration of the same screening agent also differs among different varieties.
[0020] Compared with the prior art, the present invention has the following beneficial effects: The screening method provided by this invention achieves co-expression of the P2A self-cleaving peptide fusion screening gene and the base editing effector fusion gene, thereby extending the window of action and improving the base editing efficiency, and thus obtaining more target base editing mutant plants. In addition, the modified vector backbone contains the newly added screening gene and the original screening gene. By using the corresponding screening agents in sequence during plant tissue culture, the tissue culture burden caused by screening for high expression of base editing effector proteins can be overcome.
[0021] In this invention, the dual-resistance base editing vector contains two selectable genes, so it can also perform gene base editing on transformants with selectable genes. It can overcome the limitation of transformant background selection resistance by simply using a selection agent with different background selection resistance from the transformant recipient for tissue culture screening.
[0022] Compared to existing technologies that use a single selection gene and corresponding single selection agent for genetic transformation, which struggles to efficiently obtain base-edited transformed plants, this invention utilizes a novel vector framework with dual selection genes, combined with the combined use of different concentrations and types of selection agents during plant tissue culture. This makes it easier to obtain transformed plants with high expression of base-editing effector proteins, significantly improving the efficiency of genome base editing. For example, in rice, 65% of C-to-T mutations can be achieved. Among these, homozygous or biallelic mutants account for 20% of positive seedlings, and homozygous mutants with the target base editing can be obtained in the T0 generation, saving a generation of breeding time. This allows for the efficient and low-cost generation and screening of mutant plants with the target base editing. Attached Figure Description
[0023] Figure 1 This is a schematic diagram of the T-DNA structure of the six dual-anti-base editing transformation vectors constructed in this embodiment of the invention.
[0024] Figure 2 This is the result of sequencing data analysis of the base-editing mutant strain in Example 1 of the present invention. Detailed Implementation
[0025] The technical solution of the present invention will now be clearly and completely described in conjunction with preferred embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0026] This invention optimizes and modifies plant gene base editing systems and genetic transformation methods to obtain a highly efficient base editing method applicable to various plants. Firstly, an additional selection marker gene is linked to the C-terminus of the nCas9 protein in an existing base editing vector via a P2A self-cleaving peptide. hpt or EPSPS This method utilizes a single promoter to achieve simultaneous expression of additional selection marker proteins HPT or EPSPS with fusion proteins of rAPOBEC1-XTEN-nCas9-UGI, Tad8e-nCas9, UNGv3-nCas9, or nCas9-MPGv6.3. Then, during genetic transformation, high concentrations of the selection agent hygromycin or glyphosate are used in combination with commonly used concentrations of the selection agent G418 or kanamycin corresponding to the original selection marker genes on the editing system.
[0027] In some embodiments, the method for constructing the dual-anti-base editing vector includes, but is not limited to, the following: 1. Construction of a dual-resistance base editing vector for rice gene base editing A. Modifying GhBE3 for use in rice cultivation Hpt and G 418 dual-antibase editing vector CBE-HG. Specifically, it involves two steps: First, P2A-HPT is fused into the C-terminus of nCas9 in GhBE3 to obtain the intermediate vector CBE-MfeI-HG; second, the GhU6.7 promoter in CBE-MfeI-HG is replaced with an OsU3 promoter plus an tRNA sequence to obtain CBE-HG.
[0028] B. GhABE8e was modified into the rice-use Hpt and G418 dual-resistance base editing vector ABE-HG. This involved three steps: First, the tRNA sequence was introduced into GhABE8e to obtain 8eABE-A0, thus removing the restriction on transcription initiation at the G / A base position of the target site by the U6 / U3 promoter; second, P2A-HPT was fused to the C-terminus of nCas9 in 8eABE-A0 to obtain the intermediate vector 24EV225; third, the OsU3 promoter replaced the GhU6.7 promoter in 24EV225 to obtain 24EV289, i.e., ABE-HG.
[0029] C. Based on ABE-HG, replace TadA8e on the ABE-HG vector with the human uracil DNA glycosylation enzyme variant UNGv3 to obtain TBE-HG.
[0030] D. GBE-HG was obtained by two-step modification based on the ABE-HG backbone. Specifically: First, TadA8e was replaced with a 19-amino acid nuclear localization peptide; second, the human N-methylpurine DNA glycosylation enzyme variant MPGv6.3 was fused to the C-terminus of nCas9 to obtain GBE-HG.
[0031] 2. Construction of a dual-resistance base editing vector for cotton gene base editing
[0032] A. To modify GhABE8e for use in cotton E PSPs and K The dual-anti-base editing vector GhABE-EK is obtained by fusing P2A-CTP-EPSPs into the C-terminus of nCas9 in 8eABE-A0 in one step.
[0033] B. Modify GhBE3 into E PSPs and K The dual-antibiotic base editing vector GhCBE-EK is produced in two steps: First, P2A-CTP-EPSPs are fused into the C-terminus of nCas9 in GhBE3 to obtain the intermediate vector CBE-MfeI-EK; second, the tRNA sequence is introduced into CBE-MfeI-EK to obtain GhCBE-EK.
[0034] The structure of the dual-antibase editing transformation vector T-DNA constructed by the above method is as follows: Figure 1 As shown.
[0035] In the above embodiments, plants were subjected to base editing after electrotransformation of Agrobacterium using bispecific editing vectors containing two different types of selection genes. A phased selection strategy using different concentrations and selection agents was employed based on the plant tissue culture cycle. Specifically, in the first half of the genetic transformation selection culture phase of the explants, a high concentration of the selection agent corresponding to the selection gene co-expressed with the base editing effector was used. In the subsequent second half, a commonly used concentration of the other selection agent corresponding to the separately expressed selection gene was used.
[0036] Understandably, for the concentration of the screening agent, a high concentration is one higher than the commonly used concentration in the field for obtaining more target base edits. For example, when using hygromycin as a screening agent for rice, the commonly used concentration is 50 mg / L, while a high concentration is 60-150 mg / L, which is 20-200% higher than the commonly used concentration, preferably 50% higher, i.e., 75 mg / L. Similarly, when using glyphosate as a screening agent for cotton, the commonly used concentration is 10-100 mg / L, while a high concentration is 150-500 mg / L, which is at least 50% higher than the commonly used concentration, preferably 250 mg / L.
[0037] In some embodiments, base editing in rice was performed using the ABE-HG and CBE-HG backbones. A high concentration of hygromycin (75 mg / L) was added to the rice embryogenic callus screening medium for selection 1, while the medium for selection 2 was replaced with 50 mg / L G418. Base editing in cotton was performed using the GhABE-EK and GhCBE-EK backbones. A high concentration of glyphosate (250 mg / L) was added to the cotton hypocotyl screening medium for the first two rounds, while 50 mg / L kanamycin was used for the latter two rounds. Utilizing a novel vector backbone with dual-selection genes, combined with the use of different concentrations and types of selection agents during plant tissue culture, makes it easier to obtain transformed plants with high expression of base editing effector proteins, significantly improving the efficiency of genome base editing. For example, in rice, 65% of C can be changed to T; among them, homozygous or biallelic mutants account for 20% of positive seedlings, and homozygous mutants with target base editing can be obtained in the T0 generation, which can save a generation of breeding time, so as to achieve efficient and low-cost generation and screening of mutant plants with target base editing.
[0038] Example 1: Rice base editing and genetic transformation based on CBE-HG vector
[0039] (a) Construction of intermediate carrier 25EV331-A
[0040] 1) Using CBE-MfeI (i.e. GhBE3) as a template, PCR was performed using primer combination 25EV330-F1 / 25EV330-R1 to obtain the 336 bp target fragment 1 containing UGI. Using p32HG as a template, PCR was performed using primer combination 25EV331-F1 and 25EV331-R1 to obtain the 1114 bp target fragment 2 of P2A-HPT.
[0041] 2) Take 2 μg of CBE-MfeI plasmid and digest it with MluI and XbaI at 37℃ for 2 h. Perform 1% agarose gel electrophoresis on the digestion product and extract the 16801 bp vector band (334 bp of the sequence containing the stop codon UGI was removed). Purify the sample using a gel extraction kit and set aside for later use.
[0042] 3) Ligate the target fragment from 1) to the linearized vector described above using homologous recombination. Take 1 μL of the ligation product and transform it into E. coli DH5α or TOP10 competent cells using chemical transformation. Spread the product onto Kans resistant plates and incubate overnight at 37°C.
[0043] 4) Pick a single clone from the plate, inoculate it and perform bacterial PCR. Use primer combination 25EV331J-487F / NosR-seq (expected product size 487 bp) to identify positive clones.
[0044] 5) Take 200 μL of the shaken bacterial culture of the positive clone and send it for first-generation sequencing. After the correctly sequenced clone is inoculated and cultured, take 500 μL of fresh bacterial culture and add an equal volume of sterile 50% glycerol, and store E. coli glycerol bacteria at -80℃; use the self-made plasmid extraction reagent to extract a small amount of plasmid from the remaining bacterial culture, store it at -20℃, and name it 25EV331-A.
[0045] (II) Construction of the vector CBE-HG
[0046] 1) Using PRGEB32-k (derived from a sequence modification that replaces the BsaI site of the PRGEB32 vector with tRNA-KpnI) as a template, a 515 bp target fragment containing the OsU3 promoter and tRNA was obtained by PCR using the primer combination M13R / 25EV330-R3.
[0047] 2) Take 2 μg of 25EV331-A plasmid and digest it with HindIII and MfeI at 37℃ for 2 h. Perform 1% agarose gel electrophoresis on the digestion product and extract the 17202 bp vector band (988 bp of the sequence containing the GhU6 promoter was removed). Purify the band using a gel extraction kit and set aside for later use.
[0048] 3) Ligate the target fragment from 1) to the linearized vector described above using homologous recombination. Take 1 μL of the ligation product and transform it into E. coli DH5α or TOP10 competent cells using chemical transformation. Spread the product onto Kans resistant plates and incubate overnight at 37°C.
[0049] 4) Pick single clones from the petri dish, inoculate them, and perform bacterial PCR. Use primer combination OsU3-219F / 25EV330-R3 (expected product size 262 bp) to identify positive clones.
[0050] 5) Take 200 μL of the shaken bacterial culture of the positive clone and send it for first-generation sequencing. After the correctly sequenced clone is inoculated and expanded, take 500 μL of fresh bacterial culture and add an equal volume of sterile 50% glycerol, and store E. coli glycerol bacteria at -80℃; use the self-made plasmid extraction reagent to extract a small amount of plasmid from the remaining bacterial culture, store it at -20℃, and name it CBE-HG.
[0051] (III) Constructing a rice gene editing vector using CBE-HG
[0052] 1) Design a 20 bp CRISPR target site CGACTGGCACACTGGCCCAC based on the rice Os06g0133000 gene sequence information.
[0053] 2) Adapter primers T1s and T1as, containing a 20 bp target site sequence, were synthesized by Tianyi Huayu Company. Using high-fidelity DNA polymerase, the double-stranded DNA fragment containing the T1 target was directly amplified using the above primers. The PCR system and procedure are as follows.
[0054] PCR system:
[0055] PCR program: 95℃ 3min; 95℃ 10s, 56℃ 10s, 72℃ 10s, 35 cycles; 72℃ 3min; 25℃ 1s.
[0056] 3) Take 1.5 μL of the above PCR product stock solution and 1 μL of the CBE-HG vector fragment linearized by BamHI restriction for homologous recombination ligation. Transfer 1 μL of the ligation product calcium into 20 μL of E. coli DH5α or TOP10 competent cells, plate on Kans resistant plates, and incubate overnight at 37°C.
[0057] 4) Pick single clones from the plate, inoculate them, and perform bacterial PCR to identify positive clones. Use primer combination OsU3-219F / 0133-T1as (expected product size 276 bp) to identify positive clones.
[0058] 5) Aspirate 200 μL of the shaken bacterial culture of the positive clone and send it for first-generation sequencing. After the correctly sequenced clone is inoculated and cultured, take 500 μL of fresh bacterial culture and add an equal volume of sterile 50% glycerol, and store E. coli glycerol bacteria at -80℃; use a self-made plasmid extraction reagent to extract a small amount of plasmid from the remaining bacterial culture, store it at -20℃, and name it 0133_CBE-HG.
[0059] 6) The vector plasmid was transferred into Agrobacterium strain EHA105 by electroporation, and positive Agrobacterium clones were identified by PCR.
[0060]
[0061] (iv) Using a combination of screening agents to efficiently obtain effective base-edited plants
[0062] 1. Dark induction of callus tissue: Take mature and plump seeds of the Nipponbare rice variety, remove the husk; disinfect with 75% alcohol for 1-2 minutes, then discard the alcohol; rinse twice with sterile distilled water; soak in 0.15% mercuric chloride (HgCl2) for 15-18 minutes, shaking several times during this period; discard the mercuric chloride, and rinse five times with sterile distilled water. Inoculate the sterilized seeds into the callus induction medium and incubate in the dark at 28℃ for 30 days.
[0063] 2. Subculture of callus: The induced callus tissue was transferred to a subculture medium for subculture, and then subcultured every 20 days.
[0064] 3. Agrobacterium streak activation: On the second day of pre-culture, Agrobacterium was streaked on LB medium containing kanamycin and incubated at 28°C.
[0065] 4. Suspension, infection, and co-culture of Agrobacterium: Activated Agrobacterium was scraped into a suspension culture medium and cultured on a shaker at 28°C for 30 min. OD was adjusted. 600 The value is 0.2~0.3. Place the callus tissue in Agrobacterium suspension and infect for 30 min, shaking several times during this period. Discard the bacterial suspension, blot the surface of the callus dry with sterile filter paper, and cover the callus surface with sterile filter paper to air dry in a laminar flow hood for 1-2 h. Then transfer the callus to co-culture medium and co-culture at 19℃ for 36-48 h (add 100 μL AS and 2 mL 50% glucose to every 100 mL suspension medium before use; add 250 μL AS and 5 mL 50% glucose to every 250 mL co-culture medium before use). 5. Water washing and sterilization: After co-culturing for 36-48 hours, sterilization is performed. The callus is continuously washed with sterile distilled water until the distilled water used to wash the callus is clear. Then, the callus is soaked in sterile distilled water containing 500 mg / L CN carbenicillin for 30 minutes, shaking constantly during soaking. The CN is discarded, and the surface moisture of the callus is absorbed as much as possible with sterile filter paper. The callus surface is then covered with another layer of sterile filter paper and dried in a laminar flow hood for 2-4 hours. 6. Screening Culture: Place the washed callus on screening medium and incubate in the dark at 28°C. The first round of screening uses a high concentration of 75 mg / L hygromycin. After 2 weeks, change the medium. The second round of screening uses a commonly used concentration of 50 mg / L G418. Add the appropriate volume of screening agent to every 250 mL of screening medium before use.
[0066] 7. Differentiation: Place well-grown resistant callus in differentiation medium and culture at 28-30℃ under light (14h light: 10h darkness). The differentiation cycle is 35-45 days.
[0067] 8. Rooting: When the resistant callus forms 3-4 cm long shoots on the differentiation medium, transfer the shoots to the rooting medium. Note that the shoots emerging from a single resistant callus are identical and can only be taken once. Culture at 28℃ under light until a complete plantlet is formed. Generally, 30 tubes are rooted, with 1 plantlet per tube, for a total of 30 plants. The remaining untaken differentiation tubes can be temporarily set aside for later replanting.
[0068] 9. Positive detection: After the transformed plants have developed roots (about 1 week), under aseptic conditions, cut leaves about 2 cm long and place them in a 2 mL centrifuge tube containing steel balls. Label the centrifuge tubes clearly and use the CTAB method to extract DNA for PCR positive detection. The detection primers are BE-Cas9-F / R, and the expected product size is 568 bp.
[0069] 10. Editing detection: Design F and R primers 100-200 bp upstream and downstream of the target site, respectively, and perform gene editing detection on Cas9 positive seedlings.
[0070] Sequencing data analysis results of base editing mutant strains are as follows: Figure 2 As shown.
[0071] (V) Analysis of conversion efficiency and editing efficiency
[0072] Following the above steps, Agrobacterium tumefaciens using the editing vector 0133_CBE-HG was used to transform embryogenic callus of Nipponbare rice to obtain regenerated plants for testing. Table 1 shows that when screening with commonly used concentrations of hygromycin alone, base editing mutations accounted for 45.0% of positive seedlings. However, when screening 1 was performed with a high concentration of hygromycin, followed by screening 2 with G418, although the high concentration in screening 1 resulted in fewer resistant callus and a decrease in the number of regenerated seedlings, the proportion of base editing mutations increased to 65.0%. Simultaneously, the proportion of unexpected InDels mutations decreased from 12.5% to 5.0%. Base editing outside the "3-10 position editing window" was also controlled from 7.5% to 0%.
[0073] Table 1: Effects of different screening strategies on base editing efficiency
[0074] Note: 1.5×Hn indicates that hygromycin is used at 1.5 times the commonly used concentration.
[0075] Table 2: The impact of different screening strategies on base editing types
[0076] Example 2 Construction of the dual-anti-base-editing transformation vector ABE-HG
[0077] (a) Construction of 8eABE-A0
[0078] 1) Using p7N-k (derived from a sequence modification that replaces the BsaI site of the p7N vector with tRNA-KpnI) as a template, a 268 bp fragment containing tRNA was obtained by PCR using the GhU6.7-F / SbfI-R primer pair.
[0079] 2) Take 2 μg of 8eABE-MfeI (i.e. GhABE8e) plasmid, digest it with MfeI and SbfI at 37℃ for 2 h, and then use the sodium acetate-ethanol precipitation method to obtain the purified linearized vector fragment.
[0080] 3) Ligate the target fragment from 1) to the linearized vector described above using homologous recombination. Take 1 μL of the ligation product and transform it into E. coli DH5α or TOP10 competent cells using chemical transformation. Spread the product onto Kans resistant plates and incubate overnight at 37°C.
[0081] 4) Pick single clones from the plate, inoculate them, and perform bacterial PCR. Use primer combination U6-7s / SbfI-R (expected product size 396 bp) to identify positive clones.
[0082] 5) Take 200 μL of the shaken bacterial culture of the positive clone and send it for first-generation sequencing. After the correctly sequenced clone is inoculated and cultured, take 500 μL of fresh bacterial culture and add an equal volume of sterile 50% glycerol, and store E. coli glycerol bacteria at -80℃; use the self-made plasmid extraction reagent to extract a small amount of plasmid from the remaining bacterial culture, store it at -20℃, and name it 8eABE-A0.
[0083] (II) Construction of the intermediate carrier 24EV225
[0084] 1) Using PV58K as a template, and with the 24EV225-F1 / R1 primer pair, PCR was performed to obtain a 1121 bp fragment containing P2A and HPT.
[0085] 2) Take 2 μg of 8eABE-A0 plasmid, digest it with ApaI at 37℃ for 2 h, and then use the sodium acetate-ethanol precipitation method to obtain the purified linearized vector fragment.
[0086] 3) Ligate the target fragment from 1) to the linearized vector described above using homologous recombination. Take 1 μL of the ligation product and transform it into E. coli DH5α or TOP10 competent cells using chemical transformation. Spread the product onto Kans resistant plates and incubate overnight at 37°C.
[0087] 4) Pick single clones from the petri dish, inoculate them, and perform bacterial PCR. Use the primer combination 24EV225J-413F / NosR-seq (expected product size 413 bp) to identify positive clones.
[0088] 5) Take 200 μL of the shaken bacterial culture of the positive clone and send it for first-generation sequencing. After the correctly sequenced clone is inoculated and expanded, take 500 μL of fresh bacterial culture and add an equal volume of sterile 50% glycerol, and store E. coli glycerol bacteria at -80℃; use a self-made plasmid extraction reagent to extract a small amount of plasmid from the remaining bacterial culture, store it at -20℃, and name it 24EV225.
[0089] (III) Construction of the rice dual-resistance base editing transformation vector ABE-HG
[0090] 1) Using pR32B0 as a template, and with the 24EV289-F1 / R1 primer pair, a 506 bp fragment containing the OsU3 promoter and tRNA was obtained by PCR.
[0091] 2) Take 2 μg of 24EV225 vector and digest it with HindIII and KpnI at 37℃ for 2 h. Then, perform 1% agarose gel electrophoresis on the digestion product and extract the 16803 bp vector band (1079 bp of the sequence containing GhU6.7 promoter and tRNA was removed). After purification with a gel extraction kit, it is ready for use.
[0092] 3) Ligate the target fragment from 1) to the linearized vector described above using homologous recombination. Take 1 μL of the ligation product and transform it into E. coli DH5α or TOP10 competent cells using chemical transformation. Spread the product onto Kans resistant plates and incubate overnight at 37°C.
[0093] 4) Pick single clones from the plate, inoculate them and perform bacterial PCR. Use primer combination OSU3-219F / 24EV289-R1 (expected product size 262 bp) to identify positive clones.
[0094] 5) Take 200 μL of the shaken bacterial culture of the positive clone and send it for first-generation sequencing. After the correctly sequenced clone is inoculated and expanded, take 500 μL of fresh bacterial culture and add an equal volume of sterile 50% glycerol, and store E. coli glycerol bacteria at -80℃; use a self-made plasmid extraction reagent to extract a small amount of plasmid from the remaining bacterial culture, store it at -20℃, and name it ABE-HG.
[0095] Example 3 Construction of the dual-anti-base editing transformation vector TBE-HG
[0096] The human uracil DNA glycosylase variant UNGv3 was selected to replace TadA8e in the ABE-HG vector, resulting in the editor TBE-HG, which can achieve T-to-G / C conversion in rice. Specifically, four amino acid mutations (Y68A, A126T, Q171A, and Y196D) were introduced into the amino acid sequence 80-304 of UNG (NP_003353.1), and a 19-amino acid nuclear localization peptide MKRTADGSEFESPKKKRKV was added to its N-terminus. After optimization according to plant-preferred codons, an 802 bp DNA coding sequence was synthesized and inserted between the SalI (5' end) and Bsu36I (3' end) restriction sites of ABE-HG (i.e., TadA8e was removed, and the extra 70 bp linker sequence was supplemented through gene synthesis), thus obtaining the dual-resistance editor TBE-HG. The composition information of this DNA sequence is as follows: >57bp ATGAAAAGAACTGCTGATGGATCTGAGTTTGAATCCCCAAAGAAGAAGAGGAAGGTG >675bp AATGTTCCTGTTGGTTTTGGAGAGTCTTGGAAAAAGCATCTTTCCGGTGAATTTGGGAAACCATATTTCATAAAGCTTATGGGATTTGTGGCTGAAGAGAGAAAACATTATACTGTATACCCTCCTCCCCACCAAGTCTTCACATGGACTCAAATGTGTGATATCAAA GATGTGAAAGTTGTTATCTTGGGTCAAGATCCAGCTCACGGCCCCAACCAGGCTCATGGCTTATGCTTCTCTGTTCAACGCCCTGTACCACCTCCACCGAGCTTGGAGAACATTTACAAAGAGCTATCGACAGACATTGAAGATTTTGTTCATCCTGGTCATGGAGATT TATCCGGTTGGGCAAAGCAAGGGGTGCTACTGCTAAACACGGTCTTAACCGTAAGGGCCCATCAGGCAAATTCTCACAAAGAACGGGGATGGGAACAGTTCACTGATGCTGTTGTGTCATGGCTCAATCAAAATTCAAATGGACTTGTCTTTCTGTTGTGGGGTTCATA TGCTGCAAAAAAAGGGAGTGCCATAGACAGGAAACGACACCATGTTTTGCAGACTGCACATCCGTCCCCACTCTCTGTCGATCGTGGCTTCTTTGGTTGTAGACATTTTTCAAAGACAAATGAATTGCTTCAAAAGAGTGGAAAGAAACCTATTGATTGGAAGGAGCTT >70bp tcgggcggtagttcgggcggaagttcgggatctgaaacaccaggaacatctgaatctgcaacaccagaat Example 4 Construction of the dual-anti-base-editing transformation vector GBE-HG The human N-methylpurine DNA glycosylation enzyme variant MPGv6.3 was fused to the C-terminus of nCas9 to obtain the editor GBE-HG, which can achieve G-to-T / C conversion in rice. Specifically, the TadA8e between the SalI (5' end) and Bsu36I (3' end) restriction sites of the ABE-HG vector was replaced with the 19-amino acid nuclear localization peptide MKRTADGSEFESPKKKRKV to obtain the intermediate vector 57bp_24EV289.
[0097] >57bp
[0098] ATGAAGCGCACTGCCGACGGGAGTGAGTTCGAGTCGCCCAAGAAGAAGCGGAAGGTA
[0099] Then, amino acid variations (G163R, N169G, D175R, C178N, S198A, K202A, G203A, S206A, K210A, Q294R) were introduced at positions 2-298 of the MPG (NP_002425.2). A 22-amino acid nuclear localization peptide and the GS Linker sequence SPKKKRKVLGGDSGGSGGSGGS were added to the N-terminus, and a 24-amino acid nuclear localization peptide sequence SGGSKRTADGSEFEPKKKRKVGSG was added to the C-terminus. The 1029 bp DNA coding sequence was then directly generated between nCas9 and P2A-HPT in the 57 bp_24EV289 sequence, resulting in the bispecific antibody editor GBE-HG. The composition information of this DNA sequence is as follows: >66bp TCTCCAAAGAAGAAGCGGAAGGTGCTCGGGGGCGACTCCGGGGGCTCAGGAGGTTCCGGTGGATCC >891bp gtcacccccgctttgcagatgaagaaaccaaagcagttttgccgacggatggggcaaaagaagcagcgaccagctagagcagggcagccacacagctcgtccgacgcagcccaggcacctgcagagcagccacacagctcgtccgatgcagcccaggcaccttgccccagggagcgctgcttgggaccgcccaccactccgggcccataccgcagcatctatttctcaagcccaaagggccaccttacccgactggggttggagttcttcgaccagccggcagtccccctggcccgggcatttctgggacaggtcctagtccggcgacttcctaatggcacagaactccgaggccgcatcgtggagaccgaggcatacctggggccagaggatgaagccgcccactcaaggggtggccggcagaccccccgcaaccgaggcatgttcatgaagccggggaccctgtacgtgtacatcatttacagaatgtacttctgcatgggcatctccagccaggggagaggggctaacgtcttgctgcgagcactggagcccctggaaggtctggagaccatgcgtcagcttcgcgccaccctccgggccgccaccgccgcccgtgtcctcgccgaccgcgagctctgcagtggcccctccaagctgtgccaggccctggccatcaacaagagctttgaccagagggacctggcacaggatgaagctgtatggctggagcgtggtcccctggagcccagtgagccggctgtagtggcagcagcccgggtgggcgtcggccatgcaggggagtgggcccggaaacccctccgcttctatgtccggggcagcccctgggtcagtgtggtcgacagagtggctgagagagacacacaggcc >72bp tctggcggctcaaaaagaaccgccgacggcagcgaattcgagCCAAAGAAGAAGCGGAAGGTCGGATCCGGA Example 5 Construction of the dual-anti-base-editing transformation vector GhABE-EK (I) Construction of pC6300 The 5'UTR (133 bp, used to enhance expression) from Tobacco etch virus (TEV) and the chloroplast-localizing peptide CTP (76 amino acids, optimized with soybean preferred codons, used to transport the fusion protein into the chloroplast to exert its function) from EPSPs (GenBank: CAA29828.1) from Arabidopsis thaliana were selected. The DNA sequence of the herbicide resistance gene CP4-EPSPs (1368 bp, referencing the Standard reference vector pMCS, GenBank: KJ701603.1) from Agrobacterium tumefaciens was then directly synthesized between the 5'-XhoI and 3'-XhoI sites on pCAMBIA1300, replacing the original... hpt The gene, namely the expression vector pC6300 for herbicide-resistant soybeans, was obtained.
[0100] (II) Construction of the vector GhABE-EK
[0101] 1) Using the 25EV329-F1 / 25EV260-R2 long primer pair, direct PCR amplification yielded an 82 bp target fragment containing P2A 1. Using pC6300 as a template, PCR amplification was performed using the CTP-inF / 25EV329-R1 primer pair to obtain a 1642 bp target fragment containing CTP-EPSPs 2.
[0102] 2) Take 2 μg of 8eABE-A0 plasmid, digest it with ApaI at 37℃ for 2 h, and then use the sodium acetate-ethanol precipitation method to obtain the purified linearized vector fragment.
[0103] 3) Ligate the target fragment from 1) to the linearized vector described above using homologous recombination. Take 1 μL of the ligation product and transform it into E. coli DH5α or TOP10 competent cells using chemical transformation. Spread the product onto Kans resistant plates and incubate overnight at 37°C.
[0104] 4) Pick a single clone from the plate, inoculate it, and perform bacterial PCR. Use the primer combination PESE403J-F1 / NosR-seq (expected product size 514 bp) to identify positive clones.
[0105] 5) Take 200 μL of the shaken bacterial culture of the positive clone and send it for first-generation sequencing. After the correctly sequenced clone is inoculated and cultured, take 500 μL of fresh bacterial culture and add an equal volume of sterile 50% glycerol, and store E. coli glycerol bacteria at -80℃; use a self-made plasmid extraction reagent to extract a small amount of plasmid from the remaining bacterial culture, store it at -20℃, and name it GhABE-EK.
[0106] Example 6 Construction of the dual-anti-base-editing transformation vector GhCBE-EK
[0107] (a) Construction of the intermediate carrier 25EV330-A
[0108] 1) Using CBE-MfeI (i.e. GhBE3) as a template, PCR was performed using primers 25EV330-F1 / 25EV330-R1 to obtain a 336 bp target fragment 1 containing UGI. Using GhABE-EK as a template, PCR was performed using primers 25EV330-F3 and 6300-EPSPs-XbaiR to obtain a 1686 bp target fragment 2 of P2A-CPT-EPSPs.
[0109] 2) Take 2 μg of CBE-MfeI plasmid and digest it with MluI and XbaI at 37℃ for 2 h. Perform 1% agarose gel electrophoresis on the digestion product and extract the 16801 bp vector band (334 bp of the sequence containing the stop codon UGI was removed). Purify the sample using a gel extraction kit and set aside for later use.
[0110] 3) Ligate the target fragment from 1) to the linearized vector described above using homologous recombination. Take 1 μL of the ligation product and transform it into E. coli DH5α or TOP10 competent cells using chemical transformation. Spread the product onto Kans resistant plates and incubate overnight at 37°C.
[0111] 4) Pick a single clone from the plate, inoculate it, and perform bacterial PCR. Use the primer combination PESE403J-F1 / NosR-seq (expected product size 509 bp) to identify positive clones.
[0112] 5) Take 200 μL of the shaken bacterial culture of the positive clone and send it for first-generation sequencing. After the correctly sequenced clone is inoculated and cultured, take 500 μL of fresh bacterial culture and add an equal volume of sterile 50% glycerol, and store E. coli glycerol bacteria at -80℃; use a self-made plasmid extraction reagent to extract a small amount of plasmid from the remaining bacterial culture, store it at -20℃, and name it 25EV330-A.
[0113] (II) Construction of the vector GhCBE-EK
[0114] 1) Using PGTR as a template, and primer combination 25EV330-F4 / 25EV330-R4, PCR was used to obtain a 120 bp target fragment containing tRNA and BamHI restriction sites.
[0115] 2) Take 2 μg of 25EV330-A plasmid, digest it with MfeI at 37℃ for 2 h, and then use the sodium acetate-ethanol precipitation method to obtain the purified linearized vector fragment.
[0116] 3) Ligate the target fragment from 1) to the linearized vector described above using homologous recombination. Take 1 μL of the ligation product and transform it into E. coli DH5α or TOP10 competent cells using chemical transformation. Spread the product onto Kans resistant plates and incubate overnight at 37°C.
[0117] 4) Pick a single clone from the plate, inoculate it and perform bacterial PCR. Use primer combination U6-7S / 25EV330-R4 (expected product size 251 bp) to identify positive clones.
[0118] 5) Take 200 μL of the shaken bacterial culture of the positive clone and send it for first-generation sequencing. After the correctly sequenced clone is inoculated and expanded, take 500 μL of fresh bacterial culture and add an equal volume of sterile 50% glycerol, and store E. coli glycerol bacteria at -80℃; use a self-made plasmid extraction reagent to extract a small amount of plasmid from the remaining bacterial culture, store it at -20℃, and name it GhCBE-EK.
[0119] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.
Claims
1. A highly efficient screening method for genetic transformation of plant single-base editing mutants, characterized in that, include: A base editing vector based on nCas9 containing a first resistance gene and a second resistance gene was constructed based on the P2A self-cleaving peptide, with the first resistance gene linked to the C-terminus of the nCas9 protein. The dual-anti-base editing vector was transferred into Agrobacterium strain, infected plant callus tissue, and cultured. The cultured tissues were subjected to first and second resistance screenings using a first screening agent and a second screening agent, respectively, to obtain positive plants that underwent target base editing; the first screening agent was at a high concentration, and the second screening agent was at a commonly used concentration. The first resistance gene and the second resistance gene are different resistance genes, corresponding to the resistance genes of the first selection agent and the second selection agent, respectively.
2. The method for efficient screening of plant single-base editing mutants through genetic transformation according to claim 1, characterized in that, The first resistance gene has better screening specificity in plants than the second resistance gene.
3. The efficient screening method for genetic transformation of plant single-base editing mutants according to claim 1, wherein the dual-resistant base editing vector is used for editing any one type of base; And / or, the method for constructing the dual-resistance base editing vector is to fuse the P2A self-cleaving peptide-first resistance gene fragment to the C-terminus of nCas9 in the original base editing vector, and replace or retain the resistance gene in the original base editing vector as the second resistance gene.
4. The method for efficient screening of plant single-base editing mutants through genetic transformation according to claim 1, characterized in that, The first and second resistance screening processes were performed using basal culture media.
5. The method for efficient screening of plant single-base editing mutants through genetic transformation according to claim 1, characterized in that, The plants mentioned are monocotyledonous plants such as rice or dicotyledonous plants such as cotton.
6. The method for efficient screening of plant single-base editing mutants through genetic transformation according to claim 1, characterized in that, The plant is rice, the first screening agent is hygromycin at a concentration of 60-150 mg / L, and the second screening agent is G418 at a concentration of 30-50 mg / L.
7. The method for efficient screening of plant single-base editing mutants through genetic transformation according to claim 6, characterized in that, The method for constructing the dual-anti-base editing vector includes any one of the following: 1) P2A-HPT was fused into the C-terminus of nCas9 in GhBE3 to obtain the intermediate vector CBE-MfeI-HG; then the GhU6.7 promoter in CBE-MfeI-HG was replaced with an OsU3 promoter and an tRNA sequence to obtain the C-to-T base editing vector CBE-HG. 2) The tRNA sequence was introduced into GhABE8e to obtain 8eABE-A0. P2A-HPT was fused into the C-terminus of nCas9 in 8eABE-A0 to obtain the intermediate vector 24EV225. Then, the OsU3 promoter was used to replace the GhU6.7 promoter in 24EV225 to obtain the A-to-G base editing vector ABE-HG. 3) Replace TadA8e on the ABE-HG vector with the human uracil DNA glycosylation enzyme variant UNGv3 to obtain the base editing vector TBE-HG with T-to-G or C. 4) Based on the ABE-HG vector backbone, TadA8e was replaced with a 19-amino acid nuclear localization peptide; in the second step, the human N-methylpurine DNA glycosylation enzyme variant MPGv6.3 was fused to the C-terminus of nCas9 to obtain the G-to-T or C base editing vector GBE-HG.
8. The method for efficient screening of plant single-base editing mutants through genetic transformation according to claim 1, characterized in that, The plant is cotton, the first screening agent is glyphosate at a concentration of 150-500 mg / L, and the second screening agent is kanamycin at a concentration of 30-50 mg / L.
9. The method for efficient screening of plant single-base editing mutants through genetic transformation according to claim 8, characterized in that, The method for constructing the dual-anti-base editing vector includes any one of the following: 1) P2A-CTP-EPSPs were fused into the C-terminus of nCas9 in 8eABE-A0 to obtain the base editing vector GhABE-EK with A-to-G conversion; 2) P2A-CTP-EPSPs were fused into the C-terminus of nCas9 in GhBE3 to obtain the intermediate vector CBE-MfeI-EK. Then, the tRNA sequence was introduced into CBE-MfeI-EK to obtain the C-to-T base editing vector GhCBE-EK.
10. A method for transgenic plants, characterized in that, This includes constructing plant receptors with resistance to the target gene and screening these plant receptors through genetic transformation; wherein: The genetic transformation screening process includes transferring a dual-resistance base editing vector into an Agrobacterium strain and infecting the callus tissue of a plant recipient and culturing it, and screening using at least two screening agents; The method for constructing the dual-resistance base editing vector is as follows: a base editing vector based on nCas9 containing at least one resistance marker gene is constructed based on the P2A self-cleaving peptide, wherein an resistance marker gene is linked to the C-terminus of the nCas9 protein; The resistance marker gene is different from the target gene that the plant receptor is resistant to. The screening agent includes a screening agent corresponding to the target gene that the plant receptor is resistant to, and a screening agent corresponding to the resistance marker gene.