Establishment and application of frontal bone tissue osteoblast line of humpback perch
By establishing the CAFBOB osteoblast cell line from the frontal bone tissue of humpback perch, we have filled the technical gap in the study of the molecular mechanism of morphological specialization in humpback perch, provided a stable cell model, achieved efficient transfection and osteoblast characteristics, and supported the study of classification disputes and speciesization.
Patent Information
- Application Number
- CN202512055638.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-31
- Publication Date
- 2026-04-10
AI Technical Summary
The lack of osteoblast cell lines in the frontal bone tissue of humpback perch in existing technologies hinders in-depth analysis of the molecular mechanisms of its morphological specialization and resolution of classification disputes.
Using frontal bone tissue from juvenile humpback bass as starting material, the CAFBOB osteoblast line was established by treating with erythrocyte lysis buffer, dry-attach inoculation, and culturing in a dedicated complete culture medium. The cells were then passaged, purified, cryopreserved, and thawed. The culture medium formulation was optimized to maintain cell stability and viability.
A stable, passageable osteoblast cell line from the frontal bone tissue of the humpback perch was established, possessing efficient transfection and osteoblast characteristics. This provides a model for studying the molecular mechanisms of morphological specialization in humpback perch and resolves classification controversies and provides a new vector for speciesization research.
Smart Images

Figure CN121825865A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to the establishment and application of an osteoblast cell line from the frontal bone tissue of a humpback perch. Background Technology
[0002] The humpback perch (Cromileptes altivelis), commonly known as the mouse grouper, belongs to the order Perciformes, family Epinephelidae, and genus Cromileptes. It is widely distributed in the western Pacific Ocean from southern Japan to Queensland, Australia, and the Indian Ocean side of northwestern Australia, Indonesia, and Malaysia. It is a valuable economic fish valued for both its ornamental and edible qualities, but its population has been severely depleted in recent years, leading to its IUCN listing as Vulnerable. As the most morphologically specialized group of groupers, the humpback perch is classified as its own genus due to its unique "concave head and hunchback" feature. However, its molecular phylogenetic relationship belongs to the genus Cromileptes, showing close kinship with many species in the genus Cromileptes, resulting in some debate regarding its taxonomic status. Furthermore, the humpback perch shares a sympatric distribution with many closely related species, and this unique morphological characteristic is likely crucial for maintaining reproductive isolation and rapid speciation, while also providing it with an advantage and competitiveness in adapting to its ecological environment. Therefore, conducting research on the morphological specialization of the humpback perch can not only provide evidence to resolve its classification disputes, but also lay a theoretical foundation for the research on its rapid speciesization.
[0003] Humpbacked bass do not exhibit a hunched back in the early stages of hatching; rather, their morphology gradually specializes as they grow and develop. Early research by the inventors indicated that the gradual remodeling of the frontal bone is one of the main reasons for the gradual humping of the head and back. This skeletal remodeling process depends on the dynamic balance between osteoblasts and osteoclasts. Histological analysis of the frontal bone of humpbacked bass also showed that osteoblast differentiation was more active during its specialization phase. This suggests that the proliferation and differentiation of osteoblasts in the frontal bone tissue may provide a cellular basis for its morphological remodeling (Cao, X.; Deng, S.; Liu, Q.; Wu, L.; Zhuang, X.; Ding, S. Important Role of the Ihh Signaling Pathway in Initiating Early Cranial Remodeling and Morphological Specialization in Cromileptes altivelis. Animals 2023, 13, 3840). However, cell lines derived from frontal bone tissue have not yet been reported, and this research gap severely restricts the in-depth analysis of the molecular mechanisms of morphological specialization in humpbacked bass. Therefore, establishing an osteoblast cell line from the frontal bone tissue of the humpback perch will provide a good research model for elucidating the molecular mechanisms of its morphological specialization, and also provide a new vehicle for resolving its classification controversies and speciesization research. Summary of the Invention
[0004] The purpose of this invention is to address the problem of the unique morphological feature of "concave head and hunchback" in the development of humpback perch, which has caused controversy over its classification. This invention provides an osteoblast cell line from the frontal bone tissue of humpback perch, providing a new carrier for studying the molecular mechanism of its morphological specialization, resolving classification disputes, and studying the speciesization process.
[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0006] This invention provides osteoblasts from the frontal bone tissue of Cromileptes altivelis, named the Cromileptes altivelis frontal bone osteoblast line CAFBOB, which was deposited at the China Center for Type Culture Collection on May 17, 2025, with accession number CCTCC NO:C2025129.
[0007] This invention uses frontal bone tissue from juvenile Cromileptes altivelis as the starting material. After removing attached blood cells by treating with erythrocyte lysis buffer, the tissue was inoculated using the dry-attach method and cultured in a dedicated complete culture medium for primary culture. Following multiple passages and purification using cell culture techniques, a Cromileptes frontal bone osteoblast cell line was established and named the Cromileptes frontal bone osteoblast cell line CAFBOB. This cell line was deposited on May 17, 2025, at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, with accession number CCTCC NO: C2025129.
[0008] This cell line has the following biological characteristics:
[0009] 1) Morphological characteristics: During passage 1-40, the cells are mainly long spindle-shaped and morphologically stable;
[0010] 2) Growth characteristics: It grows well in L-15 complete culture medium containing specific additives at 27℃, can be passaged every 2-3 days, and has stable proliferation capacity.
[0011] 3) Karyotype characteristics: Chromosome karyotype analysis showed that 78% of the mitotic cells had a chromosome number of 2n=48, indicating a stable karyotype;
[0012] 4) Osteogenic characteristics: Positive for alkaline phosphatase staining, exhibiting strong alkaline phosphatase activity, consistent with osteoblast core characteristics;
[0013] 5) Transfection characteristics: It can efficiently receive foreign genes. The transfection efficiency after electrotransfection of pEGFP-N1 plasmid is about 85%, which is suitable for experiments related to foreign gene expression.
[0014] 6) Cryopreservation and thawing characteristics: After cryopreservation with programmed gradient cooling, the cell adhesion rate reaches 60%-80% after thawing for 24 hours. The cell morphology and proliferation capacity after thawing are not significantly different from those before cryopreservation, and the cells can be passaged normally.
[0015] This invention obtains a humpback perch frontal bone osteoblast line by isolating humpback perch frontal bone tissue, culturing it using the dry-attach method, initiating primary culture, initiating passage culture, cryopreservation and thawing.
[0016] The present invention also provides a method for establishing the CAFBOB osteoblast line from the frontal bone tissue of the humpback bass (Cromileptes altivelis), comprising the following steps:
[0017] 1) Obtaining frontal bone tissue from humpbacked bass
[0018] Juvenile humpback bass were placed on ice until they showed no response to stress. The mucus on the surface of the fish was wiped off with sterile gauze, and then the surface of the fish was wiped with gauze soaked in alcohol. The frontal bone tissue of the humpback bass was removed and placed in PBS solution containing penicillin, streptomycin and amphotericin B (100 mL of PBS solution was added to 1 mL of 100× concentrate of commercially available triple antibiotics).
[0019] 2) Primary culture of frontal bone tissue from humpbacked bass
[0020] The above-mentioned humpbacked bass frontal bone tissue was minced into small tissue pieces of approximately 2.0 mm and rinsed three times with PBS solution. After rinsing, the tissue pieces were transferred to 15 mL centrifuge tubes, and the attached blood cells were lysed using commercially available erythrocyte lysis buffer. The tissue pieces were then washed three times with PBS solution, and the tissue pieces were evenly placed into cell culture flasks. The bottom of the culture flasks was resuspended and moistened with 1 mL of complete culture medium, and primary culture was initiated at 27°C and 5% CO2. 1 mL of culture medium was added on the second day; another 1 mL of culture medium was added on the third day; and the complete culture medium was replaced once on the fourth day, with an additional 5 mL of complete culture medium added for primary culture.
[0021] 3) Passage culture of frontal bone tissue cells from humpbacked bass
[0022] When primary cultured cells reach 80-90% adherent cell coverage, remove the old culture medium, add 3 mL of PBS for washing to remove residual serum and divalent metal ions, and discard the waste liquid (using a 1 mL pipette tip). Then, passage the cells using 0.25% trypsin digestion, ensuring all cells at the bottom of the flask are submerged. Seal the flask, shake for 2-3 minutes, and observe the cells under an inverted microscope. As time progresses, the originally adherent cells gradually become more rounded. Before they float to the surface, discard the trypsin and add 10 mL of culture medium to stop digestion. Digestion can also be observed visually; stop digestion when the bottom of the flask turns white and fine pinholes appear. Digestion at room temperature typically takes 1-3 minutes. Use a pipette to resuspend the adherent cells and transfer them to two or three other flasks. Briefly heat the flask opening and cap over an alcohol lamp flame, then seal the flasks and continue culturing at 27°C. Observe the adherent growth the next day. The cells were passaged at a ratio of 1:2; thereafter, they were passaged every 2-3 days until 210 days, 40 generations, at which point the osteoblast cell line of the humpbacked bass frontal bone was successfully established.
[0023] 4) Cryopreservation of frontal bone tissue cells from humpbacked bass
[0024] This invention also provides a method for cryopreserving the CAFBOB osteoblast cell line from the frontal bone of the humpback perch (Cromileptes altivelis). A bottle containing a vigorous, fully grown frontal bone osteoblast cell line is taken and centrifuged using trypsin digestion. The cell pellet is collected, and serum-free cryopreservation solution is slowly added. The cells are gently pipetted to ensure even dispersion. The liquid is then transferred to cryovials using a pipette. The cryovials are placed at 4°C for 1 hour, then placed in a programmed gradient cooling cryopreservation box at a temperature decrease rate of 1°C / min. The cryopreservation box is placed at -80°C for 1 day. Finally, the cryovials are removed and immersed in liquid nitrogen for long-term cryopreservation.
[0025] 5) Recovery of frontal bone tissue cells from humpback perch
[0026] This invention also provides a method for thawing the CAFBOB osteoblast cell line from the frontal bone tissue of the humpback perch (Cromileptes altivelis). The cryovial is removed from liquid nitrogen and quickly placed in a water bath at 40°C. During the thawing process, the cryovial should be continuously shaken to ensure rapid and uniform thawing until completely thawed. The thawed cell suspension is then transferred to a centrifuge tube in a culture flask, and complete culture medium is added to the culture flask. The flask is then incubated at 27°C with 5% CO2. After 24 hours, the complete culture medium is replaced, and the culture continues.
[0027] 6) Application of frontal bone tissue cells of humpback perch in gene function
[0028] The osteoblasts of the frontal bone of the humpback perch of this invention were analyzed by alkaline phosphatase activity identification, transfection efficiency analysis, and dual-luciferase assay. The functional verification analysis of related genes was initially obtained, laying the foundation for the functional study of development-related genes such as skeletal specialization in humpback perch. This provides a new carrier for studying the molecular mechanism of its morphological specialization, resolving classification disputes, and studying the speciesization process.
[0029] The above complete culture medium: based on L-15 culture medium, the added amounts of fetal bovine serum, β-mercaptoethanol, human basic fibroblast growth factor (Human FGF-basic), human epithelial growth factor (Human EGF), human hepatocyte growth factor (Human HGF), human leukemia inhibitory factor (Human LIF), penicillin, streptomycin, and fish serum were 15 vol%~20 vol%, 0.5 vol‰, 10 μg / L, 5 μg / L, 1 μg / L, 1 μg / L, 100 IU / mL, 100 μg / mL, and 1 vol%, respectively.
[0030] The above-mentioned fish serum was prepared as follows: A 10 mL syringe was moistened with 15% (w / v) EDTA, and blood was collected from the tail vein of grouper into a 15 mL centrifuge tube placed on ice. The solution was centrifuged at 3,500 g for 15 min, and the supernatant was transferred to a 50 mL centrifuge tube and incubated overnight at 4°C. The solution was then centrifuged again at 3,500 g for 30 min. The supernatant was filtered through a 0.2 μm filter for sterilization. The supernatant was aliquoted into 10 mL tubes and stored at -20°C.
[0031] The CAFBOB osteoblast cell line from the frontal bone of the humpback bass can be used to establish a cell model for studying morphological specialization (frontal bone remodeling) in humpback bass.
[0032] The CAFBOB osteoblast cell line from the frontal bone of the humpback perch can be used in cell models to study the differentiation mechanism of osteoblasts in humpback perch, the cellular basis of frontal bone remodeling, and the regulatory mechanism of morphological specialization.
[0033] The CAFBOB osteoblast cell line from the frontal bone tissue of the humpback perch can be applied in elucidating the molecular mechanisms of morphological specialization in humpback perch, resolving its classification controversies, and developing a model for the speciesization process.
[0034] The CAFBOB osteoblast cell line from the frontal bone tissue of the humpback perch can be used to detect osteogenic genes in humpback perch (such as...). En1b Applications in cell models for gene function verification, promoter activity analysis, and gene interaction research.
[0035] The CAFBOB osteoblast cell line from the frontal bone tissue of the humpback perch can be used in the species origin verification of humpback perch-derived cell lines and as a cell model for cytogenetic studies.
[0036] In addition, the CAFBOB osteoblast cell line from the frontal bone of the humpback perch can also be used in the large-scale preparation, long-term preservation, and resuscitation of the humpback perch frontal bone osteoblast cell line.
[0037] The technical problem solved by this invention:
[0038] The method for constructing the frontal bone tissue cell line of the humpback perch of the present invention has high reproducibility and the cultured frontal bone tissue cell line has good stability.
[0039] This invention uses electrotransfection to perform transfection experiments on the frontal bone tissue cell line of humpback perch, achieving high transfection efficiency.
[0040] The cellular characteristics of the frontal bone tissue of the humpbacked perch of this invention are excellent; the chromosome karyotype analysis is stable.
[0041] The osteoblasts of the frontal bone of the humpback perch of this invention were analyzed by alkaline phosphatase activity identification, transfection efficiency analysis and dual-luciferase assay, and functional verification analysis of related genes were obtained. This provides a good research model for elucidating the molecular mechanism of its morphological specialization, and also provides a new carrier for resolving its classification controversy and speciesization research.
[0042] Compared with the prior art, the advantages of the present invention are:
[0043] The complete culture medium used in the construction method of this invention consists of L-15 medium as the basal medium, fetal bovine serum, β-mercaptoethanol, human basic fibroblast growth factor (FGF-basic), human epithelial growth factor (EGF), human hepatocyte growth factor (HGF), human leukemia inhibitory factor (LIF), penicillin, streptomycin, and sea bass serum. L-15 medium and fetal bovine serum (FBS) provide sufficient nutrients for cell growth; the addition of β-mercaptoethanol, human FGF-basic, human EGF, and human HGF stimulates cell activity and accelerates cell division and proliferation, while providing a good buffer environment for in vitro cell culture, enabling cells to maintain a stable pH during long-term culture; fish serum helps improve the mitotic activity of fish cells in culture and may be one of the key additives in current culture media; the addition of LIF effectively inhibits the differentiation of frontal bone osteoblasts and promotes cell proliferation.
[0044] This invention establishes, for the first time, an osteoblast cell line from the frontal bone tissue of the humpback perch, filling a research gap in bone tissue cell lines for this species and providing a dedicated cell model for studying its morphological specialization mechanisms. The construction method of this invention exhibits good reproducibility; the cell line maintains stable morphology, karyotype, and growth characteristics even after 40 passages, and its viability remains stable after cryopreservation and thawing, allowing for long-term experimental use. This cell line possesses excellent transfection characteristics (transfection efficiency up to 85%) and osteoblast specificity, meeting various experimental needs such as gene function verification and osteogenic mechanism analysis, and is particularly suitable for research on genes related to morphological specialization. The entire culture medium formula has been specifically optimized, with the addition of various growth factors and sea bass serum. L-15 culture medium and fetal bovine serum provide basic nutrition, while various growth factors can stimulate cell activity, accelerate proliferation, and maintain stable pH. Fish serum enhances cell mitotic activity, and LIF can inhibit osteoblast differentiation and promote proliferation, ensuring stable cell culture in vitro. This invention provides a new platform for elucidating the molecular mechanism of the "concave head and hunchback" morphological specialization of the humpback sea bass, resolving its classification controversy, and studying its speciesization process. At the same time, it provides technical support for the resource protection and breeding research of precious and vulnerable fish species. Attached Figure Description
[0045] Figure 1 Image of primary cultured frontal bone tissue cells of humpback perch after 5 days;
[0046] Figure 2 Image of primary cultured frontal bone tissue cells of humpbacked perch after 7 days;
[0047] Figure 3 Image of first-generation passaged cells from the frontal bone tissue of the humpbacked perch;
[0048] Figure 4 Image showing second-generation passaged culture of frontal bone tissue cells from humpbacked perch;
[0049] Figure 5 Figure 5 shows the passaged cells of the frontal bone tissue of the humpbacked perch.
[0050] Figure 6 Image of frontal bone tissue cells of humpbacked perch passage 10 times;
[0051] Figure 7 Figure 15 shows the passaged cells of the frontal bone tissue of the humpbacked perch.
[0052] Figure 8 Figure 20 shows the passaged cells of the frontal bone tissue of the humpbacked perch.
[0053] Figure 9 Image of frontal bone tissue cells from humpbacked perch cultured for 25 generations;
[0054] Figure 10 Image of frontal bone tissue cells of humpbacked perch passage 30 generations;
[0055] Figure 11 Figure 35 passages of frontal bone tissue cells from humpbacked perch.
[0056] Figure 12 Image of the frontal bone tissue cell line of humpback perch 24 h after cryopreservation and thawing;
[0057] Figure 13 Image showing the species origin identification results of the frontal bone tissue cell line of the humpback perch;
[0058] Figure 14 Image showing the karyotype analysis results of the frontal bone tissue cell line of humpbacked perch;
[0059] Figure 15 Image showing alkaline phosphatase staining of cells from the frontal bone tissue of the humpbacked bass;
[0060] Figure 16 Image showing the results of transfecting EGFP into the frontal bone tissue cell line of humpback perch;
[0061] Figure 17 The image shows the results of a dual-luciferase assay using the frontal bone tissue cell line of the humpback perch. Detailed Implementation
[0062] To make the objectives, technical solutions, and advantages of this invention clearer, the following embodiments will be used in conjunction with the accompanying drawings to further illustrate the invention. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
[0063] Unless otherwise specified, the experimental methods and reagents described in the following examples are all conventional methods.
[0064] Example 1: Establishment of the frontal bone tissue cell line of the humpbacked perch according to the present invention
[0065] (1) Place the juvenile humpback bass on ice until the fish show no stress response to stimulation. Wipe off the mucus on the fish's body with sterile gauze. Wipe the fish's body twice with gauze soaked in 75% alcohol. Transfer the fish to a clean bench and remove the frontal bone tissue with dissecting instruments. Rinse the tissue 3-4 times in PBS solution containing 1X commercial triple antibodies (penicillin, streptomycin, and amphotericin B) (i.e., 100mL of PBS solution with 1mL of 100X concentrated commercial triple antibodies). (2) Use two No. 11 scalpels to cross-cut the frontal bone tissue into small tissue pieces of about 2 mm. Rinse the cut tissue pieces three times with PBS solution containing triple antibodies. After rinsing, transfer the tissue fragments to 15 mL centrifuge tubes. Lyse the attached blood cells using commercially available erythrocyte lysis buffer. Wash three times with PBS solution. Evenly distribute the tissue fragments into cell culture flasks, resuspend and moisten the bottom of the flasks with 1 mL of complete culture medium, and initiate primary culture at 27°C. Add 1 mL of culture medium on the second day, another 1 mL on the third day, and replace the complete culture medium once on the fourth day, adding 5 mL of complete culture medium for primary culture. Figures 1 to 2 As shown, adherent cells migrated from the frontal bone tissue around the bone tissue as early as day 5 after the initiation of primary culture of humpbacked bass. Figure 1 By day 9, the cell count had increased to 70-80%. Figure 2 ).
[0066] (3) When the primary culture of the humpback bass frontal bone cell line reaches 80-90% or higher of the adherent cell coverage, the primary cells may show obvious contact inhibition. At this time, the passage culture should be started by trypsin digestion. The classic cell digestion procedure was followed: The old culture medium in the original culture flask was removed; 5 mL of PBS solution was added, and the flask was washed once to remove serum and divalent metal ions (these substances greatly affect trypsin digestion); the PBS solution was poured out, and 0.5 mL of 0.25% commercially available EDTA-containing trypsin digestion solution was added. The flask was shaken to ensure sufficient contact between the trypsin solution and the underlying cells. The trypsin digestion solution was then poured out (this step should be performed quickly to avoid over-digestion; sufficient solution should be left to keep the bottom of the flask moist when removing the trypsin digestion solution, otherwise some areas at the bottom of the flask may dry out and affect digestion); the culture flask was removed and observed under an inverted microscope. Once most cells became rounded and detached from the wall, the flask was immediately transferred to a clean bench and 5 mL of serum-containing complete culture medium was added to terminate digestion; the cells were pipetted and examined under a microscope. If there were too many residual cells, digestion could be repeated once; the cell suspension was seeded into a new culture flask at a 1:2 ratio, and the culture medium was added to 5 mL. The culture flask was then incubated at 27°C. Subsequent incubation was performed every 2 weeks. Reproduction occurs every 3 days. For example... Figures 3 to 11 As shown, the humpback perch frontal bone cell line consistently exhibited a predominantly elongated spindle shape from generation 1 to generation 40. These experiments demonstrate that the cell line culture method established in this invention is stable and reliable, and can be applied to the large-scale preparation of humpback perch frontal bone osteoblast cells.
[0067] Example 2: Cryopreservation and thawing of osteoblast cells from the frontal bone of humpback perch
[0068] (1) Cryopreservation: Take one 75 cm bottle 2 The vigorous growth of osteoblast cells from the frontal bone of the humpback perch, which covered the bottom of the culture flask, was digested with trypsin. After centrifugation, the cell pellet was collected, and 3 mL of prepared cell cryopreservation solution was slowly added. The cells were gently pipetted to disperse them evenly in the cryopreservation solution. The liquid was then transferred into cryovials using a pipette. The cryovials were incubated at 4°C for 1 hour, then placed in a programmed gradient cooling cryopreservation box (temperature decrease rate of 1°C / min). The cryopreservation box was then placed at -80°C for 1 day. Finally, the cryovials were removed and immersed in liquid nitrogen for long-term cryopreservation.
[0069] (2) Remove the cryovials from liquid nitrogen and quickly place them in a preheated water bath (40°C). During the thawing process, continuously shake the cryovials to ensure rapid and even thawing until completely thawed. Transfer the thawed cell suspension to a 25 cm³ container. 2 Add 5 mL of complete culture medium to the centrifuge tube in the culture flask, and incubate at 27°C with 5% CO2. After 24 hours, replace with fresh complete culture medium and continue incubation. Figure 12As shown, the adhesion rate of the humpback bass frontal bone osteoblasts reached 60%-80% after cryopreservation and thawing for 24 hours, with no significant difference in cell morphology compared to before cryopreservation. The thawed humpback bass frontal bone osteoblasts can be passaged normally.
[0070] The above experiments demonstrate that the cell cryopreservation and thawing method of the present invention has excellent effects and can be applied to the long-term preservation and subsequent thawing of the frontal osteoblast cell line of humpback perch.
[0071] Example 3: Species identification and verification of the humpback perch frontal bone cell line
[0072] The frontal bone cell line of humpback perch was identified using RT-PCR technology. En1b Gene (upstream primer sequence (5'-3'): ATGGAAGAGCAAAAGGAG, downstream primer sequence (5'-3'): CTATTCACTGTCCTCCTTGTCC); such as Figure 13 As shown, En1b The gene was highly expressed in both frontal bone tissue and frontal bone cells. After gelatinization and purification, the sequencing sequence was similar to that of the humpback perch. En1b The gene sequence alignment results were over 99%. These experiments demonstrate that the identification method established in this invention is accurate and effective, and can be applied to species tracing and verification of cell lines derived from humpback perch.
[0073] Example 4 Chromosome analysis of the frontal bone cell line of humpback perch
[0074] Harvesting bony cells from humpback bass (passage 30, cells in good condition and almost completely adhering to the bottom of the flask at 48 hours) were collected and seeded at a height of 75 cm. 2 Cell culture flasks were prepared until cells reached the logarithmic growth phase. Colchicine was added to a final concentration of 20 μg / mL, and the cells were cultured for 6-8 h. Cell suspension was then collected. The cell suspension was transferred to 15 mL centrifuge tubes and centrifuged at 1,000 g for 10 min. The supernatant was gently aspirated, and 4 mL of 0.075 M KCl was added for hypotonic treatment for 30 min. 0.5 mL of freshly prepared, pre-chilled Carnoy's fixative was added for pre-fixation for 10 min, followed by centrifugation at 2,000 g for 10 min. The cell pellet was collected and resuspended with 0.5 mL of Carnoy's fixative using a pipette. Another 1 mL of fixative was added. A drop was placed from a height of 30 cm onto a glass slide (pretreated at -20 °C), placed horizontally to ensure complete spread, and dried at 65 °C. The slide was then immersed in a staining jar containing Giemsa stain working solution for 10 min, rinsed with double-distilled water to remove surface debris, dried, mounted with neutral resin, and observed and counted under a 1000 × oil immersion microscope. Figure 14As shown, chromosome analysis of the humpback perch frontal bone cell line revealed that 78% of the cells in the mitotic phase had a chromosome number of 2n=48. These experiments demonstrate that the cell line established in this invention has a stable karyotype and can be applied in humpback perch cytogenetic studies and morphological specialization-related karyotype mechanism analysis models.
[0075] Example 5: Alkaline phosphatase staining analysis of the frontal bone cell line of humpback perch
[0076] Harvesting humpback periosteal bone cells (passage 30, cells in good condition and almost completely adhering to the bottom of the flask at 48 h) were collected and cultured in cell culture plates to a suitable density (until cells reach 80% confluence for subsequent experiments). The culture medium was aspirated, and the cells were gently washed twice with pre-chilled PBS. 4% PFA was added, and the cells were fixed at room temperature for 15-20 minutes. The cells were washed three times with PBS, 5 minutes each time. 0.1% Triton X-100 (prepared with PBS) was added, and the cells were incubated at room temperature for 10 minutes. The cells were washed twice with PBS, 5 minutes each time. BCIP / NBT staining solution was prepared according to the manufacturer's instructions (operate in the dark). The staining solution was evenly applied to the cells, and the cells were placed in a light-proof container and incubated at 37°C or room temperature for 30-60 minutes (observe the staining under a microscope). After staining (appearance of a blue-purple precipitate), the reaction was stopped with PBS or deionized water, and the cells were washed three times. Figure 15 As shown, the humpback bass frontal bone cell line was stained blue-purple, indicating that this cell line has strong alkaline phosphatase (ALP) activity and possesses osteoblast characteristics. The above experiments demonstrate that the cell line established in this invention possesses core osteoblast characteristics and can be applied in the study of humpback bass osteogenic mechanisms and the analysis model of osteogenic function related to frontal bone remodeling, providing support for elucidating the morphologically specialized cellular basis.
[0077] Example 6: Analysis of EGF transfection efficiency of humpbacked bass frontal bone cell line
[0078] Vigorously dividing humpbacked bass frontal bone cells (passage 30, cells in good condition and largely adhering to the bottom of the flask at 48h) were used for transfection experiments using a BEX™ CUY21 EDIT II electroporator. The pEGFP-N1 plasmid was electroporated into the humpbacked bass frontal bone cell line. The culture medium was changed after 24h, and cell status was observed after 48h. Cells were gently washed twice with pre-chilled PBS, and fixed for 10 minutes at room temperature with 4% PFA. They were then washed three times with PBS for 3 minutes each time. 0.1% Triton X-100 (prepared with PBS) was added, and the cells were incubated at room temperature for 10 minutes. They were then washed twice with PBS for 2 minutes each time. DAPI staining solution was prepared according to the manufacturer's instructions (protected from light). The staining solution was evenly applied to the cells, and the cells were incubated in a light-protected container at room temperature for 15 minutes for nuclear staining. Cells were washed three times with PBS for 1 minute each time. The expression of green fluorescence in the cells was observed and photographed under an inverted fluorescence microscope. Figure 16 As shown, 48 h after transfection, the cell nuclei stained blue, and the pEGFP-N1 plasmid expressed green fluorescence in the cell line, with a transfection efficiency of approximately 85%. This indicates that the established humpback perch frontal bone cell line can adapt to transfection experiments of exogenous genes. The above experiments demonstrate that the cell line established in this invention has high transfection efficiency and can be applied in the functional verification of exogenous genes in humpback perch and in the research model of gene regulatory mechanisms related to morphological specialization.
[0079] Example 7: Dual-luciferase assay of humpback perch frontal bone cell line
[0080] The plasmids used for transfection in this experiment were the target plasmid (PGL3-en1b-basic, pCDNA3.1-en1b-8s), the internal control plasmid (TK), the negative control (PGL3-basic), and the positive control (PGL3-en1b-basic).
[0081] When cells have grown well after passage and reached 70%–80% confluency, transfection can be performed. After digestion, do not discard the mixture; directly add an appropriate amount of fresh cell culture medium, repeatedly pipette, and then seed the cells into 48-well plates. Incubate in a constant temperature incubator. After 24 hours, observe the cells under a microscope. If all cells adhere to the plate and the density reaches 70%–80%, transfection can be performed. Use Lipofectamine 3000 as the transfection reagent, with a ratio of internal control plasmid to target plasmid of 1:20. The specific procedure is as follows:
[0082] Before transfection, the concentration of the transfected plasmid needs to be determined, and the concentrations of the en1b promoter plasmid and en1b overexpression plasmid should be diluted to approximately 200 ng / μL, while the internal control plasmid should be diluted to 50 ng / μL. Add 1 μg (5 μL) of plasmid to 25 μL of Opti-MEM medium, mix well, and then incubate at room temperature for 5 min. Simultaneously, take a new 1.5 mL EP tube and add 1 μL of Lipo3000 transfection reagent to 25 μL of Opti-MEM medium, mix well by pipetting, and incubate at room temperature for 5 min. After 5 min, dropwise add the plasmid and Opti-MEM medium mixture to the transfection reagent and Opti-MEM medium mixture, mix by pipetting, and then incubate at room temperature for 20 min. During this time, aspirate the old cell culture medium from the culture plate and slowly add 200 μL of Opti-MEM medium. Carefully dropwise add the above mixture into the culture plate, 50 cells per well. Add μL of the solution and gently tap the bottom of the culture plate to mix thoroughly. After transfection, return the 48-well plate to the incubator for 24 h. Cells can then be collected for activity assay. Dual-luciferase activity was measured using the Promega Dual-Luciferase® Reporter Assay System kit and the Berthold LB9508 tube chemiluminescence analyzer. The activities of firefly luciferase and Renilla luciferase were recorded separately; the ratio of their activities represents the relative activity of the plasmid dual-luciferase reporter gene. Figure 17 As shown, it can be seen that after overexpression of pCDNA3.1-en1b-8s, En1b The activation of the promoter activity indicates that the established osteoblast line from the frontal bone tissue of the humpbacked bass can adapt to overexpression experiments and experiments involving interactions between promoters.
[0083] The above experiments demonstrate that the cell line established in this invention can be used to detect osteogenic genes in humpback perch (such as...). En1b It is applied in promoter activity analysis, gene interaction and functional verification models of genes, providing key technical tools for elucidating the molecular mechanisms of morphological specialization.
[0084] The above embodiments are merely preferred embodiments of the present invention and should not be considered as limiting the scope of the present invention. All equivalent variations and improvements made within the scope of the present invention should still fall within the patent coverage of the present invention.
Claims
1. A bone tissue osteoblast cell line of the preopercular bone of the Sciaenops ocellatus, characterized by, The cell line is named CAFBOB, and has been preserved in the China Center for Type Culture Collection on May 17, 2025, with a preservation number of CCTCC NO: C2025129.
2. The method for establishing osteoblast cells from the frontal bone tissue of the humpbacked bass as described in claim 1, characterized in that, The method comprises the following steps: 1) Tissue acquisition: the young A. percna is placed on ice to be free of stress, and the frontal bone tissue is taken out after disinfection and placed in PBS containing penicillin, streptomycin and amphotericin B; 1 mL of 100x commercial three-antibody concentrate is added to 100 mL of the PBS; 2) Primary culture: the frontal bone tissue is cut into about 2.0 mm, washed with PBS, treated with red blood cell lysis solution, and then dried and pasted into a culture bottle, and complete culture solution is added, and primary culture is started at 27 DEG C and 5% CO2, and the culture solution is gradually supplemented and replaced; the complete culture solution is based on L-15, and 15vol%-20vol% fetal bovine serum, 0.5vol% β-mercaptoethanol, 10 μg / L human basic fibroblast growth factor, 5 μg / L human epithelial cell growth factor, 1 μg / L human hepatocyte growth factor, 1 μg / L human leukemia inhibitory factor, 100 IU / mL penicillin, 100 μg / mL streptomycin and 1vol% sea bass serum are added; 3) Subculture: when the primary cells grow to 80%-90% coverage, they are washed with PBS, digested with 0.25% trypsin, and the digestion is terminated with culture solution, and then subcultured at a ratio of 1:2, and cultured at 27 DEG C, and subcultured every 2-3 days, and cultured to 210 days and 40 generations; 4) Freezing and recovery: logarithmic phase cells are taken, digested and centrifuged, and then serum-free freezing solution is added, and placed at 4 DEG C for 1h, and then gradually cooled at 1 DEG C / min to-80 DEG C for 1 day, and finally stored in liquid nitrogen; when recovered, it is quickly thawed in a 40 DEG C water bath, and then inoculated and cultured at 27 DEG C and 5% CO2, and the culture solution is replaced after 24h.
3. The method for establishing osteoblast cells from the frontal bone tissue of a humpbacked bass as described in claim 2, characterized in that, The preparation method of the sea bass serum is as follows: a 15% w / v EDTA is used to soak a syringe, blood is taken from the caudal vein of the Epinephelus, the supernatant is taken by centrifugation at 3500g for 15min, and the supernatant is centrifuged at 3500g for 30min after incubation at 4 DEG C overnight, and then filtered through a 0.2 μm filter to remove bacteria, and stored at-20 DEG C.
4. The A. percna frontal bone tissue osteogenic cell line of claim 1 is applied in the establishment of a cell model for A. percna morphological specialization research.
5. The use of the bone tissue osteoblast cell line of the Serranochromis robustus in the functional verification of Serranochromis robustus osteogenic-related genes; characterized in that, The application comprises alkaline phosphatase activity detection, exogenous gene transfection and dual luciferase reporter gene experiment.
6. The A. percna frontal bone tissue osteogenic cell line of claim 1 is applied in A. percna cell genetics research and species tracing verification.
7. The A. percna frontal bone tissue osteogenic cell line of claim 1 is applied in the analysis of A. percna morphological specialization molecular mechanism, the solution of its classification controversy and the research of speciation process.