KASP molecular marker associated with scutellarin of erigeron breviscapus and application of KASP molecular marker
By using KASP molecular marker technology to detect the 4554564 locus on chromosome 3A in *Erigeron breviscapus*, the problem of inaccurate assessment of *Erigeron breviscapus* serotonin content in existing technologies has been solved, realizing an efficient and accurate breeding method and improving breeding efficiency and stability.
Patent Information
- Application Number
- CN202610123397.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-29
- Publication Date
- 2026-04-10
AI Technical Summary
Existing technologies lack effective methods for rapidly and accurately assessing the content of ligustrazine in the breeding of *Erigeron breviscapus*, resulting in long breeding cycles, high costs, and significant susceptibility to environmental factors.
Using KASP molecular marker technology, specific primer combinations were designed to detect SNPs at the 4554564 locus on chromosome 3A of *Erigeron breviscapus*. Genotypes were distinguished using FAM and HEX fluorescence signals, achieving efficient and accurate assessment of *Erigeron breviscapus* glycoside content.
It improves the efficiency of plant variety selection, shortens the breeding cycle, ensures the genetic stability and high resolution of ligustrazine content, is suitable for high-throughput detection, and significantly improves breeding efficiency.
Smart Images

Figure CN121826211A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a KASP molecular marker associated with scutellarin in *Erigeron breviscapus* and its application. Background Technology
[0002] *Erigeron breviscapus* is a traditional Chinese medicinal plant used to treat cardiovascular and cerebrovascular diseases. Erigeron breviscapus contains ligustrazine, the main active ingredient in the plant, which is a prescription drug for treating these diseases. The medicinal value of *Erigeron breviscapus* depends primarily on the content of ligustrazine in the plant. Therefore, increasing the ligustrazine content in *Erigeron breviscapus* is an important goal in breeding and agricultural production.
[0003] KASP (Kompetitive Allele Specific PCR) is a molecular marker method based on SNP sites, favored in genotyping due to its high stability, accuracy, and cost-effectiveness. It is particularly suitable for high-throughput analysis, especially when processing large numbers of samples but with limited available SNP sites. The application of KASP technology not only improves the speed and efficiency of genotyping but also reduces costs, making it a promising candidate for applications in agricultural breeding, genetic research, and molecular diagnostics.
[0004] Current breeding efforts for *Erigeron breviscapus* still largely rely on traditional phenotypic selection, specifically screening plants after determining the ligustilide content in mature plants using high-performance liquid chromatography (HPLC). This method is time-consuming, costly, and highly susceptible to environmental factors. Although some studies have attempted to explore the genetic basis of ligustilide biosynthesis, no research has yet successfully identified and verified key SNPs (single nucleotide polymorphisms) significantly associated with ligustilide content.
[0005] Therefore, overcoming the shortcomings of existing technologies is a problem that urgently needs to be solved in the field of genetic engineering technology. Summary of the Invention
[0006] The purpose of this invention is to overcome the shortcomings of the prior art and provide a KASP molecular marker associated with scutellarin in *Erigeron breviscapus* and its application.
[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows: The first aspect of the present invention provides a KASP molecular marker associated with scutellarin in *Erigeron breviscapus*, wherein the KASP molecular marker contains the nucleotide sequence of position 4554564 on chromosome 3A of *Erigeron breviscapus*, wherein the base at position 4554564 is A or G.
[0008] Furthermore, the KASP molecular marker is shown in SEQ ID NO.6, where the 101st position is A or G.
[0009] A second aspect of the present invention provides primers for KASP molecular markers associated with scutellarin in *Erigeron breviscapus*, characterized in that they include forward primer 1, forward primer 2, and a shared reverse primer; The nucleotide sequence of the forward primer 1 is shown in SEQ ID NO. 1; The nucleotide sequence of the forward primer 2 is shown in SEQ ID NO.2; The nucleotide sequence of the shared reverse primer is shown in SEQ ID NO.3.
[0010] Forward primer 1: ttttagggatcaaaagtgtaaaagtttta (SEQ ID NO.1); Forward primer 2: ttttagggatcaaaagtgtaaaagttttg (SEQ ID NO.2); Shared reverse primer 4554564-R: aataatggttgtatagtatgaagaccttt (SEQ ID NO.3).
[0011] A third aspect of the present invention provides primers for KASP molecular markers associated with scutellarin in *Erigeron breviscapus*, characterized in that they include a forward primer 1 labeled with a FAM fluorescence signal, a forward primer 2 labeled with a HEX fluorescence signal, and a shared reverse primer. The nucleotide sequence of the forward primer 1 labeled with the FAM fluorescent signal is shown in SEQ ID NO.4, and the nucleotide sequence of the forward primer 2 labeled with the HEX fluorescent signal is shown in SEQ ID NO.5.
[0012] Forward primer 14554564-F1 labeled with FAM fluorescent signal: 5'-gaaggtgaccaagttcatgctttttagggatcaaaagtgtaaaagtttta-3' (SEQ ID NO.4); Forward primer 24554564-F2 labeled with HEX fluorescent signal: 5'-gaaggtcggagtcaacggattttttagggatcaaaagtgtaaaagttttg-3' (SEQ ID NO.5); Shared reverse primer 4554564-R: tctgtatcacgagccaaccacat (SEQ ID NO.3).
[0013] A fourth aspect of the present invention provides detection reagents, detection kits, or test strips containing primers containing the KASP molecular marker associated with scutellarin of *Erigeron breviscapus*.
[0014] The fifth aspect of this invention provides the application of detection reagents, detection kits, or test strips for primers of the KASP molecular marker associated with scutellarin in *Erigeron breviscapus* in marker-assisted breeding of *Erigeron breviscapus*.
[0015] The sixth aspect of this invention provides a method for identifying the content of ligustrazine in plants, characterized by comprising: using the DNA of a sample of *Ligustrazine* to be tested as a template, using primers of the KASP molecular marker associated with ligustrazine in *Ligustrazine*, or using the aforementioned detection reagent, detection kit, or test strip, to perform PCR amplification, and determining the ligustrazine content of the plant sample to be tested based on the amplification results.
[0016] Furthermore, PCR amplification of polymorphic sites is performed using primers with the KASP molecular marker associated with scutellarin, or using the aforementioned detection reagents, detection kits, or test strips. The polymorphic site is the 4554564th site on chromosome 3A of *Erigeron breviscapus*, with polymorphism A or G. *Erigeron breviscapus* with genotype GG has a high scutellarin content, while *Erigeron breviscapus* with genotype AA has a low scutellarin content.
[0017] The seventh aspect of this invention provides primers for the KASP molecular marker associated with ligustrazine in *Erigeron breviscapus*, or the application of the detection reagent, detection kit, or test strip as described below: (1) Used for the identification, breeding and improvement of the content of scutellarin in *Erigeron breviscapus*. (2) Used for early prediction of the high and low content of strychnine in strychnine flower.
[0018] This invention provides a KASP marker related to ligustilide in *Erigeron breviscapus*, which is an SNP molecular marker associated with ligustilide in plants. The marker contains a nucleotide sequence with a polymorphism of A / G at position 4554564 bp on chromosome 3A of *Erigeron breviscapus*. Plants with the polymorphic site containing the marker and the genotype GG have a higher ligustilide content compared to plants with the genotype AA.
[0019] This invention provides a method for identifying the content (high or low) of ligustrazine in plants, comprising: using the DNA of the plant sample as a template, performing PCR amplification using the KASP primer combination or the detection reagent or kit, and determining the ligustrazine content of the plant sample based on the amplification results. The genotypes of the polymorphic sites contained in the marker in the amplification product are analyzed; plants with genotype GG have a higher ligustrazine content than those with genotype AA.
[0020] Compared with the prior art, the beneficial effects of this invention are as follows: (1) This invention successfully identified a SNP locus closely related to the content of scutellarin in plants through phenotypic difference analysis and resequencing technology. The polymorphism detection of this locus can accurately and rapidly assess the scutellarin characteristics of plants; (2) By utilizing KASP technology, the SNP loci and corresponding primer combinations provided by this invention not only improve the efficiency of plant variety selection, but also help shorten the breeding cycle and accelerate the cultivation of high-quality plant varieties. These markers have good genetic stability, high resolution, and are suitable for high-throughput detection, and have significant application value in the field of plant breeding. Attached Figure Description
[0021] Figure 1 This is a statistical chart of the content of scutellarin B at different genotypes of SNP sites obtained by resequencing technology analysis provided in Example 1 of the present invention; Figure 2 This is the genotyping result of *Erigeron breviscapus* at locus 4554564 on chromosome 3A provided in Example 2 of this invention; where NTC: negative control; Empty: empty sample; Unknown: unknown genotype; missing: missing data; Figure 3 This is a statistical chart of the content of ligustrazine B at different genotypes at locus 4554564 on chromosome 3A provided in Example 2 of the present invention; Detailed Implementation
[0022] The present invention will now be described in further detail with reference to the embodiments.
[0023] Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be construed as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed in accordance with the techniques or conditions described in the literature in the field or according to the product instructions. Materials or equipment whose manufacturers are not specified are all conventional products that can be obtained by purchase.
[0024] Example 1: KASP molecular marker sites associated with the content of ligustrazine in *Erigeron breviscapus* Germplasm resources were screened to obtain *Erigeron breviscapus* materials and wild materials from five different regions (Nanjian, Gejiu, Reshui, Baoshan, and Huize), and a total of 360 materials were subjected to 10X whole-genome resequencing.
[0025] The *Erigeron breviscapus* sample was dried at 55℃ to constant weight, pulverized using a pulverizer, and 0.1 g of the sample (passed through a 40-mesh sieve) was accurately weighed and placed in a 10 mL volumetric flask. 70% methanol was added and the volume was adjusted to the mark. The sample was sonicated in a water bath at room temperature for 45 min. After standing for 2 hours, the supernatant was collected and filtered through a 0.45 μm microporous membrane to obtain 1 mL of the test solution.
[0026] High-performance liquid chromatography (HPLC) was used to quantitatively analyze scutellarin using the external standard method. The chromatographic column was a Kinetex® C18 (100 × 4.6 mm, 2.6 μm), the flow rate was 0.6 ml / min, the column temperature was 30℃, and the injection volume was 10 µl. The detection wavelength was 335 nm. The mobile phase was acetonitrile (A) and 0.2% phosphoric acid aqueous solution (B), with the following elution gradient: 0 min, 15% A; 0–25 min, 15%–22% A; 25–26 min, 22%–90% A; 26–33 min, 90% A; 33–35 min, 90%–15% A; 35–40 min, 15% A. Linearity was assumed for the gradient changes. Identification was based on retention time, and quantification was performed using the external standard method, with peak area as the quantification basis.
[0027] Using SNP loci as genotypic data and scutellarin (SE) content as phenotypic data, genome-wide association studies (GWAS) were performed using EMMAX software with a mixed linear model (MLM). SNP loci were screened on chromosome 3A of the *Lysimachia christinae* genome, ultimately identifying a significant locus affecting scutellarin content (3A: 4554564 bp). Figure 1 It can be seen that plants with the GG genotype have a higher content of scutellarin B compared to plants with the AA genotype. The sequence information of the gene sequence containing at least 100 bp flanking sequences upstream and downstream of the SNP site, including the 100 bp sequences before and after the Chr3A-4554564 site, is as follows: >Chr3A_4554564,3A, ccacgatgctaacgtccgtttaatggcctggtcacgtgacacgcacaccatgggcaaaatggtcagttcggtttttagggatcaaaagtgtaaaagtttt[a / g]attattgttgatttgttaatgaaaagattattttctttatataatcttttattttttcaaaggtcttcatactatacaaccattattatcatcgacaaca; Using NCBI's Primer-BLAST function and based on the KASP principle, a primer set for PCR amplification to obtain the molecular marker of *Erigeron breviscapus* was further developed and designed. The specific design is as follows: 4554564-F1: 5'-gaaggtgaccaagttcatgctttttagggatcaaaagtgtaaaagtttta-3' (SEQ ID NO.4); the 5' end of this primer, "gaaggtgaccaagttcatgct" (SEQ ID NO.1), is a FAM marker sequence; 4554564-F2: 5'-gaaggtcggagtcaacggattttttagggatcaaaagtgtaaaagttttg-3' (SEQ ID NO.5); the 5' end of this primer, "gaaggtcggagtcaacggatt" (SEQ ID NO.2), is a HEX marker sequence; 4554564-R: aataatggttgtatagtatgaagaccttt (SEQ ID NO. 3).
[0028] When using 4554564-F1 and 4554564-R as primer pairs, they are used to amplify the A-base sequence at chromosome 4554564 on chromosome 3A in the molecular marker of *Erigeron breviscapus*. When using primer pairs 4554564-F2 and 4554564-R, the sequence with a G base at chromosome 4554564 on chromosome 3A in the molecular marker of *Erigeron breviscapus* is amplified.
[0029] Example 2: Application of SNP markers in the identification of scutellarin in *Erigeron breviscapus* Primers were designed using Primer 3 software to target SNP sites and flanking sequences. The genotypes of 580 randomly selected *Erigeron breviscapus* materials were then analyzed, and the association between genotype and *Erigeron breviscapus* serotonin content was identified. The specific process is as follows: First, genomic DNA was extracted using the CTAB method, and the concentration of the DNA sample was detected using a NanoDrop micro-ultraviolet spectrophotometer. The integrity of the DNA sample was detected by 1% agarose gel electrophoresis, and the DNA samples that passed the quality control were used for labeling and detection. Then, using the extracted DNA as a template, the PCR system was assembled using the Gene Matrix high-throughput genotyping system according to the primers designed in Example 1. The PCR reaction system was designed as follows: 1 μL of 15 ng / μL DNA template; 1 μL of 2×KASPMaster mix; 0.01 μL of KASP mixed primers, wherein the KASP mixed primers included upstream primers 4554564-F1, 4554564-F2 and a common reverse primer 4554564-R. The concentrations of upstream primers 4554564-F1, 4554564-F2 and the common reverse primer 4554564-R were all 50 μM, and the volume ratio of the mixed primers was 1:1:3. The PCR amplification program was as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s; annealing at 61–55℃ for 40 s, decreasing the temperature by 0.6℃ per cycle, for 10 cycles; 95℃ denaturation for 20 s, 55℃ annealing for 40 s, for 35 cycles. After PCR amplification, the fluorescence signal was read, analyzed, and converted. The fluorescence scan results were automatically converted into graphs. Both pairs of labeled primers clearly separated the two genotypes. Figure 2 ).
[0030] The 580 *Erigeron breviscapus* materials were divided into three categories according to genotype, coded as Eb1-Eb580. Specific genotypes and statistical results of *Erigeron breviscapus* ligustrazine content are shown in Table 1 and... Figure 3 As shown.
[0031] Table 1. Correspondence between genotypes and scutellarin content of 580 *Erigeron breviscapus* materials serial number genotype Content of ethyl acetate in lamp spores (%) serial number genotype Content of ethyl alcohol in lamp spores (%) serial number genotype Content of ethyl alcohol in lamp spores (%) Eb1 A:A 2.8948% Eb195 A:G 2.1020% Eb389 G:G 2.5938% Eb2 A:A 2.3164% Eb196 A:G 1.9968% Eb390 G:G 2.4016% Eb3 A:A 2.4124% Eb197 A:G 1.6769% Eb391 G:G 2.2149% Eb4 A:A 2.4005% Eb198 A:G 2.0284% Eb392 G:G 2.4120% Eb5 A:A 1.7600% Eb199 A:G 1.3055% Eb393 G:G 2.2098% Eb6 A:A 2.6976% Eb200 A:G 1.0222% Eb394 G:G 2.0439% Eb7 A:A 1.9192% Eb201 A:G 1.9850% Eb395 G:G 3.1448% Eb8 A:A 2.3155% Eb202 A:G 1.7868% Eb396 G:G 3.6027% Eb9 A:A 2.6421% Eb203 A:G 2.1352% Eb397 G:G 3.9456% Eb10 A:A 2.1866% Eb204 A:G 2.5651% Eb398 G:G 2.8481% Eb11 A:A 1.8735% Eb205 A:G 2.1075% Eb399 G:G 2.2360% Eb12 A:A 1.5836% Eb206 A:G 1.6055% Eb400 G:G 2.9302% Eb13 A:A 2.1528% Eb207 A:G 1.4484% Eb401 G:G 2.8162% Eb14 A:A 1.9397% Eb208 A:G 1.8111% Eb402 G:G 2.4993% Eb15 A:A 2.9672% Eb209 A:G 2.6935% Eb403 G:G 2.2993% Eb16 A:A 2.0707% Eb210 A:G 1.9188% Eb404 G:G 2.4374% Eb17 A:A 1.2919% Eb211 A:G 1.6586% Eb405 G:G 3.3392% Eb18 A:A 1.7392% Eb212 A:G 2.7733% Eb406 G:G 3.9032% Eb19 A:A 1.6097% Eb213 A:G 2.0105% Eb407 G:G 2.5825% Eb20 A:A 2.4987% Eb214 A:G 2.6678% Eb408 G:G 3.6675% Eb21 A:A 2.0255% Eb215 A:G 2.0564% Eb409 G:G 2.8599% Eb22 A:A 2.4553% Eb216 A:G 2.9632% Eb410 G:G 2.7119% Eb23 A:A 2.9499% Eb217 A:G 2.8238% Eb411 G:G 2.5900% Eb24 A:A 2.2519% Eb218 A:G 2.1121% Eb412 G:G 2.5001% Eb25 A:A 2.7271% Eb219 A:G 1.5059% Eb413 G:G 3.0897% Eb26 A:A 2.2320% Eb220 A:G 2.5243% Eb414 G:G 3.2429% Eb27 A:A 2.1793% Eb221 A:G 2.0934% Eb415 G:G 3.9013% Eb28 A:A 2.7109% Eb222 A:G 2.8996% Eb416 G:G 3.4782% Eb29 A:A 2.5444% Eb223 A:G 2.0131% Eb417 G:G 3.1258% Eb30 A:A 2.4989% Eb224 A:G 2.4437% Eb418 G:G 2.6175% Eb31 A:A 2.1216% Eb225 G:G 4.8957% Eb419 G:G 2.3990% Eb32 A:A 1.3571% Eb226 G:G 4.8048% Eb420 G:G 3.4082% Eb33 A:A 2.5325% Eb227 G:G 2.8441% Eb421 G:G 2.8255% Eb34 A:A 2.7621% Eb228 G:G 4.3361% Eb422 G:G 2.0814% Eb35 A:A 1.9771% Eb229 G:G 2.5521% Eb423 G:G 2.2494% Eb36 A:A 1.6980% Eb230 G:G 2.8355% Eb424 G:G 3.1048% Eb37 A:A 2.9002% Eb231 G:G 3.3411% Eb425 G:G 2.9555% Eb38 A:A 1.6853% Eb232 G:G 3.5170% Eb426 G:G 2.3205% Eb39 A:A 2.7726% Eb233 G:G 2.4481% Eb427 G:G 2.5134% Eb40 A:A 2.0023% Eb234 G:G 2.3740% Eb428 G:G 2.3483% Eb41 A:A 2.1246% Eb235 G:G 2.6021% Eb429 G:G 2.8984% Eb42 A:A 2.7152% Eb236 G:G 2.7595% Eb430 G:G 2.4950% Eb43 A:A 2.7241% Eb237 G:G 2.9684% Eb431 G:G 3.0381% Eb44 A:A 1.9332% Eb238 G:G 3.2884% Eb432 G:G 2.9275% Eb45 A:A 1.7805% Eb239 G:G 2.7722% Eb433 G:G 2.7716% Eb46 A:A 1.5783% Eb240 G:G 3.4376% Eb434 G:G 2.0927% Eb47 A:A 2.0955% Eb241 G:G 2.7557% Eb435 G:G 2.9437% Eb48 A:A 1.8938% Eb242 G:G 3.4110% Eb436 G:G 2.9096% Eb49 A:A 2.8156% Eb243 G:G 4.0094% Eb437 G:G 2.8272% Eb50 A:A 2.5187% Eb244 G:G 3.1235% Eb438 G:G 2.7421% Eb51 A:A 1.7062% Eb245 G:G 2.9787% Eb439 G:G 2.6138% Eb52 A:A 2.8389% Eb246 G:G 4.4283% Eb440 G:G 2.2918% Eb53 A:A 2.2138% Eb247 G:G 2.9903% Eb441 G:G 2.7405% Eb54 A:A 1.6251% Eb248 G:G 2.6527% Eb442 G:G 2.0499% Eb55 A:A 2.2893% Eb249 G:G 2.6831% Eb443 G:G 2.4341% Eb56 A:A 1.5436% Eb250 G:G 3.1135% Eb444 G:G 3.6842% Eb57 A:A 2.5146% Eb251 G:G 2.2390% Eb445 G:G 3.9833% Eb58 A:A 1.3607% Eb252 G:G 3.4943% Eb446 G:G 3.1076% Eb59 A:A 2.9742% Eb253 G:G 3.1669% Eb447 G:G 3.7714% Eb60 A:A 2.1870% Eb254 G:G 2.8661% Eb448 G:G 2.9735% Eb61 A:A 2.3696% Eb255 G:G 2.8939% Eb449 G:G 2.4852% Eb62 A:A 2.3814% Eb256 G:G 2.8645% Eb450 G:G 4.1406% Eb63 A:A 1.9753% Eb257 G:G 2.5710% Eb451 G:G 3.4000% Eb64 A:A 1.6461% Eb258 G:G 3.1709% Eb452 G:G 3.5747% Eb65 A:A 2.8066% Eb259 G:G 4.3415% Eb453 G:G 3.3803% Eb66 A:A 1.6442% Eb260 G:G 3.7428% Eb454 G:G 3.2852% Eb67 A:A 2.6881% Eb261 G:G 3.4918% Eb455 G:G 3.4847% Eb68 A:A 2.2223% Eb262 G:G 2.1896% Eb456 G:G 3.7704% Eb69 A:A 1.9434% Eb263 G:G 2.4022% Eb457 G:G 2.6940% Eb70 A:A 2.2736% Eb264 G:G 2.9422% Eb458 G:G 2.8300% Eb71 A:A 2.6948% Eb265 G:G 3.5494% Eb459 G:G 2.6209% Eb72 A:A 2.1929% Eb266 G:G 4.0330% Eb460 G:G 3.3340% Eb73 A:A 2.5482% Eb267 G:G 3.0214% Eb461 G:G 3.5193% Eb74 A:A 2.1771% Eb268 G:G 2.1840% Eb462 G:G 2.8106% Eb75 A:A 1.7950% Eb269 G:G 2.6741% Eb463 G:G 2.5048% Eb76 A:A 1.9912% Eb270 G:G 2.1114% Eb464 G:G 3.7911% Eb77 A:A 2.0984% Eb271 G:G 2.5752% Eb465 G:G 2.4624% Eb78 A:A 2.1941% Eb272 G:G 2.6337% Eb466 G:G 3.6449% Eb79 A:A 1.5332% Eb273 G:G 2.2281% Eb467 G:G 3.2678% Eb80 A:A 3.0773% Eb274 G:G 2.7215% Eb468 G:G 3.8765% Eb81 A:A 1.6112% Eb275 G:G 3.9047% Eb469 G:G 4.1429% Eb82 A:A 2.6652% Eb276 G:G 4.1009% Eb470 G:G 3.0919% Eb83 A:A 1.7680% Eb277 G:G 2.7682% Eb471 G:G 4.0764% Eb84 A:A 2.4945% Eb278 G:G 2.3808% Eb472 G:G 2.8294% Eb85 A:A 2.4609% Eb279 G:G 3.6994% Eb473 G:G 3.7790% Eb86 A:A 3.0515% Eb280 G:G 2.8344% Eb474 G:G 3.2749% Eb87 A:A 2.7171% Eb281 G:G 2.6721% Eb475 G:G 2.3877% Eb88 A:A 1.4180% Eb282 G:G 2.5401% Eb476 G:G 3.2533% Eb89 A:A 1.7088% Eb283 G:G 3.1714% Eb477 G:G 2.8874% Eb90 A:A 2.1864% Eb284 G:G 2.9236% Eb478 G:G 3.3971% Eb91 A:A 2.8146% Eb285 G:G 2.0216% Eb479 G:G 3.4497% Eb92 A:A 1.6345% Eb286 G:G 2.5661% Eb480 G:G 3.8714% Eb93 A:A 1.9341% Eb287 G:G 2.9193% Eb481 G:G 4.3489% Eb94 A:A 1.7020% Eb288 G:G 2.7837% Eb482 G:G 3.9719% Eb95 A:A 2.9953% Eb289 G:G 2.0908% Eb483 G:G 4.3262% Eb96 A:A 2.7089% Eb290 G:G 3.5069% Eb484 G:G 2.8089% Eb97 A:A 1.3932% Eb291 G:G 3.2669% Eb485 G:G 3.3286% Eb98 A:A 2.4871% Eb292 G:G 4.6276% Eb486 G:G 2.4553% Eb99 A:A 1.1410% Eb293 G:G 2.7571% Eb487 G:G 4.4734% Eb100 A:A 1.5834% Eb294 G:G 3.0975% Eb488 G:G 3.2831% Eb101 A:G 3.0891% Eb295 G:G 3.7320% Eb489 G:G 2.5220% Eb102 A:G 1.8823% Eb296 G:G 2.5335% Eb490 G:G 3.0880% Eb103 A:G 1.7617% Eb297 G:G 3.3159% Eb491 G:G 3.5500% Eb104 A:G 2.6619% Eb298 G:G 3.6866% Eb492 G:G 2.8230% Eb105 A:G 1.6036% Eb299 G:G 2.6913% Eb493 G:G 4.6320% Eb106 A:G 1.7273% Eb300 G:G 3.3318% Eb494 G:G 2.9423% Eb107 A:G 1.5578% Eb301 G:G 3.6711% Eb495 G:G 3.6268% Eb108 A:G 2.21% Eb302 G:G 3.0859% Eb496 G:G 3.2702% Eb109 A:G 2.21% Eb303 G:G 4.1869% Eb497 G:G 2.5647% Eb110 A:G 2.04% Eb304 G:G 3.4893% Eb498 G:G 2.5580% Eb111 A:G 2.45% Eb305 G:G 2.3313% Eb499 G:G 2.8972% Eb112 A:G 2.0691% Eb306 G:G 2.9637% Eb500 G:G 3.4183% Eb113 A:G 1.5833% Eb307 G:G 2.8057% Eb501 G:G 3.5414% Eb114 A:G 1.9494% Eb308 G:G 2.6206% Eb502 G:G 2.3201% Eb115 A:G 2.2050% Eb309 G:G 3.4009% Eb503 G:G 2.4545% Eb116 A:G 2.6903% Eb310 G:G 2.8784% Eb504 G:G 3.5516% Eb117 A:G 2.1234% Eb311 G:G 2.3958% Eb505 G:G 4.5776% Eb118 A:G 2.5055% Eb312 G:G 2.1996% Eb506 G:G 2.4178% Eb119 A:G 2.3739% Eb313 G:G 2.4848% Eb507 G:G 3.4888% Eb120 A:G 2.3051% Eb314 G:G 2.3130% Eb508 G:G 3.8712% Eb121 A:G 2.4297% Eb315 G:G 2.3547% Eb509 G:G 3.9619% Eb122 A:G 1.6900% Eb316 G:G 3.2890% Eb510 G:G 3.5518% Eb123 A:G 2.1474% Eb317 G:G 3.4804% Eb511 G:G 2.7883% Eb124 A:G 2.1126% Eb318 G:G 2.5976% Eb512 G:G 3.8431% Eb125 A:G 2.8299% Eb319 G:G 2.0771% Eb513 G:G 2.4355% Eb126 A:G 2.3960% Eb320 G:G 3.1502% Eb514 G:G 3.0174% Eb127 A:G 1.9636% Eb321 G:G 2.1897% Eb515 G:G 2.8352% Eb128 A:G 2.6464% Eb322 G:G 3.0623% Eb516 G:G 3.3274% Eb129 A:G 2.8550% Eb323 G:G 2.3315% Eb517 G:G 3.1911% Eb130 A:G 2.1917% Eb324 G:G 3.2222% Eb518 G:G 3.1574% Eb131 A:G 2.1366% Eb325 G:G 2.9941% Eb519 G:G 2.3200% Eb132 A:G 2.4301% Eb326 G:G 2.9646% Eb520 G:G 2.6171% Eb133 A:G 2.0378% Eb327 G:G 2.6000% Eb521 G:G 2.8436% Eb134 A:G 2.3102% Eb328 G:G 2.2893% Eb522 G:G 2.2880% Eb135 A:G 2.2916% Eb329 G:G 2.5724% Eb523 G:G 2.6244% Eb136 A:G 3.0415% Eb330 G:G 4.3054% Eb524 G:G 4.2457% Eb137 A:G 2.6096% Eb331 G:G 2.1108% Eb525 G:G 2.9878% Eb138 A:G 2.7183% Eb332 G:G 2.5841% Eb526 G:G 3.0033% Eb139 A:G 2.2460% Eb333 G:G 3.3383% Eb527 G:G 2.9849% Eb140 A:G 1.7247% Eb334 G:G 2.5539% Eb528 G:G 3.6658% Eb141 A:G 3.0868% Eb335 G:G 3.5808% Eb529 G:G 2.7866% Eb142 A:G 2.5153% Eb336 G:G 4.1411% Eb530 G:G 3.4208% Eb143 A:G 0.9688% Eb337 G:G 3.6855% Eb531 G:G 2.3223% Eb144 A:G 2.3363% Eb338 G:G 2.5816% Eb532 G:G 2.5528% Eb145 A:G 2.0265% Eb339 G:G 3.5458% Eb533 G:G 2.5409% Eb146 A:G 2.2120% Eb340 G:G 2.5674% Eb534 G:G 2.5684% Eb147 A:G 1.7651% Eb341 G:G 3.6450% Eb535 G:G 2.3026% Eb148 A:G 2.5111% Eb342 G:G 2.3511% Eb536 G:G 3.2441% Eb149 A:G 2.2973% Eb343 G:G 2.8487% Eb537 G:G 2.8098% Eb150 A:G 1.9996% Eb344 G:G 2.2739% Eb538 G:G 2.7585% Eb151 A:G 1.7767% Eb345 G:G 3.7146% Eb539 G:G 3.4353% Eb152 A:G 1.6312% Eb346 G:G 2.4300% Eb540 G:G 2.0885% Eb153 A:G 2.3945% Eb347 G:G 3.8057% Eb541 G:G 2.2714% Eb154 A:G 2.6590% Eb348 G:G 4.1015% Eb542 G:G 2.7720% Eb155 A:G 1.8867% Eb349 G:G 4.1654% Eb543 G:G 2.2051% Eb156 A:G 2.9042% Eb350 G:G 2.9708% Eb544 G:G 3.4902% Eb157 A:G 2.9791% Eb351 G:G 2.5688% Eb545 G:G 3.5981% Eb158 A:G 1.8673% Eb352 G:G 2.8137% Eb546 G:G 3.0715% Eb159 A:G 2.5850% Eb353 G:G 2.1576% Eb547 G:G 2.3747% Eb160 A:G 2.4478% Eb354 G:G 2.4541% Eb548 G:G 3.1323% Eb161 A:G 2.1160% Eb355 G:G 2.6800% Eb549 G:G 2.8015% Eb162 A:G 1.9642% Eb356 G:G 3.0012% Eb550 G:G 4.0743% Eb163 A:G 3.0277% Eb357 G:G 2.3238% Eb551 G:G 3.0930% Eb164 A:G 2.4329% Eb358 G:G 2.1162% Eb552 G:G 2.4869% Eb165 A:G 2.5338% Eb359 G:G 3.1344% Eb553 G:G 3.6977% Eb166 A:G 1.9549% Eb360 G:G 2.4107% Eb554 G:G 2.3311% Eb167 A:G 1.6179% Eb361 G:G 2.5291% Eb555 G:G 2.1591% Eb168 A:G 1.8474% Eb362 G:G 3.6885% Eb556 G:G 2.3820% Eb169 A:G 1.8260% Eb363 G:G 3.1967% Eb557 G: G 4.3241% Eb170 A: G 1.7455% Eb364 G: G 2.7628% Eb558 G: G 2.5371% Eb171 A: G 1.6018% Eb365 G: G 2.9867% Eb559 G: G 2.3771% Eb172 A: G 1.7168% Eb366 G: G 2.1522% Eb560 G: G 2.6658% Eb173 A: G 2.8552% Eb367 G: G 2.3794% Eb561 G: G 2.4915% Eb174 A: G 1.7500% Eb368 G: G 2.3441% Eb562 G: G 2.1607% Eb175 A: G 2.4369% Eb369 G: G 3.2074% Eb563 G: G 2.0401% Eb176 A: G 1.9838% Eb370 G: G 4.4225% Eb564 G: G 2.7000% Eb177 A: G 2.9637% Eb371 G: G 2.0213% Eb565 G: G 2.0320% Eb178 A: G 2.1950% Eb372 G: G 2.3390% Eb566 G: G 2.7367% Eb179 A: G 1.9545% Eb373 G: G 2.7555% Eb567 G: G 2.5507% Eb180 A: G 1.5843% Eb374 G: G 2.8475% Eb568 G: G 2.5839% Eb181 A: G 2.3779% Eb375 G: G 2.7324% Eb569 G: G 2.5878% Eb182 A: G 2.3431% Eb376 G: G 2.0155% Eb570 G: G 3.9101% Eb183 A: G 2.7908% Eb377 G: G 3.1576% Eb571 G: G 2.0624% Eb184 A: G 3.0760% Eb378 G: G 3.7251% Eb572 G: G 2.4884% Eb185 A: G 2.2945% Eb379 G: G 3.2876% Eb573 G: G 2.4405% Eb186 A: G 2.4954% Eb380 G: G 3.1776% Eb574 G: G 2.2407% Eb187 A: G 1.9729% Eb381 G: G 4.0640% Eb575 G: G 2.8310% Eb188 A: G 2.3825% Eb382 G: G 3.6920% Eb576 G: G 2.1766% Eb189 A: G 2.8144% Eb383 G: G 2.8626% Eb577 G: G 2.7678% Eb190 A: G 2.2289% Eb384 G: G 3.3697% [[ID= 3.0721% 1.7778% 2.3671% 2.7703% 2.8661% 3.8136% 2.3602% 2.5527% 2.3080% 2.1672% 2.8721% The experimental results above show that the average content of ligustrazine in the GG genotype of *Erigeron breviscapus* is 2.99%; the average content of ligustrazine in the AA genotype is 2.19%; and the average content of ligustrazine in the AG genotype is 2.2%. The content of ligustrazine in the GG genotype of *Erigeron breviscapus* was significantly higher than that in the AA genotype, increasing by 26.76% (p<0.01). The content of ligustrazine in the GG genotype was also significantly higher than that in the AG genotype, increasing by 26.42% (p<0.01). In other words, the content of ligustrazine in the AA and AG genotypes was significantly lower than that in the GG genotype.
[0032] Since breeding requires stable inheritance of traits, and the offspring of heterozygotes (AG) exhibit phenotypic segregation (producing GG, AG, AA), making it difficult to maintain uniform traits and hindering the selection of ideal *Erigeron breviscapus* varieties, this invention only considers the identification of GG and AA.
[0033] In summary, this invention, through the detection of specific SNP sites using carefully designed primers, can accurately determine the content of ligustrazine in *Erigeron breviscapus*. This technology not only provides accurate genotypic information for molecular breeding but also facilitates the rapid screening of *Erigeron breviscapus* varieties with ideal ligustrazine content. Furthermore, the technical and theoretical support of this invention makes a significant technological contribution to the development of high-content *Erigeron breviscapus* varieties, promoting agricultural technological progress and increasing the content of medicinal plant components.
[0034] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.
Claims
1. A KASP molecular marker associated with ligustrazine in *Lysimachia christinae*, characterized in that, The KASP molecular marker contains the nucleotide sequence of the 4554564th position on chromosome 3A of *Erigeron breviscapus*, wherein the base at position 4554564 is either A or G.
2. The KASP molecular marker associated with scutellarin in *Lysimachia christinae* according to claim 1, characterized in that, The KASP molecular marker is shown in SEQ ID NO.6, where the 101st position is A or G.
3. The primers for the KASP molecular marker associated with ligustrazine in claim 1, characterized in that, It includes forward primer 1, forward primer 2, and a shared reverse primer; The nucleotide sequence of the forward primer 1 is shown in SEQ ID NO. 1; The nucleotide sequence of the forward primer 2 is shown in SEQ ID NO.2; The nucleotide sequence of the shared reverse primer is shown in SEQ ID NO.
3.
4. The primers for the KASP molecular marker associated with ligustrazine in claim 3, characterized in that, It includes forward primer 1 labeled with FAM fluorescence signal, forward primer 2 labeled with HEX fluorescence signal, and a shared reverse primer; The nucleotide sequence of the forward primer 1 labeled with the FAM fluorescent signal is shown in SEQ ID NO.4, and the nucleotide sequence of the forward primer 2 labeled with the HEX fluorescent signal is shown in SEQ ID NO.
5.
5. Detection reagents, detection kits, or test strips containing primers containing the KASP molecular marker associated with scutellarin of *Erigeron breviscapus* as described in claim 3 or 4.
6. The application of the detection reagent, detection kit, or detection strip of the primers for the KASP molecular marker associated with scutellarin in *Erigeron breviscapus* as described in claim 5 in marker-assisted breeding of *Erigeron breviscapus*.
7. A method for identifying the content of ligustrazine in plants, characterized in that, include: Using the DNA of the *Erigeron breviscapus* sample as a template, PCR amplification is performed using primers with the KASP molecular marker associated with lignansin in *Erigeron breviscapus* as described in claim 3 or 4, or using the detection reagent, detection kit, or test strip as described in claim 5. The lignansin content of the plant sample is determined based on the amplification results.
8. The method for identifying the content of scutellarin in plants according to claim 7, characterized in that, include: The polymorphic site is amplified by PCR using the KASP molecular marker associated with scutellarin as described in claim 3 or 4, or by the detection reagent, detection kit, or detection strip as described in claim 5. The polymorphic site is the 4554564th site on chromosome 3A of *Erigeron breviscapus*, with polymorphism A or G. *Erigeron breviscapus* with genotype GG has a high scutellarin content, while *Erigeron breviscapus* with genotype AA has a low scutellarin content.
9. The primers of the KASP molecular marker associated with ligustrazine as described in claim 3 or 4, or the detection reagent, detection kit, or test strip as described in claim 5, in any of the following applications: (1) Used for the identification, breeding and improvement of the content of scutellarin in *Erigeron breviscapus*. (2) Used for early prediction of the high and low content of strychnine in strychnine flower.